CN102743746A - Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof - Google Patents

Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof Download PDF

Info

Publication number
CN102743746A
CN102743746A CN 201210194915 CN201210194915A CN102743746A CN 102743746 A CN102743746 A CN 102743746A CN 201210194915 CN201210194915 CN 201210194915 CN 201210194915 A CN201210194915 A CN 201210194915A CN 102743746 A CN102743746 A CN 102743746A
Authority
CN
China
Prior art keywords
toxin
clostridium difficile
live bacterial
male
gene
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 201210194915
Other languages
Chinese (zh)
Inventor
陈学清
杨晓强
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
FIRST AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL SCHOOL
Original Assignee
FIRST AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL SCHOOL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by FIRST AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL SCHOOL filed Critical FIRST AFFILIATED HOSPITAL OF GUANGZHOU MEDICAL SCHOOL
Priority to CN 201210194915 priority Critical patent/CN102743746A/en
Publication of CN102743746A publication Critical patent/CN102743746A/en
Pending legal-status Critical Current

Links

Images

Landscapes

  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses a live bacterial vaccine for controlling intestinal infection caused by positive clostridium difficile of clostridium difficile toxin A, wherein the vaccine contains thymidylate synthetase ThyA gene defective recombined lactic streptococci; and tests of the vaccine verify that the vaccine is safe and effective. The invention also discloses a preparation method of the live bacterial vaccine, and a use of the live bacterial vaccine in the preparation of medicines for controlling the intestinal infection caused by the positive clostridium difficile of the clostridium difficile toxin A.

Description

A kind of control is by the live bacterial vaccines of intestinal infection due to the clostridium difficile
Technical field
The present invention relates to a kind of control by the live bacterial vaccines of intestinal infection due to the clostridium difficile, be specifically related to a kind of live bacterial vaccines of preventing and treating intestinal infection due to the male clostridium difficile of Toxin A Toxin A (Clostridium difficile clone seq5).
Background technology
(clostridium difficile is a kind of Gram-positive anaerobic spore-bearing bacilli CD) to clostridium difficile, is one of pathogen of most important hospital infection.Research shows, bacterium is relevant therewith with nearly 100% pseudomembranous enteritis for about clinically 10 ~ 20% antibiotic-associated diarrhea.Clostridium difficile associated diarrhea (Clostridium difficile-associated diarrhea; CDAD) mainly betide the person that takes the antibiotic for a long time; Also can betide other and influence normal intestinal flora; Reduce the situation that the opposing clostridium difficile is grown surely, as with antitumor drug, for a long time in hospital, immunodeficiency etc., particularly those have immunologic function reduction person and/or old people.The CDAD complicated clinical manifestation is various, from asymptomatic carrier to explosive colitis.Patient with severe symptoms's poor prognosis, mortality rate is up to 40%.The treatment of CDAD is divided into antibacterial therapy and non-antibacterial therapy.In the antibacterial therapy,, be prone to recurrence after 5～30% patient's drug withdrawals, also can cause the secondary multiple antibiotic resistant strain to infect though 95% patient is responsive to metronidazole or vancomycin.One of main means of non-antibacterial therapy are to adopt ecological agent, can be used as treatment adjuvant drug or prevention of recurrence.But because antibiotic " non-selectivity " bactericidal action, the effect that ecological bacterium is brought into play in the prevention of CDAD is very limited.Therefore, be necessary to explore new control CDAD method.And effectively vaccine is prevented and treated the optimal approaches and methods of CDAD just.
Clostridium difficile mainly produces two kinds of toxin: toxin A and toxin B.Toxin B and toxin A gene have certain homology, and two genes are positioned at the repetitive sequence of C end, play the binding film receptor acting, and the N terminal sequence is the enzyme and the toxic action district of toxin.Toxin A molecular surface structure major part is made up of the terminal repetition unit of C-, has formed the adhesion area (TxAC314, i.e. 14CDTA, 14C-terminal toxin A repeats) of toxin A molecule.Proved to have protective effect already, can suppress the cytotoxicity and the intestinal toxicity of toxin A to the antibody of adhesion area.Clostridium difficile vaccine to the toxin A design also can be prevented and treated the male C. difficile infection of A toxin effectively.
