CN112501170A

CN112501170A - Method for constructing MLH1 gene knockout cell line

Info

Publication number: CN112501170A
Application number: CN202011375917.1A
Authority: CN
Inventors: 李军; 程扬; 项阳; 赵家顺
Original assignee: Wuhan Abclonal Inc
Current assignee: Wuhan Abclonal Inc
Priority date: 2020-11-30
Filing date: 2020-11-30
Publication date: 2021-03-16

Abstract

The invention relates to a method for constructing an MLH1 gene knockout cell line, and relates to the technical field of genetic engineering. The method is characterized in that a CRISPR/Cas9 system is adopted to prepare an MLH1 gene knockout cell line, firstly, two sgRNA sequences are designed aiming at an MLH1 gene, and a recombinant plasmid is constructed by utilizing a molecular cloning technology; and then transfecting the recombinant plasmid to a HeLa cell, verifying the activity of sgRNA by PCR, performing puromycin drug screening and monoclonality treatment, extracting the genomic DNA and total protein of a monoclonal cell strain, and performing MLH1 gene level sequencing identification and protein level expression detection to obtain an MLH1 gene knockout HeLa cell line. The MLH1 gene knockout HeLa cell line constructed by the invention is a cell line with stable genetic genes. The method provided by the invention can be used for directional knockout of MLH1 gene to inactivate the function of MLH1 gene, has the characteristics of simplicity, high efficiency, rapidness, low cost and the like, and has important significance for research on MLH1 gene function and related pathways.

Description

Method for constructing MLH1 gene knockout cell line

[ technical field ] A method for producing a semiconductor device

The invention relates to the technical field of genetic engineering, in particular to a method for constructing an MLH1 gene knockout cell line.

[ background of the invention ]

DNA mismatch repair genes (MMR) were first found in bacteria and yeast, and later in the human genome, analogs were also found, and studies demonstrated that this gene plays an important role in the pathogenesis of human hereditary non-polyposis colorectal Cancer (HNPCC) and Sporadic colorectal Cancer (SCRC). DNA mismatch repair genes are neither oncogenes nor cancer suppressor genes, and are another class of tumor-associated genes, which is yet another important finding in the molecular mechanism of tumor-associated, following oncogenes and cancer suppressor genes.

hMLH1 is a member of the MMR family, located at 3p21 and is a homologue of the bacterial mismatch repair gene mutL, associated with approximately 30% of HNPCC, hMLH1 has a cDNA full length of 2484bp encoding an open reading frame of 2268bp in length, and hMLH1 protein consists of 756 amino acid residues and is 41% homologous to the yeast mismatch repair gene hMLH 1. hMLH1 may function as a housekeeping gene in colorectal cancer, and in some HNPCC patients hMLH1 gene has a C-T mutation at codon 41, changing the corresponding amino acid residue from serine to phenylalanine. In addition, a loss of heterozygosity between codons 578 and 632 and a loss of 4 nucleotides from the first nucleotide of codon 727 was detected in patients with HNPCC, and in other cases a T insertion was present at codon 519, resulting in a deletion of the carboxyl-terminal 238 amino acid residues of the hMLH1 protein product. In addition, the scholars found a heterohybrid transversion of the T-A at 1151 th base of hMLH1 gene in somatic cells of colorectal cancer patients, resulting in mutation of the amino acid encoded at 384 th position from valine (Val) to aspartic acid (Asp).

Ionow and Aaltonen et al discovered in 1993 that there is a mutation on a microsatellite, called microsatellite instability (MSI), in almost all HNPCC tumors and in sporadic CRC of about 12% to 15%, thus suggesting another novel pathway, the mismatch repair pathway. The basic principle of the method is that once MMR gene is mutated or promoter methylation causes mismatch repair gene inactivation, the mismatch repair function of the organism is reduced, and further the whole genome is unstable, the phenotype of MMR function defect is high microsatellite instability (MSIH), also called Replication Error (RER) positive, so that mutation of certain oncogene and cancer suppressor gene is rapidly accumulated in vivo, and tumors are generated, the DNA of tumor cells is mostly diploid or near diploid content, and in the pathway, two MMR genes of hMLH1 and hMSH2 play a main role.

