CN112442472B - Recombinant lactococcus lactis for resisting clostridium difficile, live carrier vaccine and preparation method thereof - Google Patents
Recombinant lactococcus lactis for resisting clostridium difficile, live carrier vaccine and preparation method thereof Download PDFInfo
- Publication number
- CN112442472B CN112442472B CN202011379456.5A CN202011379456A CN112442472B CN 112442472 B CN112442472 B CN 112442472B CN 202011379456 A CN202011379456 A CN 202011379456A CN 112442472 B CN112442472 B CN 112442472B
- Authority
- CN
- China
- Prior art keywords
- lactococcus lactis
- clostridium difficile
- recombinant
- tcda
- plasmid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/33—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Clostridium (G)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/08—Clostridium, e.g. Clostridium tetani
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/74—Vectors or expression systems specially adapted for prokaryotic hosts other than E. coli, e.g. Lactobacillus, Micromonospora
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/52—Bacterial cells; Fungal cells; Protozoal cells
- A61K2039/523—Bacterial cells; Fungal cells; Protozoal cells expressing foreign proteins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/542—Mucosal route oral/gastrointestinal
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Plant Pathology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Gastroenterology & Hepatology (AREA)
- Mycology (AREA)
- Immunology (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a recombinant lactococcus lactis resisting clostridium difficile and a preparation method thereof, wherein the recombinant lactococcus lactis is obtained by transforming clostridium difficile subunit TcdA plasmid into a lactococcus lactis carrier. The recombinant lactococcus lactis can be adhered and planted in the intestinal tract for a short time, expresses TcdA protein, induces an organism to generate an immune response, and thus generates a specific antibody. The invention further provides a live vector vaccine which takes the recombinant lactococcus lactis as an effective active ingredient and is used for preventing diseases caused by clostridium difficile infection.
Description
Technical Field
The invention belongs to the technical field of biological pharmacy, relates to a live carrier vaccine for resisting clostridium difficile, and in particular relates to a recombinant lactococcus lactis for resisting clostridium difficile and a live carrier vaccine technology.
Background
Clostridium difficile (Clostridium difficile, CD) is a strictly anaerobic gram-positive bacillus, a direct pathogen for clostridium difficile-associated diarrhea. Because of the improper use of antibiotics and the difficult elimination of clostridium difficile, it is one of the major pathogens of antibiotic diarrhea in hospitals. Mild patients with clostridium difficile infection often present with diarrhea, watery diarrhea-like stool, and cramping abdominal pain; severe patients can become pseudomembranous enteritis, toxic megacolon, and even septic shock death. 100% of pseudomembranous enteritis is associated with this bacterium. The situation is more severe in our country due to the abuse of antibiotic drugs, and the clostridium difficile infection rate has increased to 14% in 2010 to 2016.
Clostridium difficile-associated diarrhea is mostly the result of dysregulation of normal intestinal flora, in which CD is inhibited by the dominant flora and is not pathogenic; when the intestinal flora is deregulated, CD will overmultiply and release toxins, causing clostridium difficile associated diarrhea. The main causative agents of clostridium difficile are toxin a, toxin B and binary toxins.
Toxin a (TcdA, about 308 KDa) is a glycosyltransferase encoded by a TcdA gene located in the pathogenicity determining region (pathogenicity locus, paLoc), also known as enterotoxin; it can bind to toxin receptors of intestinal mucosa cells, causing damage to the intestinal mucosa; it can destroy the close connection between cells, resulting in the damage of epithelial barrier; it can promote the release of strong inflammatory factor, increase the permeability of local mucous membrane blood vessel, and result in damage of villus, hemorrhage and necrosis of mucous membrane. Toxin a is a multi-module site structure, consisting of ABCD modules, with different modules playing different regulatory roles in the pathogenic process: a is a biologically active N-terminal site; b is a C-terminal binding site; c is a cysteine protease site; d is a hydrophobic site. The majority of the toxin A molecular surface structure is composed of a module B repeating unit, and the C-terminal binding site of the module B has strong antigenicity and can trigger humoral immunity and cellular immunity of an organism, thereby protecting cells from being affected by the toxin A. The invention thus focuses on studying the C-terminal repeat sequence of toxin A.
The current conventional treatment regimen for clostridium difficile associated diarrhea is antibiotic therapy with metronidazole, vancomycin, rifampin, and the like. However, the spores cannot be killed, so that repeated infection and multiple drug-resistant strains of the patients can be caused after drug withdrawal. Thus, more and more researchers have proposed that treatment of CD infections should seek new therapies to restore normal flora of the gastrointestinal tract while killing pathogenic strains.
Disclosure of Invention
The invention aims at providing a recombinant lactococcus lactis resisting clostridium difficile and a preparation method thereof, aiming at the prior art, the prepared recombinant lactococcus lactis can be subjected to short-term adhesion colonization and propagation in intestinal tracts, expresses TcdA protein and induces an organism to generate an immune response, so that a specific antibody is generated.
It is another object of the present invention to provide a live vector vaccine comprising recombinant lactococcus lactis as an active ingredient for preventing diseases caused by clostridium difficile infection.
The recombinant lactococcus lactis resisting clostridium difficile is obtained by transforming clostridium difficile subunit TcdA plasmid into lactococcus lactis.
The recombinant lactococcus lactis against clostridium difficile described above was used as a vector for preparing a clostridium difficile subunit TcdA plasmid, pMG36e.
The recombinant lactococcus lactis resisting clostridium difficile is named HXLC 20-1, the preservation unit is CGMCC-China general microbiological culture Collection center, the preservation address is North Chen Xway No.1 hospital No. 3 in the Korean region of Beijing, the preservation number is CGMCC No.20064, the preservation state is survival, the preservation date is 2020 month and 10 days, and the classification is named as lactococcus lactis Lactococcus lactis.
