CN112442491A

CN112442491A - Clone expression and purification method of silkworm chorion peroxidase gene and application thereof

Info

Publication number: CN112442491A
Application number: CN202011376464.4A
Authority: CN
Inventors: 贺真; 吴凡; 李德臣; 陈登松; 郝瑜
Original assignee: Institute of Economic Crop of Hubei Academy of Agricultural Science
Current assignee: Institute of Economic Crop of Hubei Academy of Agricultural Science
Priority date: 2020-12-03
Filing date: 2020-12-03
Publication date: 2021-03-05

Abstract

The invention discloses a clone expression and purification method of silkworm chorion peroxidase gene and application thereof, belonging to the technical field of biological engineering, and the method comprises the steps of constructing a vector containing His label, obtaining a chorion peroxidase full-length coding sequence by a PCR method through gene specific primers, inoculating BL21 bacterial liquid containing pET28a-Cp recombinant expression vector into LB liquid culture medium containing Kanamycin, and carrying out shake culture at 37 ℃ for overnight. Respectively taking 1ml of bacterial liquid before and after induction, separating and collecting bacterial precipitates, and washing the precipitates by PBS; after determining that the protein is expressed in the supernatant, the supernatant is passed through a Ni-NTA gel column. The invention clones and expresses chorion peroxidase gene, and deeply researches the function of the gene in ovarian development, and the result shows that after the gene is interfered, female moths have less spawning and follicular cells have abnormal development.

Description

Clone expression and purification method of silkworm chorion peroxidase gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to a method for cloning, expressing and purifying a cultivated silkworm chorion peroxidase gene and application thereof.

Background

The silkworm is one of the economic insects for spinning and cocooning, which uses mulberry leaves as foodstuff. The silkworm belongs to Lepidoptera, Bombycidae, and has the scientific name of Bombyx mori Linnaeus. The silkworm originates from China, is domesticated from an original silkworm inhabiting a mulberry in ancient times, is homologous with a wild silkworm eating the mulberry in China, and has 28 pairs of chromosomes. Silkworm moth larvae eat mulberry leaves, and a large amount of silk for cocooning is discharged before pupation, which is an important textile raw material. Silkworm is a completely metamorphotic insect and passes through four development stages which are completely different in morphology and physiology, such as eggs, larvae, pupae, imagoes and the like in life. The eggs are the stages of embryogenesis, development and formation of larvae, the larvae are the growth stages for taking in food nutrition, the pupae are the metamorphosis stages for transition from larvae to adults, and the adults are the reproduction stages for mating, oviposition and reproduction of offspring. The whole generation only feeds in the larval stage and accumulates nutrition for the life activities of pupa and adult stages.

Silkworm is one of the most important economic insects in ancient China. In the process of silkworm breeding, the egg laying amount is a key factor. Research results in the prior art show that the speed of silkworm egg laying is related to both variety and environment. Such as the maturity of female moths, the length of mating time, the temperature during spawning, the illumination during spawning, short-time low-temperature treatment before mating, slant spawning and the like all influence the spawning speed. The chorion peroxidase gene of silkworms was found in subsequent studies, and the function of the gene in silkworms has not been known so far.

Disclosure of Invention

The invention aims to provide a clone expression and purification method of silkworm choion peroxidase gene and application thereof, wherein the method clones and expresses the choion peroxidase gene and deeply researches the function of the gene in ovarian development, and the result shows that after the gene is interfered, female moth spawning is reduced, and follicular cell dysplasia is caused.

The technical scheme is as follows:

a method for cloning, expressing and purifying a cultivated silkworm chorion peroxidase gene comprises the following steps:

step 1, constructing a His-tag-containing vector, and obtaining a chorion peroxidase full-length coding sequence (amino acid residues 1-780) by a PCR method by using a gene specific primer, wherein the primer sequence is shown as SEQ: ID: NO: 1-SEQ: ID: NO: 2, respectively. The upstream primer contains a BamH I cleavage site, the downstream primer contains a Sac I cleavage site, and the full length containing the cleavage site is connected with a pET28a vector containing a stop codon to prevent frame shift mutation. And screening and cloning by using double enzyme digestion, sequencing, analyzing a sequencing result, and storing the bacterial liquid containing the transgenic plasmid after confirming that no amino acid mutation exists. Coli BL21 competent cells were transformed to obtain strains that could express Cp protein.