The loss condition of the mismatch repair gene protein in the prostate cancer cell line is detected by Western Blot blotting, and the expression of the mismatch repair protein in the prostate cancer specimen is detected by an immunohistochemical method so as to discuss the expression of the mismatch repair gene (MMR) protein MLH1 in the prostate cancer cell line and the prostate cancer specimen, and as a result, the mismatch repair gene hMLH1 is found to be deleted in all 8 studied prostate cancer cell lines; the expression of the mismatch repair protein MLH1 is reduced or disappeared in the prostate cancer specimen, and the result shows that the mismatch repair gene hMLH1 is deleted in the occurrence of the prostate cancer, namely the deletion of the mismatch repair gene is directly involved in the occurrence and the development of the prostate cancer.

CRISPR/Cas9 is a gene editing technology developed based on the natural immune mechanism of bacteria, the system is the immune system used by prokaryotes to resist invasion by foreign genetic material. The simplified and modified CRISPR/Cas9 system is a third-generation genome precise editing technology which appears after zinc finger endonuclease (ZFN) and transcription activator-like effector nuclease (TALEN), and consists of two parts, namely, endonuclease Cas9 and gRNA (Guide RNA, gRNA), wherein Cas9 can recognize and combine with a Protospacer Adjacent Motif (PAM) on a genome and form DNA Double-strand unwinding, so that the crRNA part of the gNA can be successfully and complementarily paired with an upstream sequence of the PAM, Cas9 can activate the endonuclease activity of the genome and form Double-strand DNA break (DBS ) at a specific position upstream of the PAM. DBS can activate cellular DNA damage repair mechanisms, Non-homologous End Joining (NHEJ) or homologous recombination-mediated repair (HDR). NHEJ, an error-prone repair, causes random insertions or deletions at the repair site that result in a frameshift mutation such that the gene is no longer expressed, thereby creating a gene knockout. HDR, i.e., precision repair, can mediate gene replacement or insertion by means of exogenously introduced single-or double-stranded DNA as a template, which allows for precise insertion of a DNA sequence into a specific genomic site, thereby completing knock-in or replacement.

At present, reports on knocking out MLH1 gene and constructing an obtained cell line by using a CRISPR/Cas9 system are not found. Therefore, a method for constructing the MLH1 gene knockout cell line is necessarily researched based on the CRISPR/Cas9 system.

[ summary of the invention ]

The invention aims to provide a method for constructing an MLH1 gene knockout cell line, which can knock out an MLH1 gene in cells efficiently, quickly and conveniently, construct an MLH1 gene knockout cell line, and can be used for researching the function, related pathways and drug development of the MLH1 gene.

In view of the above, the present invention provides an sgRNA knockout MLH1 gene, including sgRNA shown in SEQ ID NO: 1 and sgRNA1 as set forth in SEQ ID NO: 2, sgRNA 2.

Another objective of the invention is to provide a recombinant plasmid PX459M-MLH1-sgRNAs of the sgRNA.

The invention also aims to provide a method for constructing the recombinant plasmid PX459M-MLH1-sgRNAs of the sgRNAs, which comprises the following steps:

1. synthesizing a sgRNA DNA sequence with an enzyme cutting site and a complementary sequence thereof based on the sgRNA1 and the sgRNA2, and respectively annealing to obtain two double-stranded DNA fragments of MLH1-sgRNA1 and MLH1-sgRNA 2;

2. respectively carrying out enzyme digestion and recycling on PX459M and EZ-GuideXH two carriers;

3. the two double-stranded DNA fragments are respectively connected with a PX459M and an EZ-guide XH vector which are recovered by enzyme digestion, and product transformation and sequencing identification are carried out to obtain PX459M-MLH1-sgRNA1 and EZ-guide XH-MLH1-sgRNA 2;

4. PX459M-MLH1-sgRNA1 and EZ-guide XH-MLH1-sgRNA2 are subjected to enzyme digestion, the former recovers a vector framework containing MLH1-sgRNA1, the latter recovers a DNA fragment containing MLH1-sgRNA2, and then product ligation is carried out to construct recombinant plasmid PX459M-MLH 1-sgRNAs.