Lactococcus lactis (L.lactis) is used as one of probiotics, can regulate intestinal microbial flora, has strong adjuvant property, and can effectively enhance the immune effect of the vaccine. The lactococcus lactis is used for preparing the oral live carrier vaccine, and the lactococcus lactis can induce organisms to generate nonspecific and specific immunity through oral administration or nasal drip, and can stimulate the organisms to generate sIgA through contacting with the surface area of the mucous membrane to cause mucous membrane immune response. In addition, unlike other lactic acid bacteria, l.lactis is not a normal microbiota of humans and animals, is not substantially colonized the gastrointestinal tract, and immune tolerance due to long-term colonization is avoided to some extent. Therefore, the lactococcus lactis has very good application prospect as a mucous membrane immunity live carrier vaccine, and is an ideal candidate strain. In addition, the lactococcus lactis may be replaced by other host bacteria, such as bifidobacteria, lactobacillus casei, lactococcus lactis, lactobacillus acidophilus, and the like.
The invention further provides a recombinant lactococcus lactis live vector vaccine for resisting clostridium difficile, which comprises an active ingredient and pharmaceutically acceptable auxiliary materials. The active ingredient is the recombinant lactococcus lactis for resisting clostridium difficile. The auxiliary materials are at least one of common auxiliary materials such as pharmaceutically acceptable starch, powdered sugar, lactose, sodium carboxymethyl cellulose, hydrogenated vegetable oil and the like.
The invention further provides a preparation method of the recombinant lactococcus lactis resisting clostridium difficile, which comprises the following steps:
(1) Recombinant plasmid: inserting a target gene fragment TcdA of clostridium difficile subunits into the vector plasmid subjected to double digestion to obtain a recombinant plasmid;
(2) Recombinant lactococcus lactis: and electrically transforming the recombinant plasmid into the lactococcus lactis competent cells to obtain the recombinant lactococcus lactis.
In the preparation method of the clostridium difficile subunit lactococcus lactis live vector vaccine, in the step (1), a target gene fragment TcdA for encoding clostridium difficile subunits is synthesized, and the nucleic acid sequence is as follows:
GCAAAATGGTTACCGGTGTTTTCAAAGGTCCGAACGGTTTCGAATACTTCGCTCC GGCTAACACCCACAACAACAACATCGAAGGTCAGGCTATCGTTTACCAGAACAAATTC CTGACCCTGAACGGTAAAAAATACTACTTCGACAACGACTCTAAAGCTGTTACCGGTT GGCAGACCATCGACGGTAAAAAATACTACTTCAACCTGAACACCGCTGAAGCTGCTAC CGGTTGGCAGACCATCGACGGTAAAAAATACTACTTCAACCTGAACACCGCTGAAGCT GCTACCGGTTGGCAGACCATCGACGGTAAAAAATACTACTTCAACACCAACACCTTCA TCGCTTCTACCGGTTACACCTCTATCAACGGTAAACACTTCTACTTCAACACCGACGGT ATCATGCAGATCGGTGTTTTCAAAGGTCCGAACGGTTTCGAATACTTCGCTCCGGCTAA CACCGACGCTAACAACATCGAAGGTCAGGCTATCCTGTACCAGAACAAATTCCTGACC CTGAACGGTAAAAAATACTACTTCGGTTCTGACTCTAAAGCTGTTACCGGTCTGCGTAC CATCGACGGTAAAAAATACTACTTCAACACCAACACCGCTGTTGCTGTTACCGGTTGG CAGACCATCAACGGTAAAAAATACTACTTCAACACCAACACCTCTATCGCTTCTACCG GTTACACCATCATCTCTGGTAAACACTTCTACTTCAACACCGACGGTATCATGCAGATC GGTGTTTTCAAAGGTCCGGACGGTTTCGAATACTTCGCTCCGGCTAACACCGACGCTA ACAACATCGAAGGTCAGGCTATCCGTTACCAGAACCGTTTCCTGTACCTGCACGACAA CATCTACTACTTCGGTAACAACTCTAAAGCTGCTACCGGTTGGGTTACCATCGACGGTA ACCGTTACTACTTCGAACCGAACACCGCTATGGGTGCTAACGGTTACAAAACCATCGA CAACAAAAACTTCTACTTCCGTAACGGTCTGCCGCAGATCGGTGTTTTCAAAGGTTCT AACGGTTTCGAATACTTCGCTCCGGCTAACACCGACGCTAACAACATCGAAGGTCAGG CTATCCGTTACCAGAACCGTTTCCTGCACCTGCTGGGTAAAATCTACTACTTCGGTAAC AACTCTAAAGCTGTTACCGGTTGGCAGACCATCAACGGTAAAGTTTACTACTTCATGCC GGACACCGCTATGGCTGCTGCTGGTGGTCTGTTCGAAATCGACGGTGTTATCTACTTCT TCGGTGTTGACGGTGTTAAAGCTCCGGGTATCTACGGT。
in the method for producing a clostridium difficile-resistant lactococcus lactis, in the step (1), the mass ratio of the target gene fragment TcdA of the clostridium difficile subunit to the vector for the recombinant plasmid is (15 to 30): 5 to 10.
The step (1) comprises the following sub-steps:
(11) Taking a TcdA/pUC57-Simple plasmid as a DNA template, and obtaining a target gene through double enzyme digestion;
(12) Carrying out double enzyme digestion on the carrier;
(13) Connecting a target gene fragment TcdA obtained by double enzyme digestion with a vector by using ligase;
(14) Transferring the connection product obtained in the step (13) into competent cells of escherichia coli for culture;
(15) And (3) extracting plasmids from the culture solution obtained in the step (14) to obtain recombinant plasmids.