Both at home and abroad the technology to the clostridium difficile vaccine research mainly is divided into following three types: 1. passive immunity type vaccine: as with clostridium difficile thalline or recombinant toxin immune hen after formaldehyde treated; Obtain Yolk immune globulin IgY; After purified, the oral medication C. difficile infection.Perhaps with engineered method expression and purification to the recombinant monoclonal antibodies of clostridium difficile toxin.The advantage of this type vaccine is not only can prevent, can also be as therapeutic vaccine, but cost is high, preserves inconvenience such as transportation.2. active immunity type vaccine: as after clostridium difficile being produced strain culturing filtrate and thalline and using the formalin deactivation respectively, with the attenuated vaccine of cholera toxin as the mucosal adjuvants preparation; Combine be built into vaccine as carrier protein with the polysaccharide covalent of other source of disease microorganisms with Toxin A Toxin A (Clostridium difficile clone seq5) c-terminus recurring unit through dna recombinant expression in addition; Perhaps use gene recombination technology; At the repetitive sequence of 3 of e. coli expression toxin A and toxin B gene ' end, recombinant vaccine such as combine behind the recombinant polypeptide purification with polysaccharide.This but type vaccine be in adopting formalin to handle antigen, or be used adjuvant during immunity, and some adopt invasive immunization routes (like subcutaneous, intraperitoneal injection etc.), therefore, are difficult for during human use being accepted by the patient; 3. oral live bacterial vaccines also is a kind of of active immunity type vaccine in fact.With expressing the nontoxic receptor binding domain of Toxin A Toxin A (Clostridium difficile clone seq5) c-terminus in attenuation vibrio cholera or the attenuation bacillus typhi murium; Form attenuated live vaccine; Raise viable bacteria through nasal cavity and stomach, in lung, intestinal mucosa and serum, produce the antitoxin A antibody and the tetanus toxin antibody of high titre.The advantage of this type live bacterial vaccines is economical, convenient; Immune protective effect is preferably also arranged, also can make many Jie vaccine simultaneously, but owing to adopted attenuation typhoid fever bacterium or vibrio cholera as carrier bacterium at present; Its biological peaceful property merits attention when human use, thereby further improved necessity is arranged.
Streptococcus acidi lactici (Streptococcus lactis; Lactococcus lactis) be a kind of gram-positive cocci, be considered to a kind of harmless, safer antibacterial (generally regarded as safe, GRAS).As a kind of food industry bacterium, it is widely used in dairy processing industry.Breast chain bacterium is used to express multiple biological polypeptide or albumen in recent years in a large number, and (interleukin 2, IL2), IL6, IL10 and trefoil peptide etc. as expressing interleukin-22.Because the newborn chain bacterium antibacterial that is food stage, so the newborn chain bacterium of reorganization also is used as a kind of carrier of safe biological product.For example, it is oral that the reorganization of the secretion IL10 that warp is transformed breast chain bacterium can be used as viable bacteria, expresses the reaction of IL10 inflammation-inhibiting thereby directly get into intestinal.Breast chain bacterium also is used to the research work of oral vaccine.As with the antigen L7/L12 of Bacillus abortus (Brucella abortus) and the proteic film anchor series of M6 (the cell wall anchoring of streptococcus pyogenes (Streptococcus pyogenes); CWA) connect into expressing fusion protein in newborn chain bacterium; Can make surface that antigen is anchored to newborn chain bacterium to increase antigenicity, form the oral live bacterial vaccines (Food-grade live vaccine) that the food stage that brucella infects is produced in anti-current.
Along with the increase of aged tendency of population and tumor incidence, antibiotic etc. to reasons such as the influential drug uses of intestinal microbial population, the C. difficile infection rate has increase trend clinically.The vaccine of studying a kind of anti-C. difficile infection newly is the effective means of preventing and treating C. difficile infection.But at present still the no-trump streptococcus acidi lactici is used for the live bacterial vaccines research of intestinal infection due to the male clostridium difficile of Toxin A Toxin A (Clostridium difficile clone seq5) as expression vector.
