CN111471098B - Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof - Google Patents

Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof Download PDF

Info

Publication number
CN111471098B
CN111471098B CN202010133106.4A CN202010133106A CN111471098B CN 111471098 B CN111471098 B CN 111471098B CN 202010133106 A CN202010133106 A CN 202010133106A CN 111471098 B CN111471098 B CN 111471098B
Authority
CN
China
Prior art keywords
receptor protein
ecdysone receptor
adelphocoris suturalis
suturalis
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN202010133106.4A
Other languages
Chinese (zh)
Other versions
CN111471098A (en
Inventor
陈利珍
薛汇
任俊
黄星星
张航
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Huazhong Agricultural University
Original Assignee
Huazhong Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Huazhong Agricultural University filed Critical Huazhong Agricultural University
Priority to CN202010133106.4A priority Critical patent/CN111471098B/en
Publication of CN111471098A publication Critical patent/CN111471098A/en
Application granted granted Critical
Publication of CN111471098B publication Critical patent/CN111471098B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/72—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • C07K14/721—Steroid/thyroid hormone superfamily, e.g. GR, EcR, androgen receptor, oestrogen receptor
    • A—HUMAN NECESSITIES
    • A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
    • A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
    • A01N57/00—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds
    • A01N57/10—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds
    • A01N57/16—Biocides, pest repellants or attractants, or plant growth regulators containing organic phosphorus compounds having phosphorus-to-oxygen bonds or phosphorus-to-sulfur bonds containing heterocyclic radicals
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
    • C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
    • C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
    • C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Zoology (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Plant Pathology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Cell Biology (AREA)
  • Pest Control & Pesticides (AREA)
  • Toxicology (AREA)
  • Medicinal Chemistry (AREA)
  • Immunology (AREA)
  • Endocrinology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Virology (AREA)
  • Insects & Arthropods (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Agronomy & Crop Science (AREA)
  • Dentistry (AREA)
  • Environmental Sciences (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention relates to the field of genetic engineering, in particular to a lygus lucorum ecdysone receptor protein and a coding gene and application thereof. The amino acid sequence of the stinkbug ecdysone receptor protein is shown in SEQ ID NO. 1. The invention discovers the effect of the ecdysone receptor protein gene of the adelphocoris suturalis in the reproduction process of the adelphocoris suturalis for the first time, the suppression of the expression of the ecdysone receptor protein gene can obviously weaken the reproduction capability of the adelphocoris suturalis, the lifelong egg laying amount is obviously reduced, the decline of population development is finally caused, a new thought is provided for controlling the development of the adelphocoris suturalis population, a foundation is provided for realizing the green prevention and control of the adelphocoris suturalis and other hemiptera insects, and the adelphocoris suturalis can be used as an alternative gene for the cultivation of transgenic plants for resisting the adelphocoris suturalis.