The step (2) comprises the following sub-steps:
(21) Preparing lactococcus lactis sensing cells;
(22) Electrotransformation of the recombinant plasmid into lactococcus lactis competent cells to obtain recombinant clostridium lactis resistant to clostridium difficile, the steps comprising the following sub-steps:
(221) In an ice bath environment, uniformly mixing the recombinant plasmid with lactococcus lactis competent cells, and then placing the mixture in an electrotransport device for electric excitation;
(222) And after the electric excitation is finished, adding a regeneration culture medium into the obtained mixed system, and incubating to obtain a culture solution containing the recombinant lactococcus lactis.
The invention further provides application of the clostridium difficile resistant lactococcus lactis in preparing a live carrier vaccine against clostridium difficile.
Compared with the prior art, the invention has the following beneficial effects:
1. the recombinant lactococcus lactis provided by the invention has good immunogenicity and immune protection effect, can effectively prevent clostridium difficile infection, and is safe and nontoxic.
2. The recombinant lactococcus lactis provided by the invention can regulate intestinal microbial flora, induce organisms to generate nonspecific immunity and cause mucosal immune response.
3. The invention takes lactococcus lactis as a carrier, can be adhered and planted in the intestinal tract for a short time, expresses TcdA protein, induces organism to generate immune response, and thus generates specific antibody.
4. The lactococcus lactis used in the invention can also play an adjuvant characteristic, and enhance the immune effect of the vaccine, thereby playing roles in protecting hosts and preventing clostridium difficile.
5. The preparation method of the recombinant lactococcus lactis provided by the invention has the advantages of simple preparation process, direct application, oral immunization, no need of injection administration, economy and avoidance of potential infection danger of intravenous injection, thereby providing a potential effective method for preventing clostridium difficile.
Drawings
FIG. 1 shows the results of double cleavage of the target gene TcdA; wherein, (a) is a detection map, lane 1 is an enzyme digestion result, and a fragment of about 1360bp is obtained; lane M is Mark; (b) standard lane size for Mark.
FIG. 2 shows the results of single Xba I cleavage assay for recombinant plasmid pMG36 e/TcdA; wherein, (a) is a detection map, lanes 1-3 are enzyme digestion results, and fragments of about 5000bp are obtained; lane M is Mark; (b) standard lane size for Mark.
FIG. 3 shows the results of single Xba I cleavage assay for recombinant lactococcus lactis pMG36 e/TcdA/LL; wherein, (a) is a detection map, lanes 1-3 are plasmids, and the obtained fragment is less than about 5000bp; lane 4 is a negative plasmid, resulting in a fragment of less than about 3600bp; lanes 5-7 show the result of cleavage, resulting in a fragment of about 5000bp; lane 8 is a negative cleavage result, resulting in a fragment of about 3600bp; lane M is Mark; (b) standard lane size for Mark.
FIG. 4 is a PCR identification of recombinant lactococcus lactis pMG36 e/TcdA/LL; wherein, (a) is a detection map, lanes 1-3 are PCR identification results, and fragments of about 2000bp are obtained; lane M is Mark; (b) is the standard lane size of Mark.
FIG. 5 shows the SDS-PAGE identification of recombinant lactococcus lactis; wherein, (a) is a detection map, lane 1 is an identification result of the lactococcus lactis loaded in no space, lane 2 is an identification result of the lactococcus lactis recombinant, the target protein is about 50kDa, and lane M is Mark; (b) standard lane size for Mark.
FIG. 6 shows the results of Western Blot identification of recombinant lactococcus lactis; wherein, (a) is a detection map, lane 1 is an identification result of recombinant lactococcus lactis, the target protein is about 50kDa, lane 2 is an identification result of empty lactococcus lactis, and lane M is Mark; (b) standard lane size for Mark.
Detailed Description
The following description of the embodiments of the present invention will be made more fully hereinafter with reference to the accompanying drawings, in which it is evident that the embodiments described are only some, but not all embodiments of the invention. All other embodiments, which can be made by one of ordinary skill in the art without undue burden on the person of ordinary skill in the art based on the embodiments of the present invention, are within the scope of the present invention.
Example recombinant Clostridium difficile subunit TcdA plasmid preparation and identification of the lactococcus lactis Strain
The target gene fragment of clostridium difficile subunit TcdA used in this example was as follows (base sequences underlined as cleavage sites Xba I and Sac I):
CCATGGGCAAAATGGTTACCGGTGTTTTCAAAGGTCCGAACGGTTTCGAATACTT CGCTCCGGCTAACACCCACAACAACAACATCGAAGGTCAGGCTATCGTTTACCAGAAC AAATTCCTGACCCTGAACGGTAAAAAATACTACTTCGACAACGACTCTAAAGCTGTTA CCGGTTGGCAGACCATCGACGGTAAAAAATACTACTTCAACCTGAACACCGCTGAAGC TGCTACCGGTTGGCAGACCATCGACGGTAAAAAATACTACTTCAACCTGAACACCGCT GAAGCTGCTACCGGTTGGCAGACCATCGACGGTAAAAAATACTACTTCAACACCAACA CCTTCATCGCTTCTACCGGTTACACCTCTATCAACGGTAAACACTTCTACTTCAACACC GACGGTATCATGCAGATCGGTGTTTTCAAAGGTCCGAACGGTTTCGAATACTTCGCTCC GGCTAACACCGACGCTAACAACATCGAAGGTCAGGCTATCCTGTACCAGAACAAATTC CTGACCCTGAACGGTAAAAAATACTACTTCGGTTCTGACTCTAAAGCTGTTACCGGTCT GCGTACCATCGACGGTAAAAAATACTACTTCAACACCAACACCGCTGTTGCTGTTACC GGTTGGCAGACCATCAACGGTAAAAAATACTACTTCAACACCAACACCTCTATCGCTT CTACCGGTTACACCATCATCTCTGGTAAACACTTCTACTTCAACACCGACGGTATCATG CAGATCGGTGTTTTCAAAGGTCCGGACGGTTTCGAATACTTCGCTCCGGCTAACACCG ACGCTAACAACATCGAAGGTCAGGCTATCCGTTACCAGAACCGTTTCCTGTACCTGCA CGACAACATCTACTACTTCGGTAACAACTCTAAAGCTGCTACCGGTTGGGTTACCATCG ACGGTAACCGTTACTACTTCGAACCGAACACCGCTATGGGTGCTAACGGTTACAAAAC CATCGACAACAAAAACTTCTACTTCCGTAACGGTCTGCCGCAGATCGGTGTTTTCAAA GGTTCTAACGGTTTCGAATACTTCGCTCCGGCTAACACCGACGCTAACAACATCGAAG GTCAGGCTATCCGTTACCAGAACCGTTTCCTGCACCTGCTGGGTAAAATCTACTACTTC GGTAACAACTCTAAAGCTGTTACCGGTTGGCAGACCATCAACGGTAAAGTTTACTACT TCATGCCGGACACCGCTATGGCTGCTGCTGGTGGTCTGTTCGAAATCGACGGTGTTATC TACTTCTTCGGTGTTGACGGTGTTAAAGCTCCGGGTATCTACGGTCTCGAG
the cleavage sites Xba I and Sac I described above can also be replaced by other conventional cleavage sites present on the vector pMG36e used in the art.