Summary of the invention
First purpose of the present invention is to provide a kind of live bacterial vaccines of preventing and treating intestinal infection due to the male clostridium difficile of Toxin A Toxin A (Clostridium difficile clone seq5), and this live bacterial vaccines is safe and effective through verification experimental verification.
Second purpose of the present invention is to provide the method for preparing of the live bacterial vaccines of intestinal infection due to the male clostridium difficile of above-mentioned control Toxin A Toxin A (Clostridium difficile clone seq5), this method for preparing have cost low, can prepare in a large number and advantage such as technology is simple.
Last purpose of the present invention is to provide the purposes of live bacterial vaccines in the intestinal infection medicine due to preparation has the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) of intestinal infection due to the male clostridium difficile of above-mentioned control Toxin A Toxin A (Clostridium difficile clone seq5).
First purpose of the present invention realizes through following technical scheme: a kind of live bacterial vaccines of preventing and treating intestinal infection due to the male clostridium difficile of Toxin A Toxin A (Clostridium difficile clone seq5), said vaccine contains thymidylate synthetase ThyA gene defection type recombination lactic acid streptococcus.
Wherein, described thymidylate synthetase ThyA gene defection type recombination lactic acid streptococcus obtains through following mode: the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of employing expression-secretion type replaces the thymidylate synthetase ThyA gene order of streptococcus acidi lactici.
The fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of described expression-secretion type obtains in the following manner: with signal peptide sequence SPUsp45, clostridium difficile A toxin C terminal repeat 14CDTA and the avirulence tetanus toxin C fragment sequence TETC of streptococcus acidi lactici secreted protein 45 genes, be connected to form the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of expression-secretion type with engineered method by correct reading frame.
Preferred; The fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of described expression-secretion type obtains in the following manner: with signal peptide sequence SPUsp45, clostridium difficile A toxin C terminal repeat 14CDTA, avirulence tetanus toxin C fragment sequence TETC and the proteic film anchor series of the streptococcus pyogenes M6 CWAM6 of streptococcus acidi lactici secreted protein 45 genes, be connected to form the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of expression-secretion type with engineered method by correct reading frame.
Wherein, The nucleotide sequence of the signal peptide sequence SPUsp45 of streptococcus acidi lactici secreted protein 45 genes is shown in SEQ ID NO.1; Aminoacid sequence is shown in SEQ ID NO.2, and the nucleotide sequence of clostridium difficile A toxin C terminal repeat 14CDTA is shown in SEQ ID NO.3, and aminoacid sequence is shown in SEQ ID NO.4; The nucleotide sequence of avirulence tetanus toxin C fragment sequence TETC is shown in SEQ ID NO.5; Aminoacid sequence is shown in SEQ ID NO.6, and the nucleotide sequence of the proteic film anchor series of streptococcus pyogenes M6 CWAM6 is shown in SEQ ID NO.7, and aminoacid sequence is shown in SEQ ID NO.8.
Promptly combine the vaccine research technology of existing C. difficile infection and the technology that streptococcus acidi lactici is used in live bacterial vaccines; It is the expression bacterium (carrier) of antigen protein that the inventor adopts the streptococcus acidi lactici of food stage; Express the adhesion area (TxAC314 of Toxin A Toxin A (Clostridium difficile clone seq5) molecule; Be 14CDTA; 14C-terminal toxin A repeats) albumen is as antigen, and whole reorganization bacterium is stimulated the create antagonism antibody of 14CDTA of body as oral vaccine, is used to prevent and treat the male clostridium difficile intestinal infection of toxin A.