And 2, inoculating BL21 bacterial liquid containing the pET28a-Cp recombinant expression vector into an LB liquid culture medium containing Kanamycin, and carrying out shake culture at 37 ℃ overnight. Inoculating overnight bacteria solution into fresh LB liquid medium containing Kanamycin at a ratio of 1: 100, and shake-culturing at 37 deg.C for about 3 hr to OD₆₀₀When the concentration is 0.4-0.6, the shaking culture is continued to induce protein expression for 6h after IPTG is added to a final concentration of 0.8 mM.

And 3, respectively taking 1ml of bacterial liquid before and after induction, separating and collecting bacterial precipitates, and washing the precipitates by PBS. Add 80. mu.l PBS and 20. mu.l 5 XSDS loading buffer and boil at 100 ℃ for 10 min. Samples were loaded with protein marker and subjected to polyacrylamide gel electrophoresis (12% strength protein gel). Whether the protein induction expression is successful or not is determined by Coomassie brilliant blue staining, and the molecular weight of the protein is judged. And after the successful protein expression is determined, carrying out ultrasonic wave crushing on the induced bacterial liquid to respectively obtain a supernatant and a precipitate, and then carrying out SDS-PAGE to determine whether the protein is expressed in the supernatant or the precipitate.

And 4, determining that the protein is expressed in the supernatant, and passing through a Ni-NTA gel column. The eluate after passing through the column was subjected to SDS-PAGE to detect the concentration of the recombinant protein. -80 degrees preservation of the recombinant protein samples.

The cultivated silkworm chorion peroxidase gene obtained by the method is applied to the preparation process of the reagent for regulating the egg laying amount of female moths.

The invention has the beneficial effects that:

the invention clones and expresses chorion peroxidase gene, and deeply researches the function of the gene in ovarian development, and the result shows that after the gene is interfered, female moths have less spawning and follicular cells have abnormal development. The research result of the invention shows that the egg laying amount is reduced after the gene is interfered, which shows that the gene has influence on the egg laying of the silkworm, thereby influencing the number of offspring individuals. Therefore, if the gene is over-expressed into the silkworm body, the egg laying amount of the silkworm can be increased, so that the number of the offspring individuals can be increased, the economic character of the silkworm can be finally improved, more silkworm cocoons can be obtained, and the income of farmers can be improved.

Drawings

FIG. 1 signal peptide analysis diagram.

FIG. 2 is a phylogenetic tree diagram.

FIG. 3 is a graph showing egg laying amount.

Detailed Description

The technical solution of the present invention will be described in further detail with reference to specific embodiments.

Cloning, expression and purification of chorion peroxidase (cp) Gene

Constructing a His tag-containing vector, and obtaining a full-length coding sequence (amino acid residues 1-780) of chorion peroxidase by a PCR method by using gene-specific primers, wherein the primer sequences are as follows: the upstream primer cp-BamH I: 5'-GGATTCATGAATTTCAAAAGCTTCATTTTG-3', downstream primer cp-Sac I: 5'-GAGCTCGTCTAAATTCCGCGAGTTTTGA-3' are provided. The upstream primer contains a BamH I cleavage site, the downstream primer contains a Sac I cleavage site, and the full length containing the cleavage site is connected with a pET28a vector containing a stop codon to prevent frame shift mutation. And screening and cloning by using double enzyme digestion, sequencing, analyzing a sequencing result, and storing the bacterial liquid containing the transgenic plasmid after confirming that no amino acid mutation exists. Coli BL21 competent cells were transformed to obtain strains that could express Cp protein.

BL21 bacterial liquid containing the pET28a-Cp recombinant expression vector was inoculated into LB liquid medium containing Kanamycin, and cultured overnight at 37 ℃ with shaking. Inoculating overnight bacteria solution into fresh LB liquid medium containing Kanamycin at a ratio of 1: 100, and shaking at 37 deg.CCultured for about 3h to OD₆₀₀When the concentration is 0.4-0.6, the shaking culture is continued to induce protein expression for 6h after IPTG is added to a final concentration of 0.8 mM.