According to the base sequence of clostridium difficile subunit TcdA, a target gene fragment of clostridium difficile subunit TcdA is obtained by double digestion (the digestion sites are respectively Xba I and Sac I), then plasmids pUC57-Simple are inserted into the Xba I and the Sac I, and the target gene fragment is stored in escherichia coli Top10 and is marked as pUC57-Simple/TcdA/Top10.
The preparation method of the clostridium difficile subunit resistant lactococcus lactis live vector vaccine provided by the embodiment comprises the following steps:
(1) Recombinant plasmid: the target gene fragment of clostridium difficile subunit TcdA is inserted into a vector plasmid after double enzyme digestion to obtain a recombinant plasmid. The method comprises the following sub-steps:
(11) The TcdA/pUC57-Simple plasmid is used as a DNA template, and the target gene is obtained through double enzyme digestion.
A Diaspin column plasmid DNA miniprep kit (Diamond, B110091-0100) was used to extract plasmids from the strain pUC57-Simple/TcdA/Top10 as DNA templates. The cleavage reaction system described in Table 1 was obtained by double cleavage. After the reaction, the enzyme digestion system obtained by double enzyme digestion was subjected to electrophoresis detection by using 1.5% agarose gel, and the result is shown in FIG. 1. As can be seen from FIG. 1, the band of interest is about 1360 bp. Then, the target fragment is recovered by using an agarose gel DNA recovery kit (TIANGEN, DP 209-03); wherein the concentration of the target gene fragment TcdA is 22 mug/. Mu.L.
TABLE 1 cleavage reaction System
(12) And carrying out double enzyme digestion on the vector to obtain a vector plasmid.
The vector pMG36e (available from Feng Hui organism, YH 014) was subjected to double cleavage with Xba I/Sac I to give the cleavage reaction system shown in Table 2. After the reaction is finished, carrying out electrophoresis detection on an enzyme digestion system obtained by double enzyme digestion by using 1.5% agarose gel, and then recovering a vector pMG36e by using an ultrathin DNA product purification kit (TIANGEN, DP 203-02); wherein the concentration of the vector pMG36e was 8. Mu.g/. Mu.L.
TABLE 2 cleavage reaction System
(13) The target gene fragment and the vector are ligated by using a ligase.
At 10 xT 4 DNA Ligase Buffer, T is used 4 Ligase the gene fragment TcdA recovered in step (12) and the vector pMG36e were ligated at 22℃for 2 hours, and the ligation system was shown in Table 3.
Table 3 connection system
(14) Transferring the connection product obtained in the step (13) into competent cells of escherichia coli for culture.
Transferring the ligation product into competent cells of E.coli Top10 (purchased from Producer, B528412-0010), standing in ice bath for 30min, heat-shocking at 42deg.C for 90sec, standing in ice bath for 3min, adding 1ml of SOC culture medium, and incubating at 37deg.C under shaking at 220rpm for 45min; after the incubation, 100. Mu.l of the bacterial liquid was spread on a plate containing erythromycin resistance LB (LB Culture) and incubated overnight at 37 ℃. Thereafter, single colonies were picked from the transformation plate, inoculated into LB medium containing erythromycin resistance, and cultured overnight at 37℃and 220 rpm.
(15) Extracting plasmids from the culture solution obtained in the step (14) by using a kit to obtain pMG36e/TcdA recombinant plasmids, wherein the concentration of the pMG36e/TcdA recombinant plasmids in the kit eluent is 0.1-1 mg/mL.
The extracted plasmid was subjected to Xba I single cleavage, and the cleavage reaction system shown in Table 4 was referred to. After the completion of the reaction, the cleavage system obtained by the single cleavage was subjected to electrophoresis using 1.5% agarose gel, and the results are shown in FIG. 2. As can be seen from FIG. 2, the band of interest is around 5000 bp.
TABLE 4 cleavage reaction System
The recombinant plasmid obtained in step (15) was sent to sequencing (in this example, completed by the company of Biotechnology Co., ltd.) and the sequencing result was completely consistent with the submitted synthetic sequence information, indicating successful construction of the pMG36e/TcdA recombinant plasmid.
(2) Recombinant lactococcus lactis: and electrically transforming the recombinant plasmid into the lactococcus lactis competent cells to obtain the recombinant lactococcus lactis. The method comprises the following sub-steps:
(21) Preparation of lactococcus lactis sensory cells comprising the following sub-steps:
(211) Culturing lactococcus lactis.
The lactococcus lactis used in the implementation is named HXLC 20-1 and is stored in China general microbiological culture Collection center (CGMCC) with the preservation number of CGMCC No.20064.
2mL of lactococcus lactis was inoculated in an amount of 2% to 100mL of MRS medium containing 1% glycine, and cultured at 30℃and 220rpm for 5 hours to mid-log phase.