Further, in the step 1: the sgRNA sequence of the sgRNA1 with the enzyme cutting site is SEQ ID NO: 3, the complementary sequence is SEQ ID NO: 4; the sgRNA DNA sequence of the sgRNA2 with the enzyme cutting site is SEQ ID NO: 5, the complementary sequence is SEQ ID NO: 6.

further, the method for transforming and identifying the product in the step 3 comprises the following steps: adding the enzyme-cut vector skeleton and the double-stranded DNA fragment connection product into competent bacteria, supplementing a culture medium, culturing for half an hour, coating on a resistant plate, culturing overnight, selecting a single colony, carrying out amplification culture, harvesting a bacterial liquid, extracting recombinant plasmids, carrying out sequencing identification, and storing correctly identified recombinant plasmids PX459M-MLH1-sgRNA1 and EZ-GuideXH-MLH1-sgRNA 2.

Further, the step 4 is: recovering a vector framework containing MLH1-sgRNA1 for PX459M-MLH1-sgRNA1, recovering a DNA fragment containing MLH1-sgRNA2 for EZ-guide XH-MLH1-sgRNA2, and connecting the recovered enzyme digestion product by using DNA ligase; then, the transformation and identification of the ligation products are carried out in the same step 3, and the recombinant plasmid with correct sequencing identification is named as PX459M-MLH 1-sgRNAs.

The invention also aims to provide application of the recombinant plasmid PX459M-MLH1-sgRNAs in preparation of a MLH1 gene knockout HeLa cell line.

Further, the method for constructing MLH1 gene knockout HeLa cell line by recombinant plasmid PX459M-MLH1-sgRNAs of sgRNAs comprises the following steps:

1) transfecting HeLa cells with recombinant plasmid PX459M-MLH 1-sgRNAs;

2) extracting a transfected cell genome, performing PCR amplification identification aiming at MLH1 gene, and detecting the activity of sgRNA;

3) carrying out puromycin drug screening treatment on the transfected cells, and then carrying out cell monoclonality treatment;

4) extracting the genomic DNA of the monoclonal cell strain, and performing MLH1 gene sequencing identification to obtain an MLH1 gene knockout HeLa cell line.

Further, the method for detecting the activity of the sgRNA in the step 2) comprises the following steps: after recombinant plasmid PX459M-MLH1-sgRNAs transfects HeLa cells, a rat tail genomic DNA detection kit is adopted to detect the genomic DNA of the extracted cells as a template, and the DNA sequence shown in SEQ ID NO: 7 and SEQ ID NO: 8, carrying out PCR amplification on the primers shown in the specification, carrying out agarose gel electrophoresis detection on the amplification products, and judging the activity of the sgRNA by observing and comparing the sizes of the DNA fragments of the control group and the experimental group.

Further, the traditional Chinese medicine screening method in the step 3) comprises the following steps: after HeLa cells are transfected by the recombinant plasmid PX459M-MLH1-sgRNAs, complete medium containing puromycin is added to culture the cells.

Compared with the prior art, the invention has the beneficial effects that:

1. the invention successfully constructs the MLH1 gene knockout HeLa cell line, and the MLH1 gene fragment is deleted to cause gene inactivation, so that the MLH1 protein can not be correctly expressed.

2. The MLH1 gene knockout HeLa cell line constructed by the CRISPR-Cas9 system is used, and the successful construction of the MLH1 gene knockout HeLa cell line 1 strain is determined through gene sequencing identification and Western blot verification.

3. The MLH1 gene knockout HeLa cell line constructed by the invention is large-fragment gene deletion caused on the genome level, so that the MLH1 gene knockout HeLa cell line can be stably inherited to daughter cells along with division and proliferation of the cells.

4. The PX459M-MLH1-sgRNAs plasmid constructed by the invention has puromycin resistance, and puromycin is added to screen cells, so that the positive rate of obtaining MLH1 gene knockout monoclonal cell strains is improved.

5. The method can be used for directional knockout of MLH1 gene to inactivate the function of MLH1 gene, has the characteristics of simplicity, high efficiency, rapidness, low cost and the like, and has important significance for research on MLH1 gene function and related pathways.

[ description of the drawings ]

In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.

FIG. 1 shows the PCR identification result of sgRNA activity detection after PX459M-MLH1-sgRNA plasmid of the invention is transfected into HeLa cells.

FIG. 2 shows the PCR identification result of the MLH1 gene of the monoclonal cell strain after PX459M-MLH1-sgRNAs plasmid of the invention is transfected into HeLa cells.

FIG. 3 shows the sequencing comparison result of the MLH1 gene of the monoclonal cell strain after PX459M-MLH1-sgRNAs plasmid of the invention is transfected into HeLa cells.