1ml of the bacterial solution before and after induction was taken separately to collect the bacterial pellet, and the pellet was washed with PBS. Add 80. mu.l PBS and 20. mu.l 5 XSDS loading buffer and boil at 100 ℃ for 10 min. Samples were loaded with protein marker and subjected to polyacrylamide gel electrophoresis (12% strength protein gel). Whether the protein induction expression is successful or not is determined by Coomassie brilliant blue staining, and the molecular weight of the protein is judged. And after the successful protein expression is determined, carrying out ultrasonic wave crushing on the induced bacterial liquid to respectively obtain a supernatant and a precipitate, and then carrying out SDS-PAGE to determine whether the protein is expressed in the supernatant or the precipitate.

After determining that the protein is expressed in the supernatant, the supernatant is passed through a Ni-NTA gel column. The eluate after passing through the column was subjected to SDS-PAGE to detect the concentration of the recombinant protein. -80 degrees preservation of the recombinant protein samples.

Functional study of chorion peroxidase

After the cDNA sequence is translated into a protein sequence, sequences in other species with higher similarity are obtained through Blast alignment, and a phylogenetic tree is constructed through MEGA 7.

Designing a primer containing dsBm-cp and dsEGFP, wherein the sequence of the dsBm-cp upstream primer is as follows: 5 '-TAATACGACTCACTATAGGGAGAATGAATTTCAAAAGCTTCATTTTG' -3, and the sequence of the downstream primer is as follows: 5 '-TAATACGACTCACTATAGGGAGAGTATCAGCAGAAGCTTGTAGA' -3, the dsEGFP upstream primer is: 5 '-TAATACGACTCACTATAGGGAGAATGGTGAGCAAGGGCGAG' -3, and the downstream primer is 5 '-TAATACGACTCACTATAGGGAGATTACTTGTACAGCTCGTCCATGC' -3. After obtaining the primers, dsRNA was synthesized by the kit. The silkworms in pupa stage 8 days are placed on ice for 5-10min, and injected into the middle position of the abdomen of the pupa by a micro-injector, and each pupa is injected with 20 mu g of Bm-cp dsRNA. EGFP dsRNA was used as a control. The number of worms in each treatment combination control group was 80, and collection of injection test and control (Mock) material was performed after 24h, 48h, 72h and 96 h. After dsRNA injection, the phenotype of the silkworm pupae and the change condition of the reproductive development related process are observed, and the experiment is repeated for 3 times.