(212) And (3) performing centrifugal washing on the cultured lactococcus lactis for a plurality of times to obtain lactococcus lactis sensing cells.
First, the bacterial liquid obtained by the culture was transferred to two pre-chilled 50mL centrifuge tubes, and the tubes were placed in an ice bath for cooling for 20min.
Then, respectively washing bacterial liquid in the two centrifuge tubes, which specifically comprises the following operations: (i) Centrifuging the two centrifuge tubes at 4 ℃ and 4000rpm for 7min, absorbing the supernatant, and then adding 30mL of precooled sterile water into the two centrifuge tubes respectively, and gently blowing to mix the bacterial precipitate uniformly; (ii) The two centrifuge tubes were centrifuged at 4000rpm for 7min at 4℃to remove the supernatant, 30mL of a pre-chilled washing solution (sterile water containing 0.5M sucrose and 10% glycerol) was added to each of the two centrifuge tubes, gently blown, and the bacterial pellet was mixed uniformly, and the two centrifuge tubes were combined into one tube.
Thirdly, washing the bacterial liquid in the combined centrifuge tube, wherein the method specifically comprises the following steps of: (i) Centrifuging the centrifuge tube at 4 ℃ and 4000rpm for 7min, absorbing the supernatant, adding 30mL of precooled washing liquid (sterile water containing 0.5M sucrose and 10% glycerol), gently blowing, and uniformly mixing the bacterial precipitate; (ii) Centrifuging the centrifuge tube at 4 ℃ and 4000rpm for 7min, sucking the supernatant, adding 10mL of precooled washing liquid (sterile water containing 0.5M sucrose and 10% glycerol, gently blowing to uniformly mix the bacterial precipitate), centrifuging the centrifuge tube at 4 ℃ and 4000rpm for 7min, sucking the supernatant, adding 2mL of precooled preservation liquid (sterile water containing 0.5M sucrose and 10% glycerol), gently blowing to uniformly mix to obtain bacterial suspension containing lactococcus lactis receptive cells.
Finally, the bacterial suspension is sub-packaged into a pre-cooled 1.5mL sterile centrifuge tube according to 100 mu L/tube, and the sterile centrifuge tube is preserved at the temperature of-80 ℃ for standby.
(22) Electrotransformation of recombinant plasmid pMG36e/TcdA into competent cells of lactococcus lactis to obtain recombinant lactococcus lactis resistant to Clostridium difficile, comprising the following steps:
(221) Uniformly mixing the pMG36e/TcdA recombinant plasmid with lactococcus lactis competent cells in an ice bath environment, and then placing the mixture in an electrotransport device for electric excitation;
after 10. Mu.L of the pMG36e/TcdA recombinant plasmid of step (15) and 100. Mu.L of lactococcus lactis competent cells were gently mixed, the mixture was placed in a pre-cooled 2mm electrotransformation cup, and the cup was allowed to stand in an ice bath for 5min, and all the above operations were performed in an ice bath environment.
Then, the electric rotating cup is quickly cleaned, and the electric rotating cup is placed in an electric rotating instrument for electric excitation under the condition of: 200 Ω, 10kV/cm, 25. Mu.F.
(222) And after the electric excitation is finished, adding a regeneration culture medium into the obtained mixed system, and incubating to obtain a culture solution containing the recombinant lactococcus lactis strain.
Immediately after the end of the electric stimulation, 1mL of regeneration medium (containing 0.5M sucrose, 20mM MgCl) was added to the electric rotor 2 、 20mM CaCl 2 After being uniformly mixed, the MRS culture medium is transferred into a 1.5mL centrifuge tube, then placed in an ice bath for standing for 10min, and then incubated for 2h at 30 ℃ under the condition of 220rpm with shaking.
After that, 100. Mu.L of the resulting incubation product was plated on MRS medium plates containing erythromycin resistance, and cultured overnight at 30℃to give a monoclonal strain containing recombinant lactococcus lactis pMG36 e/TcdA/LL.
The strain identification, recombinant protein TcdA and immunogenicity identification and stability detection are carried out on the clostridium difficile subunit-resistant lactococcus lactis live vector vaccine prepared in the embodiment.
Screening and identification of recombinant strains
Single colonies were picked from plates of broth containing the live carrier vaccine against Clostridium difficile subunit lactococcus lactis and inoculated into MRS medium containing erythromycin resistance, and incubated at 30℃for 5h at 220 rpm. And extracting plasmids after the bacterial liquid is turbid.
The extracted plasmid was subjected to XbaI single cleavage assay (cleavage reaction system is the same as Table 4 above), and the single cleavage conditions were: xba I was inserted into the corresponding cleavage site in a mixed system of 10X Fast Digest Buffer buffer and deionized water, and then digested at 37℃for 1h. After the completion of the reaction, the cleavage system obtained by the single cleavage was subjected to electrophoresis using 1.5% agarose gel, and the results are shown in FIG. 2. As can be seen from FIG. 3, the band of interest is about 5000 bp.
The plasmid with correct single enzyme digestion identification result is subjected to PCR amplification identification by using pMG36e-cxF/pMG36e-cxR as a primer (an amplification reaction system is shown in Table 5, and reaction conditions are shown in Table 6). After completion of the reaction, electrophoresis was performed on a 1.5% agarose gel, and the results are shown in FIG. 4. As can be seen from FIG. 4, the band of interest is about 2000 bp.
TABLE 5 amplification System
TABLE 6 reaction system
The correct plasmid for PCR identification was sequenced (in this example by the company of Biotechnology Co., ltd.) and the sequencing result was completely consistent with the submitted synthetic sequence information, indicating successful construction of the recombinant lactococcus lactis pMG36e/TcdA/LL strain.