Preferably; With the streptococcus acidi lactici viable bacteria is the expression vector of vaccine; Express clostridium difficile A toxin C terminal repeat (14CDTA) antigen; Coexpression avirulence tetanus toxin C fragment (TETC) is as the biological adjuvant of vaccine, with thymidylate synthetase (thymidylate synthase, ThyA) the gene defection type recombination lactic acid streptococcus of engineered method preparation.Promptly at first clostridium difficile A toxin C terminal repeat (14CDTA) antigen and avirulence tetanus toxin C fragment (TETC) sequence are formed a kind of fusion rotein; Then at the aminoterminal of antigen-4 fusion protein gene (N end; 5' end) has the signal peptide (75-181 of one section streptococcus acidi lactici secreted protein 45 (L.lactis secreted protein (Usp45) gene) gene; GeneBank accessionNo.M60178) sequence is as the signal peptide of streptococcus acidi lactici expressed fusion protein.Also be signal peptide sequence, clostridium difficile A toxin C terminal repeat (14CDTA) and avirulence tetanus toxin C fragment (TETC) sequence of streptococcus acidi lactici secreted protein 45 genes, the fusion rotein of anti-Toxin A Toxin A (Clostridium difficile clone seq5) that is connected to form the expression-secretion type by correct reading frame with gene engineering method is as the antigen of anti-clostridium difficile oral vaccine.And adopt the thymidylate synthase gene sequence of antigen-4 fusion protein gene sequence replacing streptococcus acidi lactici of the anti-clostridium difficile A of above-mentioned secreting type; Prepared thymidylate synthetase (thymidylate synthase, ThyA) gene defection type recombination lactic acid streptococcus with the fusion rotein of the anti-clostridium difficile A of expression-secretion type as vaccine.
Best; With the streptococcus acidi lactici viable bacteria is the expression vector of vaccine; Express clostridium difficile A toxin C terminal repeat (14CDTA) antigen, coexpression avirulence tetanus toxin C fragment (TETC) is as the biological adjuvant of vaccine, and the proteic film anchor series of coexpression streptococcus pyogenes M6 (CWAM6) is to strengthen the immune effect of vaccine; Thymidylate synthetase (thymidylate synthase, ThyA) gene defection type recombination lactic acid streptococcus with engineered method preparation.Promptly at first with clostridium difficile A toxin C terminal repeat (14CDTA) antigen and avirulence tetanus toxin C fragment (TETC) sequence and the proteic film grappling of streptococcus pyogenes M6 (CWAM6) sequence coexpression; Form a kind of fusion rotein, this fusion rotein mainly is anchored to the surface of streptococcus acidi lactici as antigen; Then at the aminoterminal of antigen-4 fusion protein gene (N end; 5' end) has the signal peptide (75-181 of one section streptococcus acidi lactici secreted protein 45 (L.lactis secreted protein (Usp45) gene) gene; GeneBank accession No.M60178) sequence is as the signal peptide of streptococcus acidi lactici expressed fusion protein.Also be signal peptide sequence, clostridium difficile A toxin C terminal repeat (14CDTA), avirulence tetanus toxin C fragment (TETC) sequence and the proteic film grappling of streptococcus pyogenes M6 (CWAM6) sequence of streptococcus acidi lactici secreted protein 45 genes, the fusion rotein of anti-Toxin A Toxin A (Clostridium difficile clone seq5) that is connected to form the expression-secretion type by correct reading frame with gene engineering method is as the antigen of anti-clostridium difficile oral vaccine.And adopt the thymidylate synthase gene sequence of antigen-4 fusion protein gene sequence replacing streptococcus acidi lactici of the anti-clostridium difficile A of above-mentioned secreting type; Prepared thymidylate synthetase (thymidylate synthase, ThyA) gene defection type recombination lactic acid streptococcus with the fusion rotein of the anti-clostridium difficile A of expression-secretion type as vaccine.
Said streptococcus acidi lactici is a food stage industry bacterium.
Second purpose of the present invention realizes through following technical scheme: the method for preparing of the live bacterial vaccines of intestinal infection due to the male clostridium difficile of above-mentioned control Toxin A Toxin A (Clostridium difficile clone seq5); After above-mentioned thymidylate synthetase ThyA gene defection type recombination lactic acid streptococcus cultivated, obtain the oral live bacterial vaccines of the intestinal infection due to the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) in containing the culture medium of thymidine.
The concentration of said thymidine is preferably 10 ~ 30 μ M.
The dosage form of said live bacterial vaccines is an oral agents.