1. By clone sequencing, the sequence of the cDNA of chorion peroxidase was obtained as follows:

ATGAATTTCAAAAGCTTCATTTTGCTCTTAATTAATGTGTTCTTATTGAGTGTCATTGAGGATAGTTCTTGTCACGTTTACGAAGGCAGCGCACGTGAGGCCTCAGAACACATTCACGTACAAGAGCGACCATGCGCCGTCTGCCCCAGAGGCGGGAAGTGTGTCCCGAAGGTCAAATGTCCGGCCCACGTCAGACCGGGATCGTTGAATCCGACCTGCCACTTGGTCCTTGGACATATCGGTATCTGCTGCTTCACCGGGCAAAAGCATTCAGCCCAATTAGAATCTACTCAGCGTTCTGGCGCCATCAGTATAGAAGACATTAAAAGCAGCCATGACGTATCAAGGCAGAAAATGGTCCAGTGGATAGCGAACGAGAAAGTTCTAGAACGTTCTGCTGATACAATCGTCAGTAGTTCGGCACCTAGTTACGGGCATCATTTGTCCATGGTTACGTACGACAAGAGAGTTGAGGGTCTTGGACGTGGTGGACTGTTGAACGTCTTCGCTGCTCTGGAACTGAAGTCTCGGCAGGCGGTCTCTGATGATGAGCTGGAGTTGGGAGCAACAGGACATACTGATGGTCCCTTTTGCCCTAAGCCCCCGCAGTGCCCGGATACCCAAAGCCGGTACAGATCTATAGATGGGGAGTGCAACAATCTGGCCAACCCAACGTGGGGAGCTGTCAATACTGGCTTCGAGAGGCTTCTACCACCAGATTATAGTGACGGCGTGTGGGCAATGAGAGTCTCCGCAGCAGGTAATCCCCTTCCGAGCGCGAGGGTGGTCAGCAGCGTTCTCCTGCCAGAAGGAAACCATCCAAGTCCCACACACAACCTCATGTTCATGCAGTTTGGACAGTTTATAGCACACGACACCAGCGCTGGAGTTATGTTCGCATCGGGTAACAACACTGGAATATCCTGTTGCGCTGAAGACGGTGTGGACCAGCTGCATCCGAAGCAGCAGCACTGGGCCTGTGCTCCAATCACCGCAGTTCCCGATGACCCTTTCTATGGTTTCTTTGGTCAGAAATGCCTCAATTTCGTGCGCACACAACTCGCACCAGCCAGCGATTGTTCCGTTGGCTATGCCAAGCAAATGAATGGCGCCACGCATTACCCTGATTTGTCTCACTTATACGGCACCTTTCCCGAAAAACTCTCATTGGTGCGCGGCGAGGGAGGGTTTCTGAAGACATTCAATGACTTTGGCAGAGCCCTCCCACCTTTGACTAAGAGAAGAGAATGCGTTAATATGGATGGTGGTAGCCCTTGCTTTGAATCAGGAGACAGTCACGGGAATCAGTTCATCTCACTGACAGCATTCCACACGTTATGGTCGAGGGAGCACAACCGAGTCGCGCAAGCCCTGTCGAGGTTGAACCCTCATTGGGACGAAGACACAGTCTTTATGGAGACCAGAAGGATACTGCAGGCAGAATTCCAGCATATCATTTATAATGAGTGGCTTCCTCTATTGATAGGTCACCAAATGATGCAGCTCTTCAATTTATCTCCATCTTCAGAGTATTCCTCGTCGTACGATCCAACAGTCAATCCGTCTATTACAGCAGAATTCGCGACCGCAGCCATGAGATTTGGCCACTCCATTGTTGATGGAAGAATTGTAATTCCCAACACGAAAACAGGAGAAGTTCACGAGACCATATCGATACCGGAAGTGATGTTTCAGCCGTCGAGAATGCGGCTACGTCACTTCTTGGATCGGCTGCTGATTGGCCTGACGCTGCAACCGATGCAGAGTGTCGATCCGTTTATCTCTGAAGGGCTTACGTCCTACATGTTCCGTGGCACCAACCCCTATGGCCTGGATCTAGCGTCAATAAACATTCAACGCGGCAGAGACTACGGAGTCAGATCCTACAATAGCTACCGGCGCTTGTGTGGGCTTCAGCCATTTGAAAGCTTCGAGCAATTTCCACAAAGTGCTGCAAAGCGTCTAGCGTCTGTCTACGAGAGTCCGGAATACATAGACCTTTGGGTTGGAGGTCTGCTGGAGGCGCCGATGGAAGAGGCAGTTATCGGGCCAACTTTCGCTCATATCATAGCCGACCAATTCTACAGGCTCAAGGCTGGAGATAGATACTTCTACGATAATGGTCCTGATATAAATCCCGGCGCTTTTACTCCAAGCCAACTGACAGAAATAAAGAAGGTTAAACTATCAAGACTGATTTGTGACAATAGCGATGGTATAGAACTTGTAACCCAGCCAGTTGAAGCCTTTTATAGAGCAGACCTACCAGGAAATGAATTAGTGGCTTGCAACAGTGGACGCATACCTTTTATGGATTTGAGCAGATTTAAGGCGCTCAAAACTTAA