(II) identification of recombinant protein TcdA and its immunogenicity
Recombinant lactococcus lactis pMG36e/TcdA/LL strain candidate vaccine and pMG36e/LL empty recombinant strain (preparation method is the same as above) were cultured in MRS medium containing erythromycin resistance, and centrifuged at 5000rpm for 10min, and the culture supernatant was collected.
The supernatant was concentrated to 1/10 of the original volume by ultrafiltration tube, and then subjected to SDS-PAGE electrophoresis, the results of which are shown in FIG. 5. As seen in FIG. 5, there is a band of interest at 50kDa, indicating successful expression of recombinant protein TcdA.
The expected band of interest in the SDS-PAGE gel was excised and silver nitrate stained using the Pierce silver staining kit (Thermo, 24600). The stained target band was then transferred to PVDF membrane and SDS-PAGE gel of the same size after methanol treatment at 4℃overnight, and the voltage across the electrotransfer membrane was 14V. After the electrotransfer, the PVDF membrane is soaked in PBST for 10min, and then is put into 5% skimmed milk powder for sealing for 1h. Then TcdA immune mouse positive antisera was added as primary antibody, after overnight at 4 ℃, incubated at room temperature with gentle shaking for 1h, and then washed with PBST. Then, HRP-labeled goat anti-mouse IgG (manufacturer, cat No. D10087-0100) was added, incubated at room temperature with gentle shaking for 1h, and washed with PBST.
The PVDF membrane was developed according to Pierce high sensitivity substrate chromogenic kit (Thermo, 34096) and the results are shown in FIG. 6. As seen in FIG. 6, the target band was clearly detected at 50kDa for recombinant lactococcus lactis pMG36e/TcdA/LL relative to the pMG36e/LL empty recombinant strain, indicating that the expressed TcdA protein was immunogenic and successfully constructed as a live vector vaccine strain against clostridium difficile subunit lactococcus lactis.
(III) stability test of recombinant lactococcus lactis
The growth curve of the pMG36e/TcdA/LL strain was measured to give the time of its lag phase and generation.
After subculturing recombinant lactococcus lactis pMG36e/TcdA/LL to 20 th and 40 th passages at 30℃and 220rpm, 100. Mu.L of fresh bacterial liquid was randomly applied and inoculated onto MRS medium plates without erythromycin resistance, and cultured overnight at 30 ℃.100 individual colonies from each plate were randomly picked and plated onto MRS medium plates without and with erythromycin resistance, and incubated overnight at 30 ℃.100% growth of the erythromycin-resistant plate is not contained, 98% growth of the erythromycin-resistant plate is contained, and the recombinant lactococcus lactis pMG36e/TcdA/LL can be stably passaged in vitro under the condition of selection pressure or not.
Application example recombinant lactococcus lactis has immunoprotection against Clostridium difficile infected mice
(1) Characterization of specific antibodies
Recombinant lactococcus lactis pMG36e/TcdA/LL and pMG36e/LL were inoculated into MRS medium containing 4. Mu.g/mL erythromycin, cultured at 30℃and 220rpm to mid-log phase, and the bacterial solution was adjusted to 10 with physiological saline 10 CFU/mL was ready for use.
30 SPF-class female BalB/c mice were randomly divided into a blank group, a negative group and an experimental lease three groups of 10 each. Blank mice were filled with 200 μl of sterile physiological saline per mouse, and negative mice were filled with 200 μl of 10 per mouse 10 CFU/mL recombinant lactococcus lactis pMG36e/LL bacterial liquid, 200 mu L of 10 per mouse of experimental group were intragastric 10 CFU/mL recombinant lactococcus lactis pMG36e/TcdA/LL bacterial liquid. The administration was performed by intragastric administration at 0d, 1d, 2d, 7d, 14d, 23d, respectively.
Tail blood was collected from each group of mice 0d, 7d, 23d, and the supernatant (i.e., serum) was centrifuged and assayed for specific IgG level changes in the mice TcdA by ELISA. The results show that the antibody titers of the experimental groups continue to increase compared to the blank and negative groups, reaching 1 at 23 d: 2626144 and positive rate up to 100%, which shows that recombinant lactococcus lactis pMG36e/TcdA/LL in experimental group successfully colonizes, and smoothly secretes and expresses recombinant protein TcdA, and stimulates the host to produce specific antibody.
(2) Immunoprotection effect
Inoculating fresh Clostridium difficile into a bullous meat liquid culture medium, anaerobically culturing at 37deg.C and 100rpm to logarithmic phase, and adjusting bacterial liquid to 10 with physiological saline 5 CFU/mL was ready for use.
Each group of mice was given 10mg clindamycin from 19d, and the drinking water was supplemented with an antibiotic cocktail (0.4 mg/mL kanamycin, 0.035mg/mL gentamicin, 850U/mL colistin, 0.215mg/mL metronidazole, 0.045mg/mL vancomycin) for three consecutive days.
After completion of clindamycin gavage for 4h at 21d, each group of mice was gavaged with 0.3mL gastric acid neutralization solution (NaHCO) 3 : hank' s=1: 4) After 30min, 100 μL 10 of each mouse was lavaged 5 CFU/mL Clostridium difficile broth.
The animal is observed every 4 hours within 72 hours after the toxin is removed, and the animal is observed to see whether the animal has diarrhea and death or not due to the appearance and luster of feces, anus, activity and fur. The results show that the mice in the blank group all have diarrhea and severe symptoms after the challenge, and die after 1d of the challenge, and the mice in the group at 5d all die. The negative group had all diarrhea after challenge but symptoms were slightly lighter than the blank group, improvement occurred after the last 23d dosing, and 2 mice in this group died. The experimental group showed slight diarrhea in 2 mice at 1d after challenge, and the diarrhea was stopped in 2d after the last administration of pMG36e/TcdA/LL strain, and no mice in the group died. Indicating that recombinant lactococcus lactis pMG36e/TcdA/LL has immunoprotection against Clostridium difficile infected mice.