Description

Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof
Technical Field
The invention relates to the field of genetic engineering, in particular to a lygus lucorum ecdysone receptor protein and a coding gene and application thereof.
Background
Adelphocoris suturalis (Adelphocoris suturalis) belongs to the genus Adelphocoris lucorum of the family hemiptera, and is a highly omnivorous pest. Due to the long-term use of chemical agents, the drug resistance of pests is gradually enhanced, and various chemical control methods such as alternate use of agents and the like are gradually applied to the control of lygus lucorum. The transgenic insect-resistant crop is also an important means for preventing and controlling pests, and the development of a new transgenic insect-resistant crop for preventing and controlling lygus bugs meets the current scientific and environmental protection concept and is innovative.
Ecdysone (20E), the major hormone regulating female reproduction in some hymenoptera, lepidoptera and all diptera insects, acts through its cognate receptor, but its functional receptor is a heterodimer consisting of two nuclear receptors, the ecr (ecdysone receptor) receptor and the usp (ultraspiracle) receptor.
There are three subtypes of EcR receptors, which play different roles in the reproductive development of drosophila. Scientists silence the desert locust ecdysone receptor complex EcR/USP through RNAi technology, which in turn affects ovarian maturation by affecting chorionic development. EcR silencing mediated by artificial miRNA influences the development of cotton bollworm larvae and the development of oocytes, and the reproductive capacity of the treated cotton bollworm is obviously reduced. In addition to its effect on female insect reproduction, EcR receptors have a critical effect on male accessory glands and fertility, which are involved in male fertility, in drosophila melanogaster, EcR is essential for the normal development of male drosophila accessory glands, interfering with EcR expression, glands are unable to produce protamine, affecting population reproduction.
The increasing use of chemical pesticides leads to the enhancement of the drug resistance of pests, and the search for scientific and environment-friendly pesticide strategies is urgent. With the development of science and technology, more means for preventing and controlling pests through transgenic plants are paid attention to by people and are also an important strategy for scientific and environment-friendly pest killing. The reproduction regulation of the EcR gene to insects can be applied to the prevention and treatment of the transgenic plants to the lygus lucorum, and the development of the concept of green, environment-friendly and scientific pest control is promoted.
Disclosure of Invention
The present invention has been made to solve the above-mentioned problems.
The invention aims to provide an ecdysone receptor protein of lygus suturalis.
Still another object of the present invention is to provide a gene encoding the ecdysone receptor protein of lygus suturalis.
The invention further aims to provide application of the adelphocoris suturalis ecdysone receptor protein and the coding gene thereof.
It is yet another object of the present invention to provide a method for controlling adelphocoris suturalis.
Still another object of the present invention is to provide a method for breeding transgenic plant against adelphocoris suturalis.
The adelphocoris suturalis ecdysone receptor protein comprises 470 amino acid residues, and the amino acid sequence of the adelphocoris suturalis ecdysone receptor protein is shown as SEQ ID NO. 1.
MMGEEKRTDDDWMVSGGSPRNYQTNGGYPSPTMSSNSYDPYSPSSKLGREDLSPPNSLNGYSADSCDGSKKKKGTATRQQEELCLVCGDRASGYHYNALTCEGCKGFFRRSITKNAVYQCKYGNNCEIDMYMRRKCQECRLKKCLSVGMRPECVVPEYQCAVKRKEKKAQKEKDKPVSTTTISPEAVKPEPEPHRVSFSSSLFQSVIKEPTKLSPESGPTEVALKHSPPYGIKPVSPEQQELINRLVYFQSEYEHPSDEDVRRINSPNEDEEQQDFRFRHITEITILTVQLIVEFAKRLPGFDKIIKEDQIALLKACSSEVMMLRTARKYDASTDSIVFADNQLYSRESYNLAGMGDVVEDILRFCRHMYRMKVDNAEYALLTAIVIFSERPSLMEGWKVEKIQEIYLEALKSYVDNRMKPRSPTIYAKLLSVLTELRTLGNQNSEMCFSLKLQNKKLPPFLAEIWDVNS
The nucleotide sequence of the gene for coding the ecdysone receptor protein of lygus suturalis according to the specific embodiment of the invention is shown in SEQ ID NO.2, and the total length of the sequence is 1413 bp.