chorion peroxidase protein sequences

MNFKSFILLLINVFLLSVIEDSSCHVYEGSAREASEHIHVQERPCAVCPRGGKCVPKVKCPAHVRPGSLNPTCHLVLGHIGICCFTGQKHSAQLESTQRSGAISIEDIKSSHDVSRQKMVQWIANEKVLERSADTIVSSSAPSYGHHLSMVTYDKRVEGLGRGGLLNVFAALELKSRQAVSDDELELGATGHTDGPFCPKPPQCPDTQSRYRSIDGECNNLANPTWGAVNTGFERLLPPDYSDGVWAMRVSAAGNPLPSARVVSSVLLPEGNHPSPTHNLMFMQFGQFIAHDTSAGVMFASGNNTGISCCAEDGVDQLHPKQQHWACAPITAVPDDPFYGFFGQKCLNFVRTQLAPASDCSVGYAKQMNGATHYPDLSHLYGTFPEKLSLVRGEGGFLKTFNDFGRALPPLTKRRECVNMDGGSPCFESGDSHGNQFISLTAFHTLWSREHNRVAQALSRLNPHWDEDTVFMETRRILQAEFQHIIYNEWLPLLIGHQMMQLFNLSPSSEYSSSYDPTVNPSITAEFATAAMRFGHSIVDGRIVIPNTKTGEVHETISIPEVMFQPSRMRLRHFLDRLLIGLTLQPMQSVDPFISEGLTSYMFRGTNPYGLDLASINIQRGRDYGVRSYNSYRRLCGLQPFESFEQFPQSAAKRLASVYESPEYIDLWVGGLLEAPMEEAVIGPTFAHIIADQFYRLKAGDRYFYDNGPDINPGAFTPSQLTEIKKVKLSRLICDNSDGIELVTQPVEAFYRADLPGNELVACNSGRIPFMDLSRFKALKT

The protein contains a signal peptide, and the cleavage site is between 24 and 25. As shown in fig. 1.

Chloron peroxidase evolutionary tree analysis

Chorion peroxidase protein of silkworm alone is gathered into one branch. As shown in fig. 2.

5. After interfering with choron peroxidase, the egg laying amount of silkworms is reduced. As shown in fig. 3.

The above description is only a preferred embodiment of the present invention, and the scope of the present invention is not limited thereto, and any simple modifications or equivalent substitutions of the technical solutions that can be obviously obtained by those skilled in the art within the technical scope of the present invention are within the scope of the present invention.

Sequence listing

<110> institute of economic crops of academy of agricultural sciences of Hubei province

<120> method for cloning, expressing and purifying cultivated silkworm chorion peroxidase gene and application thereof

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 30

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

ggattcatga atttcaaaag cttcattttg 30

<210> 2

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gagctcgtct aaattccgcg agttttga 28

<210> 3

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

aatacgactc actataggga gaatgaattt caaaagcttc attttg 46

<210> 4

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

taatacgact cactataggg agagtatcag cagaagcttg taga 44

<210> 5

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

taatacgact cactataggg agaatggtga gcaagggcga g 41

<210> 6

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

taatacgact cactataggg agattacttg tacagctcgt ccatgc 46

<210> 7

<211> 2346

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

atgaatttca aaagcttcat tttgctctta attaatgtgt tcttattgag tgtcattgag 60

gatagttctt gtcacgttta cgaaggcagc gcacgtgagg cctcagaaca cattcacgta 120

caagagcgac catgcgccgt ctgccccaga ggcgggaagt gtgtcccgaa ggtcaaatgt 180

ccggcccacg tcagaccggg atcgttgaat ccgacctgcc acttggtcct tggacatatc 240

ggtatctgct gcttcaccgg gcaaaagcat tcagcccaat tagaatctac tcagcgttct 300

ggcgccatca gtatagaaga cattaaaagc agccatgacg tatcaaggca gaaaatggtc 360

cagtggatag cgaacgagaa agttctagaa cgttctgctg atacaatcgt cagtagttcg 420

gcacctagtt acgggcatca tttgtccatg gttacgtacg acaagagagt tgagggtctt 480

ggacgtggtg gactgttgaa cgtcttcgct gctctggaac tgaagtctcg gcaggcggtc 540

tctgatgatg agctggagtt gggagcaaca ggacatactg atggtccctt ttgccctaag 600

cccccgcagt gcccggatac ccaaagccgg tacagatcta tagatgggga gtgcaacaat 660

ctggccaacc caacgtgggg agctgtcaat actggcttcg agaggcttct accaccagat 720

tatagtgacg gcgtgtgggc aatgagagtc tccgcagcag gtaatcccct tccgagcgcg 780

agggtggtca gcagcgttct cctgccagaa ggaaaccatc caagtcccac acacaacctc 840

atgttcatgc agtttggaca gtttatagca cacgacacca gcgctggagt tatgttcgca 900

tcgggtaaca acactggaat atcctgttgc gctgaagacg gtgtggacca gctgcatccg 960

aagcagcagc actgggcctg tgctccaatc accgcagttc ccgatgaccc tttctatggt 1020

ttctttggtc agaaatgcct caatttcgtg cgcacacaac tcgcaccagc cagcgattgt 1080

tccgttggct atgccaagca aatgaatggc gccacgcatt accctgattt gtctcactta 1140

tacggcacct ttcccgaaaa actctcattg gtgcgcggcg agggagggtt tctgaagaca 1200

ttcaatgact ttggcagagc cctcccacct ttgactaaga gaagagaatg cgttaatatg 1260

gatggtggta gcccttgctt tgaatcagga gacagtcacg ggaatcagtt catctcactg 1320

acagcattcc acacgttatg gtcgagggag cacaaccgag tcgcgcaagc cctgtcgagg 1380

ttgaaccctc attgggacga agacacagtc tttatggaga ccagaaggat actgcaggca 1440

gaattccagc atatcattta taatgagtgg cttcctctat tgataggtca ccaaatgatg 1500

cagctcttca atttatctcc atcttcagag tattcctcgt cgtacgatcc aacagtcaat 1560

ccgtctatta cagcagaatt cgcgaccgca gccatgagat ttggccactc cattgttgat 1620

ggaagaattg taattcccaa cacgaaaaca ggagaagttc acgagaccat atcgataccg 1680

gaagtgatgt ttcagccgtc gagaatgcgg ctacgtcact tcttggatcg gctgctgatt 1740

ggcctgacgc tgcaaccgat gcagagtgtc gatccgttta tctctgaagg gcttacgtcc 1800

tacatgttcc gtggcaccaa cccctatggc ctggatctag cgtcaataaa cattcaacgc 1860

ggcagagact acggagtcag atcctacaat agctaccggc gcttgtgtgg gcttcagcca 1920

tttgaaagct tcgagcaatt tccacaaagt gctgcaaagc gtctagcgtc tgtctacgag 1980

agtccggaat acatagacct ttgggttgga ggtctgctgg aggcgccgat ggaagaggca 2040

gttatcgggc caactttcgc tcatatcata gccgaccaat tctacaggct caaggctgga 2100

gatagatact tctacgataa tggtcctgat ataaatcccg gcgcttttac tccaagccaa 2160

ctgacagaaa taaagaaggt taaactatca agactgattt gtgacaatag cgatggtata 2220

gaacttgtaa cccagccagt tgaagccttt tatagagcag acctaccagg aaatgaatta 2280

gtggcttgca acagtggacg catacctttt atggatttga gcagatttaa ggcgctcaaa 2340

acttaa 2346

<210> 8

<211> 781

<212> PRT

<213> Artificial Sequence (Artificial Sequence)

<400> 8

Met Asn Phe Lys Ser Phe Ile Leu Leu Leu Ile Asn Val Phe Leu Leu

1 5 10 15

Ser Val Ile Glu Asp Ser Ser Cys His Val Tyr Glu Gly Ser Ala Arg

20 25 30

Glu Ala Ser Glu His Ile His Val Gln Glu Arg Pro Cys Ala Val Cys

35 40 45

Pro Arg Gly Gly Lys Cys Val Pro Lys Val Lys Cys Pro Ala His Val

50 55 60

Arg Pro Gly Ser Leu Asn Pro Thr Cys His Leu Val Leu Gly His Ile

65 70 75 80

Gly Ile Cys Cys Phe Thr Gly Gln Lys His Ser Ala Gln Leu Glu Ser

85 90 95

Thr Gln Arg Ser Gly Ala Ile Ser Ile Glu Asp Ile Lys Ser Ser His

100 105 110

Asp Val Ser Arg Gln Lys Met Val Gln Trp Ile Ala Asn Glu Lys Val

115 120 125

Leu Glu Arg Ser Ala Asp Thr Ile Val Ser Ser Ser Ala Pro Ser Tyr

130 135 140

Gly His His Leu Ser Met Val Thr Tyr Asp Lys Arg Val Glu Gly Leu

145 150 155 160

Gly Arg Gly Gly Leu Leu Asn Val Phe Ala Ala Leu Glu Leu Lys Ser

165 170 175

Arg Gln Ala Val Ser Asp Asp Glu Leu Glu Leu Gly Ala Thr Gly His

180 185 190

Thr Asp Gly Pro Phe Cys Pro Lys Pro Pro Gln Cys Pro Asp Thr Gln

195 200 205

Ser Arg Tyr Arg Ser Ile Asp Gly Glu Cys Asn Asn Leu Ala Asn Pro

210 215 220

Thr Trp Gly Ala Val Asn Thr Gly Phe Glu Arg Leu Leu Pro Pro Asp

225 230 235 240

Tyr Ser Asp Gly Val Trp Ala Met Arg Val Ser Ala Ala Gly Asn Pro

245 250 255

Leu Pro Ser Ala Arg Val Val Ser Ser Val Leu Leu Pro Glu Gly Asn

260 265 270

His Pro Ser Pro Thr His Asn Leu Met Phe Met Gln Phe Gly Gln Phe

275 280 285

Ile Ala His Asp Thr Ser Ala Gly Val Met Phe Ala Ser Gly Asn Asn

290 295 300

Thr Gly Ile Ser Cys Cys Ala Glu Asp Gly Val Asp Gln Leu His Pro

305 310 315 320

Lys Gln Gln His Trp Ala Cys Ala Pro Ile Thr Ala Val Pro Asp Asp

325 330 335

Pro Phe Tyr Gly Phe Phe Gly Gln Lys Cys Leu Asn Phe Val Arg Thr

340 345 350

Gln Leu Ala Pro Ala Ser Asp Cys Ser Val Gly Tyr Ala Lys Gln Met

355 360 365

Asn Gly Ala Thr His Tyr Pro Asp Leu Ser His Leu Tyr Gly Thr Phe

370 375 380

Pro Glu Lys Leu Ser Leu Val Arg Gly Glu Gly Gly Phe Leu Lys Thr

385 390 395 400

Phe Asn Asp Phe Gly Arg Ala Leu Pro Pro Leu Thr Lys Arg Arg Glu

405 410 415

Cys Val Asn Met Asp Gly Gly Ser Pro Cys Phe Glu Ser Gly Asp Ser

420 425 430

His Gly Asn Gln Phe Ile Ser Leu Thr Ala Phe His Thr Leu Trp Ser

435 440 445

Arg Glu His Asn Arg Val Ala Gln Ala Leu Ser Arg Leu Asn Pro His

450 455 460

Trp Asp Glu Asp Thr Val Phe Met Glu Thr Arg Arg Ile Leu Gln Ala

465 470 475 480

Glu Phe Gln His Ile Ile Tyr Asn Glu Trp Leu Pro Leu Leu Ile Gly

485 490 495

His Gln Met Met Gln Leu Phe Asn Leu Ser Pro Ser Ser Glu Tyr Ser

500 505 510

Ser Ser Tyr Asp Pro Thr Val Asn Pro Ser Ile Thr Ala Glu Phe Ala

515 520 525

Thr Ala Ala Met Arg Phe Gly His Ser Ile Val Asp Gly Arg Ile Val

530 535 540

Ile Pro Asn Thr Lys Thr Gly Glu Val His Glu Thr Ile Ser Ile Pro

545 550 555 560

Glu Val Met Phe Gln Pro Ser Arg Met Arg Leu Arg His Phe Leu Asp

565 570 575

Arg Leu Leu Ile Gly Leu Thr Leu Gln Pro Met Gln Ser Val Asp Pro

580 585 590

Phe Ile Ser Glu Gly Leu Thr Ser Tyr Met Phe Arg Gly Thr Asn Pro

595 600 605

Tyr Gly Leu Asp Leu Ala Ser Ile Asn Ile Gln Arg Gly Arg Asp Tyr

610 615 620

Gly Val Arg Ser Tyr Asn Ser Tyr Arg Arg Leu Cys Gly Leu Gln Pro

625 630 635 640

Phe Glu Ser Phe Glu Gln Phe Pro Gln Ser Ala Ala Lys Arg Leu Ala

645 650 655

Ser Val Tyr Glu Ser Pro Glu Tyr Ile Asp Leu Trp Val Gly Gly Leu

660 665 670

Leu Glu Ala Pro Met Glu Glu Ala Val Ile Gly Pro Thr Phe Ala His

675 680 685

Ile Ile Ala Asp Gln Phe Tyr Arg Leu Lys Ala Gly Asp Arg Tyr Phe

690 695 700

Tyr Asp Asn Gly Pro Asp Ile Asn Pro Gly Ala Phe Thr Pro Ser Gln

705 710 715 720

Leu Thr Glu Ile Lys Lys Val Lys Leu Ser Arg Leu Ile Cys Asp Asn

725 730 735

Ser Asp Gly Ile Glu Leu Val Thr Gln Pro Val Glu Ala Phe Tyr Arg

740 745 750

Ala Asp Leu Pro Gly Asn Glu Leu Val Ala Cys Asn Ser Gly Arg Ile

755 760 765

Pro Phe Met Asp Leu Ser Arg Phe Lys Ala Leu Lys Thr

770 775 780

Claims

1. A method for cloning, expressing and purifying a cultivated silkworm chorion peroxidase gene is characterized by comprising the following steps:

step 1, constructing a His-tag-containing vector, and obtaining a full-length choronoperoxidase coding sequence by a PCR method by using a gene specific primer, wherein the primer sequence is shown as SEQ: ID: NO: 1-SEQ: ID: NO: 2 is shown in the specification; the upstream primer comprises a BamH I restriction site, the downstream primer comprises a Sac I restriction site, and the full length containing the restriction site is connected with a pET28a vector containing a stop codon to prevent frame shift mutation; screening, cloning and sequencing by using double enzyme digestion, analyzing a sequencing result, and storing a bacterium solution containing the transgenic plasmid after confirming that no amino acid mutation exists; extracting transgenic plasmids and transferring the transgenic plasmids into E.coli BL21 competent cells to obtain strains capable of expressing Cp protein;

step 2, inoculating BL21 bacterial liquid containing the pET28a-Cp recombinant expression vector into an LB liquid culture medium containing Kanamycin, and carrying out shaking culture at 37 ℃ for overnight; inoculating overnight bacteria solution into fresh LB liquid culture medium containing Kanamycin at a ratio of 1: 100, and shake-culturing at 37 deg.C for 3 hr to OD₆₀₀When the concentration is 0.4-0.6, IPTG is added to the final concentration of 0.8mM, and then the shaking culture is continued to induce the protein expression for 6 h;

step 3, respectively taking 1ml of bacterial liquid before and after induction to separate and collect bacterial precipitates, and washing the precipitates with PBS; adding 80. mu.l PBS and 20. mu.l 5 XSDS loading buffer, boiling for 10 minutes at 100 ℃; loading a sample and a protein marker together, and performing polyacrylamide gel electrophoresis; determining whether the protein is successfully induced and expressed or not through Coomassie brilliant blue staining and judging the molecular weight of the protein; after successful protein expression is determined, carrying out ultrasonic wave crushing on the induced bacterial liquid to respectively obtain a supernatant and a precipitate, and then carrying out SDS-PAGE to determine whether the protein is expressed in the supernatant or the precipitate;

step 4, after determining that the protein is expressed in the supernatant, passing through a Ni-NTA gel column; detecting the eluate after passing through the column by SDS-PAGE and detecting the concentration of the recombinant protein; -storing the recombinant protein sample at 80 degrees; performing SDS-PAGE on the recombinant protein with the concentration of 1mg/ml, staining the recombinant protein by Coomassie brilliant blue, cutting off the gel strip with the size of the recombinant protein band to obtain 12 pieces of SDS-PAGE gel strips, and injecting the gel strips into rabbits to obtain antibodies; the obtained antibody was subjected to titer detection by Western Blot.

2. Use of cultivated silkworm chorion peroxidase gene obtained by the method of claim 1 in the preparation of a reagent for regulating the egg laying amount of female moths.