Those of ordinary skill in the art will recognize that the embodiments described herein are for the purpose of aiding the reader in understanding the principles of the present invention and should be understood that the scope of the invention is not limited to such specific statements and embodiments. Those of ordinary skill in the art can make various other specific modifications and combinations from the teachings of the present disclosure without departing from the spirit thereof, and such modifications and combinations remain within the scope of the present disclosure.
Sequence listing
<110> Huaxi Hospital at university of Sichuan
<120> recombinant lactococcus lactis against clostridium difficile, live vector vaccine and method for preparing the same
<130> 001
<141> 2020-11-30
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1319
<212> DNA
<213> Clostridium difficile (Clostridium difficile)
<400> 1
gcaaaatggt taccggtgtt ttcaaaggtc cgaacggttt cgaatacttc gctccggcta 60
acacccacaa caacaacatc gaaggtcagg ctatcgttta ccagaacaaa ttcctgaccc 120
tgaacggtaa aaaatactac ttcgacaacg actctaaagc tgttaccggt tggcagacca 180
tcgacggtaa aaaatactac ttcaacctga acaccgctga agctgctacc ggttggcaga 240
ccatcgacgg taaaaaatac tacttcaacc tgaacaccgc tgaagctgct accggttggc 300
agaccatcga cggtaaaaaa tactacttca acaccaacac cttcatcgct tctaccggtt 360
acacctctat caacggtaaa cacttctact tcaacaccga cggtatcatg cagatcggtg 420
ttttcaaagg tccgaacggt ttcgaatact tcgctccggc taacaccgac gctaacaaca 480
tcgaaggtca ggctatcctg taccagaaca aattcctgac cctgaacggt aaaaaatact 540
acttcggttc tgactctaaa gctgttaccg gtctgcgtac catcgacggt aaaaaatact 600
acttcaacac caacaccgct gttgctgtta ccggttggca gaccatcaac ggtaaaaaat 660
actacttcaa caccaacacc tctatcgctt ctaccggtta caccatcatc tctggtaaac 720
acttctactt caacaccgac ggtatcatgc agatcggtgt tttcaaaggt ccggacggtt 780
tcgaatactt cgctccggct aacaccgacg ctaacaacat cgaaggtcag gctatccgtt 840
accagaaccg tttcctgtac ctgcacgaca acatctacta cttcggtaac aactctaaag 900
ctgctaccgg ttgggttacc atcgacggta accgttacta cttcgaaccg aacaccgcta 960
tgggtgctaa cggttacaaa accatcgaca acaaaaactt ctacttccgt aacggtctgc 1020
cgcagatcgg tgttttcaaa ggttctaacg gtttcgaata cttcgctccg gctaacaccg 1080
acgctaacaa catcgaaggt caggctatcc gttaccagaa ccgtttcctg cacctgctgg 1140
gtaaaatcta ctacttcggt aacaactcta aagctgttac cggttggcag accatcaacg 1200
gtaaagttta ctacttcatg ccggacaccg ctatggctgc tgctggtggt ctgttcgaaa 1260
tcgacggtgt tatctacttc ttcggtgttg acggtgttaa agctccgggt atctacggt 1319
Claims (7)
1. A recombinant lactococcus lactis resisting clostridium difficile is characterized in that the recombinant lactococcus lactis is obtained by transforming a clostridium difficile subunit TcdA plasmid into the lactococcus lactis; the nucleic acid sequence of the clostridium difficile subunit TcdA is shown in Seq No. 1.
2. Recombinant lactococcus lactis against clostridium difficile according to claim 1, wherein the vector for preparing the clostridium difficile subunit TcdA plasmid is pMG36e.
3. The recombinant lactococcus lactis resistant to clostridium difficile according to claim 1, wherein the lactococcus lactis is designated as hxlc 20-1 and is stored in the China general microbiological culture collection center with the preservation number of CGMCC No.20064.
4. The recombinant lactococcus lactis live carrier vaccine for resisting clostridium difficile is characterized by comprising an active ingredient and pharmaceutically acceptable auxiliary materials; an active ingredient of the vaccine is a recombinant clostridium difficile resistant lactococcus lactis according to any one of claims 1 to 3.
5. The recombinant lactococcus lactis live vector vaccine against clostridium difficile according to claim 4, wherein the excipient is at least one of pharmaceutically acceptable starch, powdered sugar, lactose, sodium carboxymethyl cellulose, hydrogenated vegetable oil.
6. A process for the preparation of clostridium difficile resistant lactococcus lactis according to any one of claims 1 to 3, characterised in that it comprises the steps of:
(1) Recombinant plasmid: inserting a target gene fragment TcdA of clostridium difficile subunits into a vector subjected to double digestion to obtain a recombinant plasmid;
(2) Recombinant lactococcus lactis: and electrically transforming the recombinant plasmid into the lactococcus lactis competent cells to obtain the recombinant lactococcus lactis.