FIG. 4 shows the Western-Blotting detection result of the expression of the MLH1 protein of the monoclonal cell strain after PX459M-MLH1-sgRNAs plasmid of the invention is transfected into HeLa cells.

[ detailed description ] embodiments

The following examples are intended to illustrate the invention without limiting its scope. It is intended that all modifications or alterations to the methods, procedures or conditions of the present invention be made without departing from the spirit and substance of the invention.

Example 1: vector construction

1) sgRNA design of MLH1 Gene

Aiming at MLH1 gene (gene name: MLH1, gene ID number: 4292, detailed information of gene is https:// www.ncbi.nlm.nih.gov/gene/:

GATTGGCTGAAGGCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAATGTCGTTCGTGGCAGGGGTTATTCGGCGGCTGGACGAGACAGTGGTGAACCGCATCGCGGCGGGGGAAGTTATCCAGCGGCC, respectively; in the mRNA introduction, the Ensemble website is linked to, and the exon sequences are found and labeled.

Designing sgRNA by using online software (http:// crispor.tefor. net /), inputting the exon sequences, setting and searching to obtain a plurality of sgRNA sequences, and respectively selecting 1 optimal upstream sgRNA sequence from the sgRNA sequences by analyzing the position of the sgRNA on the gene sequence and off-target (off-target) information of the sgRNA, as shown in Seq-1; 1 optimal downstream sgRNA sequence as shown in Seq-2, in particular as shown in table 1:

table 1: target sequence

2) Synthesis of sgRNA fragments and annealing treatment

The sgRNA optimized for the above design was intended to be cloned into PX459M and EZ-guideeXH vectors, respectively. The sgrna dna sequence was added to the cohesive end of the Bbs1 restriction enzyme and sent to the obendaceae biosynthetic single nucleotide chain.

Adding a joint to the Seq-1 sequence to synthesize an insert MLH1-sgRNA 1:

Seq-1F：5’-CACCGCCAGGATGCTCTCCTCGTGC(SEQ ID NO：3)

Seq-1R：5’-AAACGCACGAGGAGAGCATCCTGGC(SEQ ID NO：4)；

adding an adaptor to the Seq-2 sequence to obtain an insert MLH1-sgRNA 2:

Seq-2F：5’-CACCGCTGGGTGAAGTACATCCTGG(SEQ ID NO：5)

Seq-2R：5’-AAACCCAGGATGTACTTCACCCAGC(SEQ ID NO：6)；

and (2) mixing each group of Seq-F and Seq-R in equal volume respectively to carry out annealing reaction, wherein an annealing reaction system comprises 4.5 mu L of each primer shown by the Seq-F and the Seq-R with the concentration of 100 mu M and 21 mu L of 10 XNEB Buffer, placing the primers in a PCR instrument for reaction, and the reaction procedure is that the primers react for 5min at 95 ℃, and then the temperature is reduced to 25 ℃ at the speed of 5 ℃/30s to obtain a double-stranded DNA fragment of the sgRNA, wherein the double-stranded DNA fragment can be connected with an enzyme digestion carrier at the moment or stored at the temperature of-20 ℃ for later use.

3) Digestion and recovery of the vector

Taking 2 mu g of PX459M carrier and EZ-guideeXH carrier4 mu g of the protease is cut by Bbs1 respectively, and the cutting system is as follows: PX459M 2 μ G, Bbs 11 μ L, 10 XBuffer G2 μ L, plus ddH₂O complement to 20. mu.L, and EZ-GuideXH 4. mu.g, Bbs 11. mu.L, 10 XBuffer G2. mu.L, plus ddH₂O make up to 20. mu.L. Respectively and uniformly mixed, and then reacted in water bath at 37 ℃ for 2-4 hours. And (3) recovering and purifying the enzyme digestion product by using an agarose DNA recovery kit, wherein the specific experimental steps are shown in the specification of the agarose DNA recovery kit.

4) Two MLH1-sgRNA fragments were ligated to DNAs of PX459M and EZ-guideXH vectors, respectively

The following reagents were added to sterile 1.5mL EP tubes, respectively: digested PX459M 50ng, 2 Xquick Ligation buffer 10. mu. L, MLH1-sgRNA 137.5 ng, DNA ligase 1. mu.L, and dd H₂O complement system to 20 μ L; EZ-guideXH 50ng, 2 XQuick Ligation buffer 10. mu. L, MLH1-sgRNA 237.5 ng, DNA ligase 1. mu.L, plus dd H₂O complement system to 20 μ L; respectively mixing uniformly and reacting in water bath at 25 ℃ for 5 min.

5) Ligation product transformation and colony PCR identification

Adding 5 μ L of the ligation product into 50uL of competent bacteria, and standing on ice for 30 min; heating in 42 deg.C water bath for 90s, and standing on ice for 5 min; adding 1mL of antibiotic-free culture medium, and performing shaking culture at 37 ℃ for half an hour; coating the bacterial liquid on a resistant plate, and placing the resistant plate in a constant-temperature incubator at 37 ℃ for inverted culture overnight; and selecting a single colony for amplification culture, harvesting a bacterial liquid to extract recombinant plasmids, then carrying out sequencing identification, and storing and identifying correct recombinant plasmids PX459M-MLH1-sgRNA1 and EZ-guideXH-MLH1-sgRNA 2.

6) Construction of recombinant plasmid PX459M-MLH1-sgRNAs

Recombinant plasmids PX459M-MLH1-sgRNA1 and EZ-guideXH-MLH1-sgRNA2 were double digested with Spe1 and Kpn1, respectively. The enzyme cutting system is as follows: PX459M-MLH1-sgRNA 12. mu.g, Spe 11. mu. L, Kpn 11. mu.L, 10 XBuffer Tango 2. mu.L, plus dd H₂O complement to 20. mu.L, and EZ-GuideXH-MLH1-sgRNA 25. mu.g, Spe 12. mu. L, Kpn 12. mu.L, 10 XBuffer Tango 2. mu.L, plus dd H₂Adding O to 20 μ L, reacting in 37 deg.C water bath for 2-4 hr, running 1% agarose gel, cutting gel, and recovering enzyme digestion vector. For PX459M-MLH1-sgRNA1 plasmid, cutting gel and recovering a vector framework containing a sgRNA1 double-stranded DNA fragment; for the EZ-GuideXH-MLH1-sgRNA2 plasmid, the sgRNA2 double-stranded DNA fragment was recovered by cutting the gel. Then using a DNA ligase kit to connect the enzyme digestion product after glue recovery, wherein a Ligation reaction system comprises PX459M-MLH1-sgRNA 150 ng after enzyme digestion, EZ-guideXH-MLH1-sgRNA 237.5ng after enzyme digestion, 1 mu L of 2 Xquick Ligation buffer 10 mu L, DNA ligase and dd H₂And O is added to the system to 20 mu L, mixed evenly and reacted in water bath at 25 ℃ for 5 min. Then, the step 5) is carried out to transform and identify the ligation product, and the recombinant plasmid PX459M-MLH1-sgRNAs with correct sequencing identification are preserved and identified.

Example 2 preparation of MLH1 Gene knockout HeLa cell line

HeLa cells transfected with PX459M-MLH1-sgRNAs

1) Cells were seeded on 12-well plates, and HeLa cells (from wuhan kino life technologies ltd., cat #: CL-0101) suspension at 2.5X 10⁵Inoculating the cell number per well, uniformly spreading the cell number per well into 2 wells of a 12-well plate, respectively supplementing 1mL of complete culture medium (containing 10% fetal calf serum and 1% double antibody), and placing the cell culture box for culture for 12-16 hours;

2) preparing a transfection compound, taking out 2 sterile EP tubes, respectively adding 50 mu L of serum-free antibiotic-free DMEM basal medium, adding 3 mu g of PX459M-MLH1-sgRNAs recombinant plasmids (experimental group) into the 1 st sterile EP tube, adding 3 mu g of PX459M-GFP plasmids (control group) into the 2 nd sterile EP tube, and uniformly mixing to obtain solution A; taking out 1 sterile EP tube, adding 100 μ L serum-free and antibiotic-free DMEM culture medium, adding 12 μ L HighGene transfection reagent, and mixing to obtain solution B;

3) respectively taking out 50 μ LB solution, slightly dropping into solution A, mixing well (blowing with gun for 3-5 times) with total volume of 100 μ L, standing at room temperature for 15-20 min;

4) the A/B mixed solution is gently dripped into the corresponding 12-hole plate, the cell culture plate is gently shaken back and forth, and then the 12-hole plate is put back into the cell culture box for continuous culture.

5) After 4-6 hours of cell transfection, half of the fresh complete medium was replaced and culture was continued for 24 hours.

2. Puromycin drug screening

1) After the cell transfection is carried out for 24 hours, observing whether a control group has green fluorescence under a fluorescence microscope, and if so, indicating that the cell transfection is successful;

2) adding fresh complete culture medium containing puromycin medicine with final concentration of 1.6 mu g/mL into cells of an experimental group and cells of a control group respectively;

3) after the puromycin is screened for 24 hours, replacing a fresh complete culture medium containing puromycin with the same concentration as the puromycin to continue cell culture;

4) after 48 hours of puromycin screening, massive cell death floating of a control group is observed under a microscope, 40% -50% of death floating of an experimental group is observed, and puromycin screening is stopped.

Detection of sgRNA Activity

1) Using pancreatin to digest the cells of the control group and the experimental group, and collecting 30-50% cell suspension;

2) extracting genomes of a control group and experimental cells by using a rat tail genome detection kit;

3) PCR amplification was performed using the extracted genomic DNA of the cells as a template with the following primers:

seq-F：5’-GCTTTTTCTCCCCCTCCCACT(SEQ ID NO：7)

seq-R：5’-GACCCTCCACTGCACCCTGT(SEQ ID NO：8)；

the PCR reaction system included 2 Xmix 10. mu.L of each of the primers Seq-F and Seq-R at a concentration of 10. mu.M, 0.5. mu.L of each of the primers Seq-F and Seq-R, 1. mu.L of the template DNA, and ddH₂O8 mu L; the PCR reaction program is pre-denaturation reaction at 95 ℃ for 5 min; denaturation reaction at 95 ℃ for 10s, annealing reaction at 60 ℃ for 10s, extension reaction at 72 ℃ for 20s, and 30 cycles; further extension at 72 deg.C for 5 min;

4) the amplified products were detected by agarose gel electrophoresis, and the sgRNA activity was determined by observing and comparing the band sizes of the amplified products of the control and experimental groups, as shown in FIG. 1, lane 1 is DL2000Marker, lane 2 is normal HeLa cell (control group), and lane 3 is HeLa cell transfected with PX459M-MLH1-sgRNAs plasmid.

4. Cell monoclonality culture

1) Discarding a cell culture medium of a 12-well plate experimental group, rinsing cells by PBS, adding 0.5mL of pancreatin digested cells, then adding 1mL of complete culture medium to terminate digestion, and re-suspending the cells;

2) after the cells are evenly resuspended, 200 mu L of cell suspension is taken out to be put into an EP tube, and a blood counting chamber is used for counting;

3) taking 500 cells out of the cell suspension, adding the cells into 20mL of complete culture medium, simultaneously supplementing 1mL of clone-easy growth factor solution, and uniformly mixing the cells;

4) spreading the cell suspension into 2 96-well culture plates by using a discharging gun, wherein each well is 100 mu L;

5) after 10 days of cell culture, the growth of the cells was observed under a microscope to mark the monoclonal cell colonies.

5. Gene level verification of monoclonal cell strain

1) When the monoclonal cell density grows to 50-60% of the area of the bottom of the hole, using pancreatin to digest the cells, taking out 50% of the cells to an EP tube, extracting cell genomes to carry out gene sequencing verification, and continuously culturing and amplifying the remaining 50% of the cells in a 96-well plate;

2) PCR amplification was performed using the extracted genomic DNA of the cells as a template with the following primers:

seq-F：5’-GCTTTTTCTCCCCCTCCCACT(SEQ ID NO：7)

seq-R：5’-GACCCTCCACTGCACCCTGT(SEQ ID NO：8)；

the PCR reaction system comprises 2 xMix 10 muL, 0.5 muL of each of the primers shown by Seq-F and Seq-R with the concentration of 10 muM, 1 muL of template DNA and 8 muL of ddH2O 8; the PCR reaction program is: performing pre-denaturation reaction at 95 ℃ for 5 min; denaturation reaction at 95 ℃ for 10s, annealing reaction at 60 ℃ for 10s, extension reaction at 72 ℃ for 20s, and 30 cycles; further extension at 72 deg.C for 5 min;

4) carrying out agarose gel electrophoresis detection on the amplification product, and comparing the size of the band of the amplification product with that of a control group to judge whether the monoclonal cell strain is targeted; as shown in FIG. 2, lane 1 is DL2000Marker, lane 2 is normal HeLa cells (control group), and lane 3 is MLH1 gene knock-out HeLa-MLH1-KO monoclonal cells.

5) And cutting the gel, recovering the targeted PCR amplification product, sequencing, identifying positive cells through sequencing comparison, carrying out amplification culture on the positive cells, freezing and preserving seeds, and naming the cells as HeLa-MLH1-KO, wherein the comparison chart of the sequencing result is shown in figure 3.

Western Blot for detecting expression condition of monoclonal cell strain MLH1 protein

In order to verify the knockout effect of MLH1 gene, the expression condition of MLH1 protein in a HeLa cell line knocked out by MLH1 gene is detected by Western Blot experiment.

1) Cell collection: digesting the HeLa-MLH1-KO monoclonal cells and normal HeLa cells by using pancreatin, collecting the cells into a 1.5mL centrifuge tube, centrifuging, removing supernate, and reserving cell precipitates;

2) cell lysis: adding RIPA lysis buffer containing protease inhibitor, performing lysis on ice for 30min, performing centrifugation for 15min at 12000r/min, taking supernatant, transferring to a new 1.5mL centrifuge tube, and determining protein concentration;

3) preparing a cell sample: mixing the cell total protein supernatant with appropriate amount of 5 xSDS protein sample buffer solution to make the final concentration of cell total protein 2mg/mL, boiling at 95 deg.C for 5 min;

4) electrophoresis: preparing 10% SDS-PAGE gel, and performing electrophoretic separation of protein, wherein the voltage is 80V and the time is 30 minutes when the gel is concentrated, and the voltage is 120V and the time is 1 hour when the gel is separated;

5) film transfer: adopting a wet transfer method, performing constant current of 240mA, and transferring the film for 2 hours;

6) and (3) sealing: the membrane was incubated for 2 hours at room temperature using TBST solution of 5% skimmed milk powder at final concentration;

7) primary antibody incubation: primary anti-MLH 1 mAb (ABClonal: A4858) was diluted 1:1000 in TBST solution of 5% skimmed milk powder at final concentration and incubated overnight at 4 ℃;

8) and (3) secondary antibody incubation: prior to incubation of the secondary antibody, the membrane was washed 3 times for 10 minutes each using TBST; the secondary antibody PeroxideAffiniPure Goatanti-Rabbit IgG (H + L) (Jackson: 111-;

9) exposure imaging: membranes were washed 3 times for 10 minutes each using TBST. And uniformly mixing equal amounts of ECL developing solution A and solution B, and imaging by using a gel imager.

The results show that: no MLH1 protein signal was detected in HeLa-MLH1-KO monoclonal cells, indicating that the monoclonal cells achieved MLH1 gene knock-out at the protein level. In particular, as shown in FIG. 4, lane 1 shows normal HeLa cells, and MLH1 protein signal was detected; lane 2 shows HeLa-MLH1-KO monoclonal cells with MLH1 gene knockout, and no MLH1 protein signal was detected.

The MLH1 gene knockout HeLa cell line constructed by the CRICPR/Cas9 system edits the MLH1 gene at the DNA level, completely silences the expression of MLH1 protein, and provides a practical tool for the function research of the MLH1 gene.

Sequence listing

<110> Wuhan Ebola Biotech Co., Ltd

<120> a method for constructing MLH1 gene knockout cell line

<141> 2020-11-25

<160> 8

<170> SIPOSequenceListing 1.0

<210> 5

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 5

ccaggatgct ctcctcgtgc 20

<210> 2

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 2

ctgggtgaag tacatcctgg 20

<210> 3

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 3

caccgccagg atgctctcct cgtgc 25

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 4

aaacgcacga ggagagcatc ctggc 25

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 5

caccgctggg tgaagtacat cctgg 25

<210> 6

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 6

aaacccagga tgtacttcac ccagc 25

<210> 7

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 7

gctttttctc cccctcccac t 21

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 8

gaccctccac tgcaccctgt 20

Claims

1. An MLH1 gene knock-out sgRNA comprising the sequence as shown in SEQ ID NO: 1 and sgRNA1 as set forth in SEQ ID NO: 2, sgRNA 2.

2. The recombinant plasmid PX459M-MLH1-sgRNAs of the sgRNA of claim 1.

3. The method of claim 2 for constructing recombinant plasmid PX459M-MLH1-sgRNAs, comprising the steps of:

s1, synthesizing a sgRNA DNA sequence with an enzyme cutting site and a complementary sequence thereof based on the sgRNA1 and the sgRNA2, and respectively annealing to obtain two double-stranded DNA fragments MLH1-sgRNA1 and MLH1-sgRNA 2;

s2, respectively carrying out enzyme digestion and recycling on PX459M and EZ-guideXH two carriers;

s3, connecting the two double-stranded DNA fragments with a PX459M and an EZ-guide XH vector which are recovered by enzyme digestion respectively, and performing product transformation and sequencing identification to obtain PX459M-MLH1-sgRNA1 and EZ-guide XH-MLH1-sgRNA 2;

s4, carrying out enzyme digestion on PX459M-MLH1-sgRNA1 and EZ-guide XH-MLH1-sgRNA2, recovering a vector framework containing MLH1-sgRNA1 from the former, recovering a DNA fragment containing MLH1-sgRNA2 from the latter, and then carrying out product ligation to construct a recombinant plasmid PX459M-MLH 1-sgRNAs.

4. The method for constructing recombinant plasmids of sgRNA1, sgRNA2 according to claim 3, characterized in that in step S1: the sgRNA sequence of the sgRNA1 with the enzyme cutting site is SEQ ID NO: 3, the complementary sequence is SEQ ID NO: 4; the sgRNA sequence of the sgRNA2 with the enzyme cutting site is SEQ ID NO: 5, the complementary sequence is SEQ ID NO: 6.

5. the method for constructing recombinant plasmids of sgRNA1, sgRNA2 of claim 3, wherein the method for transforming and identifying the product in step S3 is: adding the enzyme-cut vector skeleton and the double-stranded DNA fragment connection product into competent bacteria, supplementing a culture medium, culturing for half an hour, coating on a resistant plate, culturing overnight, selecting a single colony, carrying out amplification culture, harvesting a bacterial liquid, extracting recombinant plasmids, carrying out sequencing identification, and storing correctly identified recombinant plasmids PX459M-MLH1-sgRNA1 and EZ-Guide XH-MLH1-sgRNA 2.

6. The method for constructing recombinant plasmid PX459M-MLH1-sgRNAs of sgRNA of claim 3, wherein said step S4 is: recovering a vector framework containing MLH1-sgRNA1 for PX459M-MLH1-sgRNA1, recovering a DNA fragment containing MLH1-sgRNA2 for EZ-guide XH-MLH1-sgRNA2, and connecting the recovered enzyme digestion product by using DNA ligase; then the transformation and identification of the ligation product are carried out in the same step S3, and the recombinant plasmid with correct sequencing identification is named as PX459M-MLH 1-sgRNAs.

7. The use of the recombinant plasmid PX459M-MLH1-sgRNAs of claim 2 in the preparation of MLH1 gene knockout HeLa cell lines.

8. The method for constructing MLH1 gene knockout HeLa cell line by using recombinant plasmid PX459M-MLH1-sgRNAs as claimed in claim 2, which comprises the following steps:

t1, transfecting HeLa cells by using a recombinant plasmid PX459M-MLH 1-sgRNAs;

t2, extracting a transfected cell genome, performing PCR amplification identification aiming at MLH1 gene, and detecting the activity of sgRNA;

t3, screening puromycin drugs for transfected cells, and then performing cell monoclonality treatment;

and T4, extracting the genomic DNA of the monoclonal cell strain, and performing MLH1 gene sequencing identification to obtain an MLH1 gene knockout HeLa cell line.

9. The method according to claim 8, wherein the sgRNA activity in step T2 is detected by: after HeLa cells are transfected by recombinant plasmids PX459M-MLH1-sgRNAs, extracting genomic DNA of the cells by using a rat tail genomic DNA detection kit as a template, and performing PCR amplification by using a DNA sequence shown in SEQ ID NO: 7 and SEQ ID NO: 8, carrying out PCR amplification on the primers shown in the specification, carrying out agarose gel electrophoresis detection on the amplification products, and judging the activity of the sgRNA by observing and comparing the sizes of the DNA fragments of the control group and the experimental group.

10. The method of claim 8, wherein the step T3 is performed by adding puromycin-containing complete medium to the recombinant plasmid PX459M-MLH1-sgRNA transfected HeLa cells.