ATGATGGGCGAGGAGAAGCGGACAGACGATGACTGGATGGTGAGCGGTGGCTCCCCCAGAAACTACCAGACCAACGGGGGCTATCCGTCTCCGACCATGTCCAGCAACAGCTACGACCCTTACAGCCCCAGCTCTAAACTAGGTCGAGAGGACTTGAGCCCGCCCAACTCGCTGAACGGCTACTCGGCCGATAGCTGCGATGGCTCCAAGAAGAAGAAGGGGACGGCCACCCGGCAACAAGAGGAGCTCTGCCTCGTCTGCGGAGATCGAGCCTCGGGTTACCATTATAATGCTCTGACGTGCGAGGGCTGTAAGGGGTTCTTCCGGCGGAGTATAACGAAAAATGCCGTCTACCAGTGCAAGTACGGGAACAACTGCGAGATTGACATGTACATGAGGAGAAAATGTCAAGAGTGCCGGCTTAAAAAATGTCTCAGCGTTGGGATGAGGCCAGAGTGCGTGGTACCGGAGTACCAGTGCGCTGTAAAACGGAAAGAGAAAAAGGCGCAGAAGGAGAAGGACAAGCCGGTGAGCACGACCACCATCTCCCCGGAGGCCGTCAAACCCGAACCTGAACCCCACAGGGTCAGTTTCTCATCAAGCCTCTTTCAATCTGTGATCAAAGAGCCAACCAAACTGAGTCCGGAAAGCGGTCCCACTGAGGTTGCGCTCAAACATTCGCCGCCGTACGGCATCAAACCGGTGAGCCCTGAGCAGCAGGAACTCATCAACAGGCTCGTCTACTTCCAAAGCGAGTACGAGCACCCTTCGGACGAGGATGTCCGGAGAATTAACTCCCCTAACGAAGATGAGGAACAGCAAGACTTTAGGTTTAGGCATATAACAGAAATCACTATACTCACCGTTCAACTCATCGTAGAGTTCGCGAAAAGGCTCCCCGGTTTCGACAAAATTATCAAAGAAGATCAAATAGCATTATTAAAGGCATGTTCTAGCGAAGTGATGATGCTGAGGACAGCGCGGAAGTATGACGCGAGTACGGACTCAATCGTCTTTGCAGACAACCAGTTGTACTCTCGAGAGTCGTACAACCTTGCCGGCATGGGGGATGTAGTCGAAGACATCCTGAGGTTCTGCCGACACATGTACCGAATGAAGGTGGACAACGCAGAGTACGCCCTCCTTACCGCCATCGTTATCTTCTCTGAGAGACCGTCCCTCATGGAGGGCTGGAAGGTCGAGAAGATCCAAGAGATCTACTTGGAAGCCCTCAAATCCTACGTAGACAACCGGATGAAACCCCGATCTCCCACAATCTACGCCAAACTCCTTTCTGTCCTCACGGAACTTCGAACACTCGGCAACCAAAACTCCGAGATGTGCTTCTCCCTCAAGCTCCAGAACAAAAAGCTGCCGCCCTTCCTAGCCGAGATCTGGGACGTCAACTCGTAA
The invention provides a method for controlling adelphocoris suturalis, which comprises the step of introducing an RNA interference sequence of a gene for coding the ecdysone receptor protein of adelphocoris suturalis into the body of adelphocoris suturalis.
According to the method for controlling adelphocoris suturalis, after dsRNA of an interference sequence of an ecdysone receptor protein coding gene of adelphocoris suturalis is designed and synthesized, the dsRNA is injected into the adelphocoris suturalis by using a microinjection method, Green Fluorescent Protein (GFP) is used as a control group, the gene expression level of the ecdysone receptor protein of the adelphocoris suturalis is found to be remarkably reduced in the whole growth period, and the number of ova in ovaries of the adelphocoris suturalis and the final egg production level are also found to be remarkably reduced after the gene is interfered.
According to the method for controlling adelphocoris suturalis, dsRNA of an ecdysone receptor protein coding gene interference sequence of adelphocoris suturalis can be introduced into a plant, after the adelphocoris suturalis eats the transgenic plant, the reproductive capacity of the adelphocoris suturalis remarkably weakened, the lifelong egg laying amount is remarkably reduced, and finally the decline of population development is caused.
According to the method for controlling adelphocoris suturalis, dsRNA of an adelphocoris suturalis ecdysone receptor protein coding gene is synthesized in vitro by using a specific primer, and the sequence of the synthesized dsRNA specific primer is as follows:
the upstream primer dsECR-F: AAACCCGAACCTGAACCCCA
Downstream primer dsECR-R: CCTCAGCATCATCACTTCGC are provided.
The invention also provides a method for culturing the transgenic plant resisting the adelphocoris suturalis, which comprises the step of introducing the ecdysone receptor protein coding gene interference sequence of the adelphocoris suturalis into the plant.
The invention discovers the effect of the ecdysone receptor protein gene of the adelphocoris suturalis in the reproduction process of the adelphocoris suturalis for the first time, the suppression of the expression of the ecdysone receptor protein gene can obviously weaken the reproduction capability of the adelphocoris suturalis, the lifelong egg laying amount is obviously reduced, the decline of population development is finally caused, a new thought is provided for controlling the development of the adelphocoris suturalis population, a foundation is provided for realizing the green prevention and control of the adelphocoris suturalis and other hemiptera insects, and the adelphocoris suturalis can be used as an alternative gene for the cultivation of transgenic plants for resisting the adelphocoris suturalis.
The invention is realized by the following technical scheme:
on the basis of separating and cloning the ecdysone receptor gene, the invention also utilizes a specific primer to synthesize dsRNA of the ecdysone receptor gene in vitro, and the dsRNA is injected into a female insect body with initial emergence of the adelphocoris suturalis through microinjection. After injection, the gene expression level of the ecdysone receptor is extremely obviously inhibited in the whole growth period through real-time fluorescent quantitative RCR (qPCR) detection. Meanwhile, the number of eggs in ovaries of the female lygus lucorum after 11 days of injection is counted, the injected female lygus lucorum is matched with the newly emerged male worms one by one, the egg production quantity of the female lygus lucorum in the whole life is counted, the effect of the ecdysone receptor gene in the development and reproduction process of the ovaries of the female lygus lucorum is researched, and the result shows that the inhibition of the expression of the ecdysone receptor gene obviously reduces the number of the eggs in the ovaries of the lygus lucorum and the egg production quantity of the lygus lucorum in the whole life, and finally influences the reproductive capacity and population development of the lygus lucorum.
Drawings
Fig. 1 is a flow chart of functional verification of an ecdysone receptor protein gene of adelphocoris suturalis.
Fig. 2 is silencing efficiency of ecdysone receptor gene after injection of dsRNA of ecdysone receptor protein gene interference sequence of lygus nigrum, showing silencing efficiency after 4 days, 6 days, 8 days, 10 days, 12 days, 14 days, 16 days and 18 days of ecdysone receptor protein gene interference sequence of lygus nigrum in injection, wherein ". star" represents p <0.01, and "dsECR" represents treatment group of ecdysone receptor protein gene dsRNA in injection; "dsGFP" refers to a control group injected with GFP gene dsRNA.
Fig. 3 shows the effect of dsRNA of ecdysone receptor protein gene interference sequence of adelphocoris suturalis on reproductive capacity of adelphocoris suturalis, wherein, a diagram A: influence of dsRNA of the molting hormone receptor protein gene interference sequence of the adelphocoris suturalis injected on the number of ova in ovaries of the adelphocoris suturalis; and B, drawing: influence of dsRNA of the molting hormone receptor protein gene interference sequence of the adelphocoris suturalis on the egg production of the adelphocoris suturalis in the whole life. "x" indicates that the difference was very significant: "" P <0.01, "dsECR" indicates the treatment group of the ecdysone receptor protein gene interfering sequence dsRNA from lygus nigrum in injection; "dsGFP" refers to a control group injected with GFP gene dsRNA.
Detailed Description
The techniques used in the embodiments, including molecular biology techniques such as TRIzol method for RNA extraction, cDNA cloning, PCR amplification and detection, and synthesis of dsRNA, are conventional techniques known to those skilled in the art. The equipment, reagents, etc. used are all publicly or commercially available to those skilled in the art.
Example 1: cloning and analysis of Apolygus lineolaris ecdysone receptor gene
RNA was extracted by the TRIzol method, and the total RNA extracted above was synthesized into a cDNA template using the PrimeScript RT Master Mix (perfect real time) kit of Takara, Japan.
The upstream primer sequence ECR-F: 5'-AAACCCGAACCTGAACCCCA-3' the flow of the air in the air conditioner,
the sequence of the downstream primer ECR-R: 5'-CCTCAGCATCATCACTTCGC-3' are provided.
The primers were synthesized by Shanghai Biotechnology engineering services, Inc.
And (3) carrying out PCR amplification by using the primer ECR-F and the primer ECR-R and using the cDNA of the adelphocoris suturalis as a template, and purifying and recovering the target fragment. The recovered PCR product was ligated with pEASY-T1 vector according to the instructions of the Beijing all-purpose gold pEASY-T1 vector, the recombinant vector was transformed into competent cell T1, and cultured overnight in ampicillin-resistant LB medium. After overnight culture, 8 positive clones were picked for PCR verification (system and conditions are the same as above), fresh bacterial liquid was taken for sequencing of the clones that were positive for PCR amplification of colonies, and the protein sequence of the gene was analyzed. The full length of the open reading frame of the molting hormone receptor protein gene of the adelphocoris suturalis is 1413bp, 470 amino acid residues are coded, the predicted molecular mass is 53.7kDa, the theoretical isoelectric point is 4.96, and the gene has the characteristic of the typical molting hormone receptor protein of the adelphocoris suturalis.
Example 2: verifying function of molting hormone receptor protein gene of adelphocoris suturalis
Firstly, preparing dsRNA template
According to the ecdysone receptor protein gene sequence of the lygus intermedius obtained in the example 1, a specific amplification primer (5' -end plus a T7 promoter sequence) is designed for amplifying a dsRNA fragment of the ecdysone receptor protein gene of the lygus intermedius, and the specific primers are designed as follows:
the upstream primer sequence dsECR-F: GGGCCGAAAGAACTCAACAG the flow of the air in the air conditioner,
downstream primer sequence dsECR-R: GGGGCCATTTGAGCATAGTC are provided.
And (3) carrying out PCR amplification by using the primers dsECR-F and dsECR-R by using the adelphocoris suturalis cDNA as a template, purifying and recovering a target fragment, and connecting a PCR product to a pEASY-T1 vector. And selecting a single colony which is positive in colony PCR detection, sequencing, detecting the correctness of the gene sequence, and carrying out shake culture on the single colony with the correct sequencing in 6ml LB + AMP culture medium overnight. Extracting a plasmid containing the target fragment, performing second PCR amplification by using the plasmid as a template and the specific primers dsECR-F and dsECR-R, purifying a product of the second PCR by using a phenol chloroform extraction method, synthesizing dsRNA, and diluting the dsRNA concentration to 10 mu g/mu l for later use.
Secondly, the silencing efficiency of the gene after injecting the molting hormone receptor protein gene dsRNA of the adelphocoris suturalis into the female ovaries and the change situation of the number of the ova and the fecundity of the ovaries
Taking a green fluorescent protein Gene (GFP) double-stranded dsRNA as a contrast, and injecting the adelphocoris suturalis ecdysone receptor protein gene dsRNA into a newly-emerged female insect body from the outermost side of the hindbreast and abdominal internode membranes of the adelphocoris suturalis by a microinjection method.
And (3) detecting silencing efficiency: as shown in FIG. 2, 4 days, 6 days, 8 days, 10 days, 12 days, 14 days, 16 days and 18 days after the injection treatment of the whole plant bug of adelphocoris suturalis were collected, respectively, and after RNA was extracted and reverse-transcribed into cDNA, the same was used as that of Takara, Japan
Figure BDA0002396343780000051
Premix ExTaqTMII and Bio-Rad Detection iQ2 System to detect silencing effects of the ecdysone receptor gene.
Counting the number of ova in the ovary: after 11 days of dsRNA injection, female ovaries were dissected by a stereomicroscope, 20 undismated females were dissected for each treatment, 3 biological replicates were observed, the ovarian morphology was observed, and the number of eggs in the ovary of lygus lucorum was counted and analyzed.
The reproductive capacity: after the female is injected with dsRNA, the female is matched with newly emerged male worms one by one, the male worms are placed into a disposable plastic cup (5cm multiplied by 7cm) for mating, if the male worms die, the new sexually mature male worms are supplemented immediately, 40 pairs of worms are taken as a treatment group, 3 biological repetitions are carried out, and the egg production quantity in the final period is counted, so that the influence of injecting the ecdtor gene dsRNA on the egg production quantity of the adelphocoris suturalis evaluated.
Test results and analysis:
(1) gene silencing efficiency of ecdysone receptor protein of adelphocoris suturalis
Compared with a control group, after the dsRNA of the molting hormone receptor protein gene of the lygus lucorum is injected, the expression quantity of the molting hormone receptor protein gene of the lygus lucorum is obviously reduced in the whole growth period, which shows that the interference sequence of the molting hormone receptor protein gene of the lygus lucorum can obviously inhibit the expression of the molting hormone receptor protein gene of the lygus lucorum.
(2) Influence of injected adelphocoris suturalis ecdysone receptor protein gene dsRNA on number of eggs in ovary of adelphocoris suturalis female
After 11 days of the injection treatment, the ovaries of the female bugs were dissected, the number of ova in the ovaries was counted and the ovarian morphology was observed, and the number of ova in the ovaries of the lygus bugs in the injection treatment group of the ecdysone receptor protein gene dsRNA was reduced by 39.29% compared to the control group (see a panel in fig. 3). The dsRNA of the ecdysone receptor protein gene of the adelphocoris suturalis injected can obviously reduce the number of eggs in ovaries of the adelphocoris suturalis.
(3) Influence of injected adelphocoris suturalis ecdysone receptor protein gene dsRNA on reproductive capacity of adelphocoris suturalis, the newly-emerged female insect is mated with the male insect after being injected with dsRNA, the lifelong egg production amount is counted, and compared with a control group, the egg production amount of the adelphocoris suturalis of the treated group is reduced by 73.32% (see a picture B in a figure 3). Therefore, after the ecdysone receptor protein gene of the adelphocoris suturalis is interfered, the number of ova in ovaries and the reproductive capacity of female insects of the adelphocoris suturalis are obviously inhibited, and the adverse effect is generated on the reproductive capacity and population development of the adelphocoris suturalis. Therefore, the RNA interference sequence provided by the invention can be applied to development of transgenic lygus lucorum resistant plants. Further develops the protein of the adelphocoris suturalis and can be applied to the biological control of adelphocoris suturalis.
Sequence listing
<110> university of agriculture in Huazhong
<120> adelphocoris suturalis ecdysone receptor protein, and coding gene and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 470
<212> PRT
<213> lygus suturalis (Adelphocoris suturalis)
<400> 1
Met Met Gly Glu Glu Lys Arg Thr Asp Asp Asp Trp Met Val Ser Gly
1 5 10 15
Gly Ser Pro Arg Asn Tyr Gln Thr Asn Gly Gly Tyr Pro Ser Pro Thr
20 25 30
Met Ser Ser Asn Ser Tyr Asp Pro Tyr Ser Pro Ser Ser Lys Leu Gly
35 40 45
Arg Glu Asp Leu Ser Pro Pro Asn Ser Leu Asn Gly Tyr Ser Ala Asp
50 55 60
Ser Cys Asp Gly Ser Lys Lys Lys Lys Gly Thr Ala Thr Arg Gln Gln
65 70 75 80
Glu Glu Leu Cys Leu Val Cys Gly Asp Arg Ala Ser Gly Tyr His Tyr
85 90 95
Asn Ala Leu Thr Cys Glu Gly Cys Lys Gly Phe Phe Arg Arg Ser Ile
100 105 110
Thr Lys Asn Ala Val Tyr Gln Cys Lys Tyr Gly Asn Asn Cys Glu Ile
115 120 125
Asp Met Tyr Met Arg Arg Lys Cys Gln Glu Cys Arg Leu Lys Lys Cys
130 135 140
Leu Ser Val Gly Met Arg Pro Glu Cys Val Val Pro Glu Tyr Gln Cys
145 150 155 160
Ala Val Lys Arg Lys Glu Lys Lys Ala Gln Lys Glu Lys Asp Lys Pro
165 170 175
Val Ser Thr Thr Thr Ile Ser Pro Glu Ala Val Lys Pro Glu Pro Glu
180 185 190
Pro His Arg Val Ser Phe Ser Ser Ser Leu Phe Gln Ser Val Ile Lys
195 200 205
Glu Pro Thr Lys Leu Ser Pro Glu Ser Gly Pro Thr Glu Val Ala Leu
210 215 220
Lys His Ser Pro Pro Tyr Gly Ile Lys Pro Val Ser Pro Glu Gln Gln
225 230 235 240
Glu Leu Ile Asn Arg Leu Val Tyr Phe Gln Ser Glu Tyr Glu His Pro
245 250 255
Ser Asp Glu Asp Val Arg Arg Ile Asn Ser Pro Asn Glu Asp Glu Glu
260 265 270
Gln Gln Asp Phe Arg Phe Arg His Ile Thr Glu Ile Thr Ile Leu Thr
275 280 285
Val Gln Leu Ile Val Glu Phe Ala Lys Arg Leu Pro Gly Phe Asp Lys
290 295 300
Ile Ile Lys Glu Asp Gln Ile Ala Leu Leu Lys Ala Cys Ser Ser Glu
305 310 315 320
Val Met Met Leu Arg Thr Ala Arg Lys Tyr Asp Ala Ser Thr Asp Ser
325 330 335
Ile Val Phe Ala Asp Asn Gln Leu Tyr Ser Arg Glu Ser Tyr Asn Leu
340 345 350
Ala Gly Met Gly Asp Val Val Glu Asp Ile Leu Arg Phe Cys Arg His
355 360 365
Met Tyr Arg Met Lys Val Asp Asn Ala Glu Tyr Ala Leu Leu Thr Ala
370 375 380
Ile Val Ile Phe Ser Glu Arg Pro Ser Leu Met Glu Gly Trp Lys Val
385 390 395 400
Glu Lys Ile Gln Glu Ile Tyr Leu Glu Ala Leu Lys Ser Tyr Val Asp
405 410 415
Asn Arg Met Lys Pro Arg Ser Pro Thr Ile Tyr Ala Lys Leu Leu Ser
420 425 430
Val Leu Thr Glu Leu Arg Thr Leu Gly Asn Gln Asn Ser Glu Met Cys
435 440 445
Phe Ser Leu Lys Leu Gln Asn Lys Lys Leu Pro Pro Phe Leu Ala Glu
450 455 460
Ile Trp Asp Val Asn Ser
465 470
<210> 2
<211> 1413
<212> DNA
<213> lygus suturalis (Adelphocoris suturalis)
<400> 2
atgatgggcg aggagaagcg gacagacgat gactggatgg tgagcggtgg ctcccccaga 60
aactaccaga ccaacggggg ctatccgtct ccgaccatgt ccagcaacag ctacgaccct 120
tacagcccca gctctaaact aggtcgagag gacttgagcc cgcccaactc gctgaacggc 180
tactcggccg atagctgcga tggctccaag aagaagaagg ggacggccac ccggcaacaa 240
gaggagctct gcctcgtctg cggagatcga gcctcgggtt accattataa tgctctgacg 300
tgcgagggct gtaaggggtt cttccggcgg agtataacga aaaatgccgt ctaccagtgc 360
aagtacggga acaactgcga gattgacatg tacatgagga gaaaatgtca agagtgccgg 420
cttaaaaaat gtctcagcgt tgggatgagg ccagagtgcg tggtaccgga gtaccagtgc 480
gctgtaaaac ggaaagagaa aaaggcgcag aaggagaagg acaagccggt gagcacgacc 540
accatctccc cggaggccgt caaacccgaa cctgaacccc acagggtcag tttctcatca 600
agcctctttc aatctgtgat caaagagcca accaaactga gtccggaaag cggtcccact 660
gaggttgcgc tcaaacattc gccgccgtac ggcatcaaac cggtgagccc tgagcagcag 720
gaactcatca acaggctcgt ctacttccaa agcgagtacg agcacccttc ggacgaggat 780
gtccggagaa ttaactcccc taacgaagat gaggaacagc aagactttag gtttaggcat 840
ataacagaaa tcactatact caccgttcaa ctcatcgtag agttcgcgaa aaggctcccc 900
ggtttcgaca aaattatcaa agaagatcaa atagcattat taaaggcatg ttctagcgaa 960
gtgatgatgc tgaggacagc gcggaagtat gacgcgagta cggactcaat cgtctttgca 1020
gacaaccagt tgtactctcg agagtcgtac aaccttgccg gcatggggga tgtagtcgaa 1080
gacatcctga ggttctgccg acacatgtac cgaatgaagg tggacaacgc agagtacgcc 1140
ctccttaccg ccatcgttat cttctctgag agaccgtccc tcatggaggg ctggaaggtc 1200
gagaagatcc aagagatcta cttggaagcc ctcaaatcct acgtagacaa ccggatgaaa 1260
ccccgatctc ccacaatcta cgccaaactc ctttctgtcc tcacggaact tcgaacactc 1320
ggcaaccaaa actccgagat gtgcttctcc ctcaagctcc agaacaaaaa gctgccgccc 1380
ttcctagccg agatctggga cgtcaactcg taa 1413

Claims (5)

1. The adelphocoris suturalis ecdysone receptor protein is characterized in that the amino acid sequence of the protein is shown in SEQ ID NO. 1.
2. The adelphocoris suturalis ecdysone receptor protein gene is characterized in that the gene codes the adelphocoris suturalis ecdysone receptor protein of claim 1.
3. The adelphocoris suturalis ecdysone receptor protein gene of claim 2, wherein the nucleotide sequence of the adelphocoris suturalis ecdysone receptor protein gene is shown as SEQ ID No. 2.
4. A recombinant vector comprising the ecdysone receptor protein gene of lygus lucorum of claim 2.
5. A method for reducing the number of eggs in the ovary of adelphocoris suturalis and the amount of eggs produced in the lifetime of adelphocoris suturalis, which comprises the step of introducing the RNA interference sequence of the ecdysone receptor protein gene of adelphocoris suturalis as claimed in claim 2 into adelphocoris suturalis,
amplifying the ecdysone receptor protein gene of the lygus lucorum by the following primers to obtain the RNA interference sequence,
the upstream primer dsECR-F: 5'AAACCCGAACCTGAACCCCA3' of the composition,
downstream primer dsECR-R: 5'CCTCAGCATCATCACTTCGC 3'.
CN202010133106.4A 2020-03-01 2020-03-01 Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof Expired - Fee Related CN111471098B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202010133106.4A CN111471098B (en) 2020-03-01 2020-03-01 Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202010133106.4A CN111471098B (en) 2020-03-01 2020-03-01 Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof

Publications (2)

Publication Number Publication Date
CN111471098A CN111471098A (en) 2020-07-31
CN111471098B true CN111471098B (en) 2022-03-22

Family

ID=71747106

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202010133106.4A Expired - Fee Related CN111471098B (en) 2020-03-01 2020-03-01 Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof

Country Status (1)

Country Link
CN (1) CN111471098B (en)

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002061102A2 (en) * 2000-10-24 2002-08-08 Syngenta Participations Ag Control of gene expression in plants
CN106589125A (en) * 2016-12-23 2017-04-26 江苏省农业科学院 Monoclonal antibody of apolygus lucorum ecdysone resistant receptor protein and application thereof
CN110483631A (en) * 2019-08-07 2019-11-22 华中农业大学 Black striped plant bug reproduction GAP-associated protein GAP PG and its encoding gene, dsRNA interference sequence and application

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002061102A2 (en) * 2000-10-24 2002-08-08 Syngenta Participations Ag Control of gene expression in plants
CN106589125A (en) * 2016-12-23 2017-04-26 江苏省农业科学院 Monoclonal antibody of apolygus lucorum ecdysone resistant receptor protein and application thereof
CN110483631A (en) * 2019-08-07 2019-11-22 华中农业大学 Black striped plant bug reproduction GAP-associated protein GAP PG and its encoding gene, dsRNA interference sequence and application

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Apolygus lucorum ecdysone receptor A isoform (EcR-A) mRNA, complete cds;GenBank: KM401656.1;《GenBank》;20150821;1-2 *
Assessment of suitable reference genes for qRT-PCR analysis in Adelphocoris suturalis;LUO Jing等;《ScienceDirect》;20181231;第17卷(第12期);2745-2757 *
中黑盲蝽TryP和PGL基因的克隆及生殖调控功能研究;朱邦勤;《中国优秀硕士学位论文全文数据库 农业科技辑》;20200215(第02期);D046-124 *

Also Published As

Publication number Publication date
CN111471098A (en) 2020-07-31

Similar Documents

Publication Publication Date Title
CN109734798B (en) Migratory locust serine protease inhibitor 7, and coding gene and application thereof
CN106754948B (en) Nilaparvata lugens NlMLP gene, encoding protein and application thereof
CN108610427B (en) Migratory locust diapause hormone gene and application thereof in regulation and control of insect diapause
CN114957426B (en) SP6RARS and application thereof in preventing and treating cockroaches
CN110483631B (en) Apolygus intermedius reproduction related protein PG, coding gene thereof, dsRNA interference sequence and application
CN114853861B (en) Periplaneta americana PRP protein expression inhibitor, and encoding gene and application thereof
CN111471098B (en) Apolygus lineolarus ecdysone receptor protein and coding gene and application thereof
CN117551652A (en) Welsh onion fluorescent leaf beetle GdBR-C gene and application thereof in RNAi-mediated pest control
CN109679954A (en) The knockout and application of diamondback moth APN3a gene based on CRISPR/Cas9
CN113248586A (en) Application of brown planthopper PIB14 protein and coding gene thereof in regulation and control of plant brown planthopper resistance
CN109734789B (en) Migratory locust FK506 binding protein 46 and coding gene and application thereof
CN116732041B (en) Lethal gene and RNA interference sequence for preventing and controlling myzus persicae by RNA interference and preparation method thereof
CN108588082A (en) Hidden kind of high temperature tolerance related gene B tDnmt3 of Bemisia tabaci MED and its application
CN111378670B (en) Separated adelphocoris suturalis Taiman gene and encoded protein thereof
CN109468336B (en) Brown planthopper protein phosphate gene NlPP1, protein, dsRNA (double-stranded ribonucleic acid) thereof and application
CN111394371B (en) Migratory locust V-ATPase-V1 structural domain gene and application of dsRNA thereof in pest control
CN110106181B (en) Migratory locust low density lipoprotein receptor related gene 2LmLRP2And application of dsRNA thereof in locusta migratoria control
CN112695045A (en) Lepidoptera insect Hpx12 gene and application thereof
CN113564200A (en) Application of tea tree CsCIPK20 gene in improving cold resistance of plants
CN108707603B (en) ESCRT-III core subunit Snf7 double-stranded RNA and preparation method and application thereof
CN109112117B (en) Separated chilo suppressalis CYP15C1 gene and encoded protein thereof
CN109438565B (en) Migratory locust forkhead transcription factor LmFoxO, and coding gene and application thereof
CN111662369B (en) Apolygus linens receptor substrate 1 gene and application thereof
CN118373897A (en) Spodoptera frugiperda EcR gene, application thereof and method for preventing and controlling spodoptera frugiperda
CN109810993B (en) Locust beta-D-glucoside hydrolase gene and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20220322

CF01 Termination of patent right due to non-payment of annual fee