7. Use of a lactic acid bacterium according to any one of claims 1 to 3 against clostridium difficile for the preparation of a live vector vaccine against clostridium difficile.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011379456.5A CN112442472B (en) | 2020-11-30 | 2020-11-30 | Recombinant lactococcus lactis for resisting clostridium difficile, live carrier vaccine and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011379456.5A CN112442472B (en) | 2020-11-30 | 2020-11-30 | Recombinant lactococcus lactis for resisting clostridium difficile, live carrier vaccine and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112442472A CN112442472A (en) | 2021-03-05 |
| CN112442472B true CN112442472B (en) | 2023-05-26 |
Family
ID=74739129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011379456.5A Active CN112442472B (en) | 2020-11-30 | 2020-11-30 | Recombinant lactococcus lactis for resisting clostridium difficile, live carrier vaccine and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112442472B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104039816A (en) * | 2012-01-27 | 2014-09-10 | 默沙东公司 | Vaccines against clostridium difficile comprising recombinant toxins |
Family Cites Families (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP1169456B1 (en) * | 1999-04-09 | 2012-07-11 | Intercell USA, Inc. | Recombinant production of Clostridium difficile Toxin A or Toxin B |
| BRPI0919236A8 (en) * | 2008-09-17 | 2023-01-31 | Novartis Ag | GAS COMBINATION THERAPEUTIC AND VACCINES |
| US10046040B2 (en) * | 2009-11-16 | 2018-08-14 | University Of Maryland, Baltimore | Multivalent live vector vaccine against Clostridium difficile-associated disease |
| CN102181457B (en) * | 2011-03-21 | 2012-07-04 | 王世霞 | Clostridium difficile exotoxin B amino-terminal gene sequence with optimized codon and nucleic vaccine of clostridium difficile exotoxin B |
| CN102743746A (en) * | 2012-06-13 | 2012-10-24 | 广州医学院第一附属医院 | Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof |
| CN103865938B (en) * | 2012-12-16 | 2016-10-05 | 山东国际生物科技园发展有限公司 | The application of clostridium difficile exotoxin A carboxy-terminal stream cipher optimization gene fragment, expression vector establishment method and expressing protein thereof |
| CA2910200A1 (en) * | 2013-04-22 | 2014-10-30 | Board Of Regents Of The University Of Oklahoma | Clostridium difficile vaccine and methods of use |
| EP3388069B1 (en) * | 2017-04-12 | 2019-05-01 | ETH Zurich | Consortia of living bacteria useful for treatment of microbiome dysbiosis |
| IT201700101704A1 (en) * | 2017-09-12 | 2019-03-12 | Sofar Spa | NEW USE FOR TREATMENT OF DIFFICULT CLOSTRIDIUM INFECTIONS |
| JP2021502970A (en) * | 2017-11-15 | 2021-02-04 | エヴェロ バイオサイエンシズ，インコーポレーテッド | Compositions and Methods for Treating Immune Disorders Using the Immunomodulatory Lactococcus Bacterial Strain |
| WO2020061357A1 (en) * | 2018-09-20 | 2020-03-26 | The Royal Institution For The Advancement Of Learning/Mcgill University | Vaccine, method of vaccination against clostridium difficile |
| CN112812189B (en) * | 2020-11-30 | 2022-05-17 | 四川大学华西医院 | Nano antibody for resisting glycosyltransferase A subunit and application thereof |
| CN112322553B (en) * | 2020-11-30 | 2022-09-27 | 四川大学华西医院 | Clostridium difficile resistant lactococcus lactis and application thereof |
-
2020
- 2020-11-30 CN CN202011379456.5A patent/CN112442472B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104039816A (en) * | 2012-01-27 | 2014-09-10 | 默沙东公司 | Vaccines against clostridium difficile comprising recombinant toxins |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112442472A (en) | 2021-03-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU767143B2 (en) | Lactobacilli harboring aggregation and mucin binding genes as vaccine delivery vehicles | |
| US8900594B2 (en) | Oral recombinant Helicobacter pylori vaccine and preparing method thereof | |
| CN106188307B (en) | A kind of fusion protein, preparation method and a boar oral vaccine or drug | |
| WO2008114889A1 (en) | Oral vaccine | |
| CN104593397A (en) | Optimized enterotoxigenic escherichia coli-producing polyvalent antigen gene sequence and application thereof in preventing weaned piglet diarrhea | |
| CN107653260A (en) | A kind of preparation method and application of Recombinant Lactococcus lactis | |
| CN102276730A (en) | Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof | |
| Yang et al. | Alleviation of enterotoxigenic Escherichia coli challenge by recombinant Lactobacillus plantarum expressing a FaeG-and DC-targeting peptide fusion protein | |
| CN101880647B (en) | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application | |
| AU726429B2 (en) | Helicobacter pylori adhesin binding group antigen | |
| CN103275228A (en) | K99-987P-F41 recombinant protein and application thereof | |
| CN101157907B (en) | Recombinant salmonella choleraesuis strain for expression of pig origin bordetella bronchisepatica fhaB and prn gene segment, bacterin and uses thereof | |
| BRPI1003750A2 (en) | recombinant microorganisms, methods of preparation of vaccine strains, antigens, vectorized vaccine compositions, their uses, antibodies, diagnostic kit and methods of treatment and / or prophylaxis | |
| CN112442472B (en) | Recombinant lactococcus lactis for resisting clostridium difficile, live carrier vaccine and preparation method thereof | |
| CN104894045A (en) | Recombinant lactobacillus for coexpression of foot and mouth disease virus VP1 gene and immunoadjuvant cattle IL-6 gene, and preparation method and application of recombinant lactobacillus | |
| CN107619816A (en) | A kind of genetic engineering lactic acid bacteria oral vaccine strain of targeted delivery vaccine antigen and its purposes in chicken colibacillosis is prevented and treated | |
| CN109468255B (en) | Probiotic clone strain integrating single-copy functional F4 pilus operon gene, construction method and application | |
| CN109468256B (en) | Probiotic clone strain integrating four-copy F18 pilus operon gene and double-copy F4 pilus operon gene and construction method | |
| CN110295134A (en) | A kind of building and its application of surface display c-type perfringens alpha, β toxin protein recombinant plant lactobacillus | |
| CN103127498A (en) | Recombination antigen composition, vaccine and carrier and method for preparing antigen composition | |
| CN115991749A (en) | Porcine infectious pleuropneumonia-porcine pasteurellosis bigeminal subunit vaccine | |
| CN1864746B (en) | Gene engineered poly-valence subunit vaccine of pylorus Hp AhpC-NapA and preparation method thereof | |
| CN102676570B (en) | Recombinant bacillus subtilis immunoglobulin binding protein functional-domain expression vector and application thereof | |
| CN109504643B (en) | Probiotic clone strain integrating four-copy functional F18 pilus operon gene, construction method and application | |
| CN102268444B (en) | Expression of truncated SasA protein of staphylococcus aureus in escherichia coli and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |