CN110483631B

CN110483631B - Apolygus intermedius reproduction related protein PG, coding gene thereof, dsRNA interference sequence and application

Info

Publication number: CN110483631B
Application number: CN201910725701.4A
Authority: CN
Inventors: 陈利珍; 朱邦勤; 赵景; 朱俊宇; 彭捷
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2019-08-07
Filing date: 2019-08-07
Publication date: 2022-07-05
Anticipated expiration: 2039-08-07
Also published as: CN110483631A

Abstract

The invention belongs to the technical field of agricultural biology, and particularly relates to lygus lucorum reproduction related protein PG, a coding gene thereof, a dsRNA interference sequence and application thereof. The amino acid sequence of the lygus lucorum reproduction related protein PG is shown in SEQ ID No. 1. According to the invention, the interference sequence of the pepsinogen gene is injected into the adelphocoris suturalis, so that the number of eggs in ovaries of the adelphocoris suturalis is remarkably reduced, the final production egg quantity of the adelphocoris suturalis is inhibited, the reproductive capacity of the adelphocoris suturalis finally reduced, and the development of the population of the adelphocoris suturalis can be effectively controlled. The gene and the protein can be used for development of transgenic insect-resistant plants and biological control of adelphocoris suturalis.

Description

Apolygus intermedius reproduction related protein PG, coding gene thereof, dsRNA interference sequence and application

Technical Field

The invention belongs to the technical field of agricultural biology, and particularly relates to lygus lucorum reproduction related protein PG, a coding gene thereof, a dsRNA interference sequence and application thereof.

Background

Since Bt cotton is planted commercially in China, the use amount and times of pesticides are greatly reduced, and the pest of lygus rises from secondary pests to main pests. The Adelphocoris suturalis (Adelphocoris suturalis) belongs to the family of hemiptera Adelphocoris, is one of the main pests in cotton growing areas in Yangtze river basin in China, and can also damage vegetables, soybeans, fruit trees and the like. The prior art mainly controls adelphocoris suturalis by chemical control, but the chemical control can generate drug resistance, reduce the control effect, and pollute agricultural products, air, soil and water areas, endanger the health, safety and ecological environment of people and livestock. In addition, the lygus lucorum is agile in movement and easy to transfer, so that the control difficulty is increased. Therefore, novel and efficient control measures for adelphocoris suturalis are urgently needed to be explored.

pepsinogen is a precursor of pepsin, is mainly secreted from the gastric mucosa, and can be activated into pepsin having a digestive function under an acidic condition of pH of about 2.0. The high and low serum pepsinogen level can reflect the health condition of the involvement of mucous membrane glands in the gastric acid secretion area, gastric antrum and the metaplasia of pyloric glands and intestinal glands in the mucous membrane of the stomach. Pepsin is the major enzyme involved in protein digestion and is involved in the digestive metabolism of the organism. The pepsin extracted from gastric mucosa of animals such as pig, cattle, and sheep can also be used as animal feed additive. Pepsin can also be used as a tool enzyme for the production of polypeptides or collagen.

At present, the pepsinogen is mainly researched according to the relation between the content and the stomach health condition, and the effect of the pepsinogen in the insect reproduction process is not reported.

Disclosure of Invention

The invention aims to provide a lygus lucorum reproduction related gene PG.

It is still another object of the present invention to provide a protein encoded by the above gene.

Still another object of the present invention is to provide dsRNA interference sequences of the above genes.

It is still another object of the present invention to provide a recombinant expression vector containing the above gene.

It is still another object of the present invention to provide a recombinant strain containing the above gene.

The invention further aims to provide application of the PG gene of adelphocoris suturalis.

The invention further aims to provide application of the dsRNA interference sequence of the PG gene of adelphocoris suturalis.

The amino acid sequence of the lygus lucorum reproduction related protein PG is shown as SEQ ID No. 1:

MIFVAATALLALWASDCRTATPHGGPNRSNGKRFIVQLTRNTEQSGFHSERNYIEELELNVYKSAYSINIFVGNPPQEIKVDFDTGSSDLWVRGNLYRNYCYEYPGNQSEFIAQCSSEFVLLGGRYSGSYGGGNCSGRPGNDLVEVAGMGQYRLSFGVVSSITDHLLPEHCGGILGLGLQYSQYSFLQHLKRNGVLSRNVFSTKLTNQGEYNFVEFGGWDETIVSENIHWIPIVHNVFGHWRFHANSMSIGSHEVISHPTDMIADTGCTNIVVLSRDIFNKLMQNMQANESSTGLCVMNEWNLQLEIDIMGKTYVLDWEDFTSKQADVYCPFKLHISYLDRRDDLRMPEVILGDPFLRKFYSIYDFGSPSQIAFVPYQ

the protein sequence coded by the apolygus lucorum pepsinogen gene codes 378 amino acid residues.

The nucleotide sequence of the lygus lucorum reproduction related gene PG is shown as SEQ ID NO. 2:

ATGATTTTCGTTGCTGCTACAGCGCTTTTGGCACTTTGGGCTTCGGACTGTCGCACAGCGACACCTCACGGTGGACCGAACCGTTCAAATGGAAAGAGGTTTATTGTGCAGCTTACCAGGAATACGGAACAATCTGGATTTCATTCGGAAAGGAATTACATAGAGGAGTTGGAACTCAATGTCTACAAGAGCGCATACAGCATAAATATATTTGTGGGAAATCCTCCTCAAGAAATCAAGGTGGATTTTGACACTGGTTCGAGCGACCTGTGGGTCCGAGGAAATTTATACAGAAACTACTGCTACGAATACCCAGGCAACCAATCCGAATTCATCGCACAATGCTCGTCTGAATTTGTGTTACTCGGAGGCCGATACAGCGGTTCTTACGGCGGAGGGAATTGTTCTGGAAGACCGGGGAATGATTTAGTTGAGGTAGCGGGAATGGGTCAGTACCGGTTAAGCTTCGGAGTTGTTTCTTCGATTACGGATCATTTGCTCCCGGAACACTGCGGTGGAATTTTGGGGCTTGGATTGCAATATAGTCAATACTCCTTCCTTCAACATTTAAAACGTAACGGGGTGTTGAGTAGAAACGTATTTTCGACTAAGCTAACCAATCAGGGGGAATATAACTTCGTCGAATTCGGTGGTTGGGACGAAACAATTGTAAGTGAAAACATACACTGGATTCCCATTGTTCATAATGTTTTTGGACATTGGAGATTTCACGCTAACAGCATGTCTATAGGCAGTCACGAAGTAATATCACATCCGACTGACATGATAGCTGATACTGGGTGCACTAACATCGTCGTCTTGAGTCGTGATATTTTCAATAAATTAATGCAAAATATGCAAGCCAACGAGAGCTCGACCGGATTATGTGTAATGAATGAATGGAATCTACAACTTGAAATCGACATCATGGGAAAGACTTACGTTCTAGACTGGGAGGATTTCACCTCAAAACAAGCTGATGTGTATTGTCCCTTCAAGCTCCACATTTCATATCTTGACAGACGGGATGATCTAAGAATGCCGGAAGTAATACTTGGTGATCCATTCTTGAGAAAGTTCTACTCCATCTATGATTTTGGATCGCCAAGCCAAATTGCGTTTGTACCTTACCAATGA

the whole length of the nucleotide sequence, namely the cDNA sequence, is 1137 bp.

The invention also provides a recombinant expression vector and a recombinant strain containing the PG gene of lygus lucorum or the dsRNA interference sequence thereof.

The dsRNA interference sequence of the black bug reproduction related gene PG according to the specific embodiment of the invention is obtained by amplifying the following specific primer sequences:

an upstream primer dsPG-F: 5'-CCCGAACAACTGTGGTGGAA-3' the flow of the air in the air conditioner,

downstream primer dsPG-R: 5'-TTGGCTTGGCGATCCAAAATC-3' are provided.

Injecting the interference sequence into a newly emerged female adelphocoris suturalis by a microinjection method, detecting the expression quantity of the pepsinogen gene of the adelphocoris suturalis by real-time fluorescence quantification RCR (qPCR), counting the number of eggs in the ovary of the newly emerged female adelphocoris suturalis 10 days after injection, and in addition, pairing the injected female with the newly emerged male insect one by one, and counting the egg quantity, the service life and the early stage of egg laying of the female insect in the final production. The result shows that the expression quantity of the apolygus lucorum pepsinogen gene is remarkably inhibited in the whole growth period, the quantity of ova in the ovary and the fertility of the female insect are remarkably inhibited after the expression of the apolygus lucorum pepsinogen gene is inhibited, the quantity of the ova in the ovary is reduced, the quantity of the ova produced in the lifetime is reduced, and the development of the reproductive capacity and the population of the apolygus lucorum is adversely affected.

The invention has the beneficial effects that:

the invention provides a separated apolygus lucorum pepsinogen gene and a protein coded by the same, and the action of the pepsinogen gene in the reproduction process of apolygus lucorum is found for the first time, so that the reproduction capability of the apolygus lucorum can be obviously weakened by inhibiting the expression of the pepsinogen, and the development of the apolygus lucorum population is declined.

According to the invention, the dsRNA of the apolygus lucorum pepsinogen gene is synthesized, then the dsRNA is input into the apolygus lucorum body by using a microinjection method, and a Green Fluorescent Protein (GFP) control group is used for discovering that the expression quantity of the apolygus lucorum pepsinogen gene is remarkably inhibited in the whole growth period, and simultaneously, the quantity of eggs in the ovary of the apolygus lucorum and the quantity of eggs produced in the end are remarkably reduced after the gene is interfered.

Therefore, the invention provides a new idea for controlling the development of the adelphocoris suturalis population and also provides a basis for realizing green control of the adelphocoris suturalis and other hemiptera insects.

Drawings

FIG. 1 shows the efficiency of silencing of the pepsinogen gene following injection of dsRNA interfering with the pepsinogen gene; wherein ". x" represents p <0.05, ". x" represents p < 0.01; "dsPG" represents the treatment group injected with pepsinogen gene dsRNA; "dsGFP" represents a control group injected with GFP gene dsRNA;

FIG. 2 shows the effect of injecting dsRNA with a pepsinogen gene interference sequence on reproductive capacity of adelphocoris suturalis, wherein A is the effect of injecting dsRNA with a pepsinogen gene interference sequence on the number of eggs in ovary of adelphocoris suturalis; b is the influence of dsRNA injected with a pepsinogen gene interference sequence on the life of female adelphocoris suturalis adults; c is the influence of dsRNA injected with a pepsinogen gene interference sequence on the egg production of the adelphocoris suturalis for the lifetime; d is the influence of dsRNA injected with pepsinogen gene interference sequence on the pre-oviposition period of the adelphocoris suturalis; "+ represents significance of difference: "x" represents P <0.05, "x" P represents < 0.01; "dsPG" represents the treatment group injected with pepsinogen gene interference sequence dsRNA; "dsGFP" represents a control group injected with GFP gene dsRNA.

Detailed Description

Cloning and analysis of the Apolygus lucinogen Gene in example 1

Weighing 30mg of adelphocoris suturalis sample, placing the sample in a 1.5ml enzyme-free tube, precooling with liquid nitrogen, grinding female insects by using a grinding rod, and extracting total RNA by using a TRIzol method.

The total RNA extracted above was synthesized into cDNA template using PrimeScript RT Master Mix (perfect real time) kit.

The synthetic primers were designed as follows:

the upstream primer sequence PG-F: 5'-TGATCTAAGTGTGATCAGTAAAGATGATTT-3' the flow of the air in the air conditioner,

the downstream primer sequence PG-R: 5'-GTTCCATAAAGTATTTAATTCGCTAAAGTCG-3' is added.

And carrying out PCR amplification by using the primers PG-F and PG-R by using the adelphocoris suturalis cDNA as a template. Detecting PCR products by 1% agarose electrophoresis, staining by Ethidium Bromide (EB), observing electrophoresis results under an ultraviolet lamp, detecting correct fragments, cutting gel, and purifying and recovering target fragments by using a DNA gel recovery kit.

And connecting the recovered PCR product with a pEASY-T1 vector, transforming the recombinant vector into Beijing holocompetent cell T1, and culturing in an ampicillin-resistant LB culture medium overnight. After overnight culture, 10 positive clones were picked for PCR validation, and fresh bacterial solution was sequenced for clones that were positive for PCR amplification of colonies.

The pepsinogen gene open reading frame has the total length of 1137bp, 378 amino acid residues are coded, the amino acid sequence is shown as SEQ ID NO.1, the molecular mass is 93.72kDa, and the theoretical isoelectric point is 5.07.

Example 2 silencing efficiency of the pepsinogen Gene after dsRNA injection and its effect on the Productivity of Neuropus intermedius

2.1 preparation of dsRNA templates

Specific amplification primers (5' -terminal plus T7 promoter sequence) were designed based on the pepsinogen gene sequence obtained in example 1 for amplification of dsRNA fragments of pepsinogen gene, and the specific primers were designed as follows:

upstream primer sequence dsPG-F: CCCGAACAACTGTGGTGGAA

Downstream primer sequence dsPG-R: TTGGCTTGGCGATCCAAAATC are provided.

Taking cDNA of adelphocoris suturalis as a template, carrying out PCR amplification by using the primers dsPG-F and dsPG-F, detecting a PCR product by 1% agarose electrophoresis, staining by Ethidium Bromide (EB), observing an electrophoresis result under an ultraviolet lamp, cutting gel, and purifying and recovering a target fragment by using a DNA gel recovery kit. The PCR product was ligated into pEASY-T1 vector. And selecting a single colony which is positive in colony PCR detection, sequencing, detecting the correctness of the gene sequence, and carrying out shake culture on the single colony which is correct in sequencing in 6ml of LB + AMP culture medium overnight.

Extracting the plasmid containing the target fragment by using an AxyPrep plasmid extraction kit, and performing second PCR amplification by using the plasmid as a template and the specific primers dsPG-F and dsPG-F.

2.2 Synthesis of dsRNA

And purifying the product of the second PCR by using a phenol chloroform extraction method to synthesize dsRNA. The dsRNA was extracted with phenol chloroform, and the mass of the diluted product was checked by 1% agarose gel electrophoresis, and the dsRNA concentration was diluted to 10. mu.g/. mu.l for use.

2.3 feeding dsRNA

Taking a green fluorescent protein Gene (GFP) double-stranded dsRNA as a control, and injecting the pepsinogen gene dsRNA into a newly-emerged female insect body from the outermost side of a hindbreast and an abdominal internode membrane of the adelphocoris suturalis through a microinjection method.

And (3) detecting silencing efficiency: collecting adelphocoris suturalis Scorpio 5 days, 10 days, 14 days and 18 days after injection treatment, extracting RNA, reverse transcribing to cDNA, and using

Premix ExTaq^TMII and Bio-Rad Detection iQ2System to detect silencing effects of pepsinogen genes.

As shown in FIG. 1, the pepsinogen gene expression levels were significantly reduced at 5d, 10d, 14d, and 18d after injecting dsRNA of pepsinogen gene, and were significantly suppressed throughout the entire growth period, as compared to the control group injected with dsGFP. Therefore, interfering sequences of the pepsinogen gene of the lygus lucorum in injection can cause the expression amount of the pepsinogen gene to be remarkably reduced.

Counting the number of ova in the ovary: after 10 days of dsRNA injection, female ovaries were dissected by a stereomicroscope, 20 undismated females were dissected for each treatment, 3 biological replicates were observed, the ovarian morphology was observed, and the number of eggs in the ovary of lygus lucorum was counted and analyzed.

Fertility: after the female is injected with dsRNA, the female is matched with newly emerged male worms one by one, the male worms are placed into a disposable plastic cup (5cm multiplied by 7cm) for mating, if the male worms die, the new sexually mature male worms are supplemented immediately, 40 pairs of worms are taken as a treatment group, 3 biological repetitions are carried out, the egg production amount in the early stage of egg production, the egg production amount in the final stage and the life of the female adults are counted, and the influence of injecting the pepsinogen gene dsRNA on the early stage of egg production, the egg production amount and the life of the female adults of the middle-sized plant bugs is evaluated.

Ovaries were dissected after injection of pepsinogen gene dsRNA10d to count the number of ova and observed for ovarian morphology. As shown in a in fig. 2, after the pepsinogen gene is silenced, the number of eggs in the ovary of the middle lygus lucorum is significantly reduced by 23.5% compared with the control group, and thus, the number of eggs in the ovary of the female lygus lucorum can be significantly reduced by injecting dsRNA of the pepsinogen gene.

The newly emerged female insect is mated with the male insect after being injected with the pepsinogen gene dsRNA, the life of the female adult insect, the egg production amount before the egg production period and the egg production amount after the egg production period are counted, and therefore the influence of the pepsinogen gene on the fertility of the middle-sized plant bug is evaluated. The results are shown in Table 1 and FIG. 2.

TABLE 1 Effect of dsRNA injection of pepsinogen Gene on reproductive Capacity of Neuropus intermedius

Table 1 illustrates: effect of injection of dsRNA of the pepsinogen gene on reproductive ability of adelphocoris suturalis. Wherein "ns" represents no significant difference; "+" represents p <0.05 and "+" represents p < 0.01. The Chinese and English abbreviations in the figures mean: "dsPG" represents the treatment group injected with pepsinogen gene dsRNA; "dsGFP" represents a control group injected with GFP gene dsRNA.

The result shows that after the pepsinogen gene is interfered, compared with a control group, the egg production amount of the female in the whole period is obviously reduced by 14.81 percent, but the service life of the female adult is prolonged, and the egg production period is not obviously different from that of the control group. After the expression of the pepsinogen gene is inhibited, the number of eggs in the ovary of the adelphocoris suturalis and the fertility of the female insect are obviously inhibited, the number of the eggs in the ovary is reduced, the egg yield in the lifetime is reduced, and the reproductive capacity and the population development of the adelphocoris suturalis finally influenced.

Therefore, the interference sequence provided by the invention can be applied to development of transgenic plant resistant to adelphocoris suturalis, development of green and environment-friendly insect-resistant plants and realization of green pest control.

Sequence listing

<110> university of agriculture in Huazhong

<120> lygus lucorum reproduction-related protein PG, coding gene thereof, dsRNA interference sequence and application

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 378

<212> PRT

<213> lygus suturalis (Adelphocoris suturalis)

<400> 1

Met Ile Phe Val Ala Ala Thr Ala Leu Leu Ala Leu Trp Ala Ser Asp

1 5 10 15

Cys Arg Thr Ala Thr Pro His Gly Gly Pro Asn Arg Ser Asn Gly Lys

20 25 30

Arg Phe Ile Val Gln Leu Thr Arg Asn Thr Glu Gln Ser Gly Phe His

35 40 45

Ser Glu Arg Asn Tyr Ile Glu Glu Leu Glu Leu Asn Val Tyr Lys Ser

50 55 60

Ala Tyr Ser Ile Asn Ile Phe Val Gly Asn Pro Pro Gln Glu Ile Lys

65 70 75 80

Val Asp Phe Asp Thr Gly Ser Ser Asp Leu Trp Val Arg Gly Asn Leu

85 90 95

Tyr Arg Asn Tyr Cys Tyr Glu Tyr Pro Gly Asn Gln Ser Glu Phe Ile

100 105 110

Ala Gln Cys Ser Ser Glu Phe Val Leu Leu Gly Gly Arg Tyr Ser Gly

115 120 125

Ser Tyr Gly Gly Gly Asn Cys Ser Gly Arg Pro Gly Asn Asp Leu Val

130 135 140

Glu Val Ala Gly Met Gly Gln Tyr Arg Leu Ser Phe Gly Val Val Ser

145 150 155 160

Ser Ile Thr Asp His Leu Leu Pro Glu His Cys Gly Gly Ile Leu Gly

165 170 175

Leu Gly Leu Gln Tyr Ser Gln Tyr Ser Phe Leu Gln His Leu Lys Arg

180 185 190

Asn Gly Val Leu Ser Arg Asn Val Phe Ser Thr Lys Leu Thr Asn Gln

195 200 205

Gly Glu Tyr Asn Phe Val Glu Phe Gly Gly Trp Asp Glu Thr Ile Val

210 215 220

Ser Glu Asn Ile His Trp Ile Pro Ile Val His Asn Val Phe Gly His

225 230 235 240

Trp Arg Phe His Ala Asn Ser Met Ser Ile Gly Ser His Glu Val Ile

245 250 255

Ser His Pro Thr Asp Met Ile Ala Asp Thr Gly Cys Thr Asn Ile Val

260 265 270

Val Leu Ser Arg Asp Ile Phe Asn Lys Leu Met Gln Asn Met Gln Ala

275 280 285

Asn Glu Ser Ser Thr Gly Leu Cys Val Met Asn Glu Trp Asn Leu Gln

290 295 300

Leu Glu Ile Asp Ile Met Gly Lys Thr Tyr Val Leu Asp Trp Glu Asp

305 310 315 320

Phe Thr Ser Lys Gln Ala Asp Val Tyr Cys Pro Phe Lys Leu His Ile

325 330 335

Ser Tyr Leu Asp Arg Arg Asp Asp Leu Arg Met Pro Glu Val Ile Leu

340 345 350

Gly Asp Pro Phe Leu Arg Lys Phe Tyr Ser Ile Tyr Asp Phe Gly Ser

355 360 365

Pro Ser Gln Ile Ala Phe Val Pro Tyr Gln

370 375

<210> 2

<211> 1137

<212> DNA

<213> lygus suturalis (Adelphocoris suturalis)

<400> 2

atgattttcg ttgctgctac agcgcttttg gcactttggg cttcggactg tcgcacagcg 60

acacctcacg gtggaccgaa ccgttcaaat ggaaagaggt ttattgtgca gcttaccagg 120

aatacggaac aatctggatt tcattcggaa aggaattaca tagaggagtt ggaactcaat 180

gtctacaaga gcgcatacag cataaatata tttgtgggaa atcctcctca agaaatcaag 240

gtggattttg acactggttc gagcgacctg tgggtccgag gaaatttata cagaaactac 300

tgctacgaat acccaggcaa ccaatccgaa ttcatcgcac aatgctcgtc tgaatttgtg 360

ttactcggag gccgatacag cggttcttac ggcggaggga attgttctgg aagaccgggg 420

aatgatttag ttgaggtagc gggaatgggt cagtaccggt taagcttcgg agttgtttct 480

tcgattacgg atcatttgct cccggaacac tgcggtggaa ttttggggct tggattgcaa 540

tatagtcaat actccttcct tcaacattta aaacgtaacg gggtgttgag tagaaacgta 600

ttttcgacta agctaaccaa tcagggggaa tataacttcg tcgaattcgg tggttgggac 660

gaaacaattg taagtgaaaa catacactgg attcccattg ttcataatgt ttttggacat 720

tggagatttc acgctaacag catgtctata ggcagtcacg aagtaatatc acatccgact 780

gacatgatag ctgatactgg gtgcactaac atcgtcgtct tgagtcgtga tattttcaat 840

aaattaatgc aaaatatgca agccaacgag agctcgaccg gattatgtgt aatgaatgaa 900

tggaatctac aacttgaaat cgacatcatg ggaaagactt acgttctaga ctgggaggat 960

ttcacctcaa aacaagctga tgtgtattgt cccttcaagc tccacatttc atatcttgac 1020

agacgggatg atctaagaat gccggaagta atacttggtg atccattctt gagaaagttc 1080

tactccatct atgattttgg atcgccaagc caaattgcgt ttgtacctta ccaatga 1137

<210> 3

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

cccgaacaac tgtggtggaa 20

<210> 4

<211> 21

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

ttggcttggc gatccaaaat c 21

Claims

1. The lygus lucorum reproduction related protein PG is characterized in that the amino acid sequence is shown as SEQ ID No. 1.

2. The lygus lucorum reproduction-related gene PG is characterized by encoding the lygus lucorum reproduction-related protein PG of claim 1.

3. The lygus lucorum reproduction-related gene PG as claimed in claim 2, characterized in that the nucleotide sequence thereof is shown as SEQ ID No. 2.

4. The interfering dsRNA of the lygus lucorum reproduction-related gene PG of claim 2.

5. The interfering dsRNA of the reproduction-related gene PG of lygus lucorum according to claim 4, which is obtained by amplification of the following specific primer sequences:

a downstream primer dsPG-R: 5'-TTGGCTTGGCGATCCAAAATC-3' are provided.

6. A recombinant expression vector comprising the lygus lucorum reproduction-related gene PG or the interfering dsRNA thereof of claim 2.

7. A recombinant strain comprising the lygus lucorum reproduction-related gene PG of claim 2 or an interfering dsRNA thereof.

8. The application of the lygus lucorum reproduction related gene PG in the control of lygus lucorum according to claim 2, which comprises the step of feeding the lygus lucorum with interference dsRNA of the lygus lucorum reproduction related gene PG.