The 3rd purpose of the present invention realizes through following technical scheme: the purposes of the live bacterial vaccines of intestinal infection in the intestinal infection medicine due to preparation has the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) due to the male clostridium difficile of above-mentioned control Toxin A Toxin A (Clostridium difficile clone seq5).
The present invention has following advantage: the dosage form of this vaccine is an oral agents, and taking convenience is convenient to preserve and transportation.
Description of drawings
Fig. 1 is the structure sketch map of the live bacterial vaccines of intestinal infection due to the control Toxin A Toxin A (Clostridium difficile clone seq5) male clostridium difficile among the embodiment 1; Wherein A makes up 14CDTA fusion rotein coexpression unit in newborn chain bacterium to make up sketch map, and it will express a kind of film anchor ingot albumen; B makes up thyA gene knockout unit sketch map in the newborn chain bacterium, ThyA-Up: newborn chain bacterium ThyA gene upstream sequence, contain ThyA gene promoter (promoter) and ribosome binding site (ribosomal binding site, RBS); The proteic signal peptide of SPUsp45:USP45 (Signal peptide ofUsp45); 14CDTA: the avirulence antigen sequence of Toxin A Toxin A (Clostridium difficile clone seq5); CWAM6: Codocyte film M6 protein sequence (sequence encoding the cell wall M6protein), TETC: the avirulent C fragment of tetanus; ThyA-Down:ThyA gene downstream sequence contains the terminator of ThyA gene;
Fig. 2 be in embodiment 2 and 3 with the structure sketch map of plasmid in the plasmid expression 14CDTA fusion rotein test, wherein A is for only containing the newborn chain bacterium of the blank plasmid of pTRKH2; B is in the plasmid of newborn chain bacterium, includes the element of expressing the 14CDTA secretory protein, comprises TETC and 14CDTA, but does not express memebrane protein CWAM6; C is in the plasmid of newborn chain bacterium, expresses the 14CDTA fusion rotein that has memebrane protein CWAM6, P: be promoter; RBS: ribosome binding site (ribosomal binding site); The proteic signal peptide of SPUsp45:USP45 (Signal peptide of Usp45); 14CDTA: the avirulence antigen sequence of Toxin A Toxin A (Clostridium difficile clone seq5); CWAM6: Codocyte film M6 protein sequence (sequence encoding the cell wall M6protein); TETC: the avirulent C fragment of tetanus; TUSP45 is the termination codon of chain acid streptococci USP45 gene;
Fig. 3 is the design drawing (by gene construction kit software development) of expression system among the embodiment 1.Wherein, Leukorrhagia line be written as the p59 promoter greatly; The red letter of the capitalization of leukorrhagia line is respectively-10 districts and-35 districts, is RBS with the lower case of blue underscore, and capitalizing blue bold-type letter is the proteic signal peptide of Usp45 partly (SPusp45); Green capitalization shows MCS (do not show the terminator part, row is cloned and is connected again in addition);
Fig. 4 is that embodiment 1 expression system is verified in escherichia coli, the expression laser confocal microscope observed result of pNBC2000-EGFP in escherichia coli, and EGFP is behind pcr amplification; Be subcloned in the pNBC2000 carrier; Change escherichia coli (figure E, F) over to, and the escherichia coli that transform with the pNBC2000 plasmid are as blank (figure C, D), the escherichia coli that the pBS-EGFP plasmid transforms are as negative control (figure A, B); Wherein, Figure A, C, E are fluoroscopic image, and figure B, D, F are DIC (differential interference contrasts method) image, and the result shows expression system that we make up correct expression alien gene in escherichia coli;
Fig. 5 is the checking in newborn chain bacterium lives of embodiment 1 expression system; The expression laser confocal microscope observed result of pNBCL2000-EGFP in newborn chain bacterium; The newborn chain bacterium (A, B) that contains pNBCL2000-EGFP contains the newborn chain bacterium (C, D) of pNBCL2000, wherein; Figure A, C are fluoroscopic image, and figure B, D are DIC (differential interference contrasts method) image;
Fig. 6 be reorganization TETC albumen the localization and expression of newborn chain bacterium (↑ be the TETC of secreting, expressing, ↑ be the TETC M of film grappling expression: the protein standard; 1: the newborn chain bacterium LL-pNBCL1002 total protein of recombinating; The newborn chain bacterium LL-pNBCL1002 that recombinates goes up albumin; 3: the newborn chain bacterium LL-pNBCL2002 total protein of recombinating; 4: the newborn chain bacterium LL-pNBCL2002 memebrane protein of recombinating; 5: newborn chain bacterium LL-pTRKH2 total protein 6: newborn chain bacterium LL-pTRKH2 goes up albumin; 7: newborn chain bacterium LL-pTRKH2 memebrane protein; 8 newborn chain bacterium total proteins; 9: albumin on the newborn chain bacterium);
Fig. 7 is LL-pNBCL1002, LL-pNBCL2002 recombiant protein immunoblotting assay result (1:LL-pNBCL1002 bacterial protein; The last albumin of 2:LL-pNBCL1002; The 3:LL-pNBCL2002 bacterial protein; The 4:L:L-pNBCL2002 memebrane protein; The 5:LL-pTRKH2 bacterial protein; The last albumin of 6:LL-pTRKH2; The 7:LL-pTRKH2 memebrane protein)
Fig. 8 recombinate the expression of TETC-14CDTA fusion rotein in newborn chain bacterium (↑ be the TETC-14CDTA of secreting, expressing, ↑ the TETC-14CDTAM that expresses for the film grappling: protein standard; 1: the newborn chain bacterium LL-pNBCL1003 total protein of recombinating; The newborn chain bacterium LL-pNBCL1003 that recombinates goes up albumin; 3: the newborn chain bacterium LL-pNBCL2003 total protein of recombinating; 4: the newborn chain bacterium LL-pNBCL2003 memebrane protein of recombinating; 5: newborn chain bacterium LL-pTRKH2 total protein 6: newborn chain bacterium LL-pTRKH2 goes up albumin; 7: newborn chain bacterium LL-pTRKH2 memebrane protein; 8: newborn chain bacterium total protein; 9: albumin on the newborn chain bacterium);
Fig. 9 LL-pNBCL1003, LL-pNBCL2003 recombiant protein immunoblotting assay result (on Lane 1:LL-pNBCL1003 bacterial protein and the tetanus antitoxin Lane 2:LL-pNBCL1003 on albumin and tetanus antitoxin Lane 3:LL-pNBCL1003 bacterial protein and the clostridium difficile A toxin antibody Lane 4:LL-pNBCL1003 albumin and clostridium difficile A toxin antibody Lane 5 LL-pNBCL2003 bacterial proteins and tetanus antitoxin Lane 6 LL-pNBCL1003 film anchorins and tetanus antitoxin Lane7 LL-pNBCL2003 bacterial protein and clostridium difficile A toxin antibody Lane 8 LL-pNBCL2003 film anchorins and clostridium difficile A toxin antibody);
Newborn chain bacterium live bacterial vaccines vaccination regimen of reorganization and zoopery arrangement of time procedure chart among Figure 10 embodiment 3;
Figure 11 is the comparison diagram that clostridium difficile is attacked accumulation diarrhoea incidence rate between each treated animal of back among the embodiment 3;
Figure 12 is the comparison diagram that clostridium difficile is attacked survival rate between each treated animal of back among the embodiment 3;
Respectively organize the life span between laboratory animal after clostridium difficile is attacked among Figure 13 embodiment 3 and attack back existence natural law comparison diagram;
Figure 14 is the comparison diagram that clostridium difficile is attacked cumulative mortality between each treated animal of back among the embodiment 3;
Figure 15 is the comparison diagram that clostridium difficile is attacked body weight between each treated animal of front and back among the embodiment 3;
Figure 16 is the microscope sketch map of intestinal tube, enteric cavity and the colon of embodiment 3 empty matched group Golden Hamster, wherein Golden Hamster dilatation of intestine, and enteric cavity is hemorrhage, and colonic does not have shaping feces;
Figure 17 is the caecum of embodiment 3 empty matched group Golden Hamster and the microscope sketch map of colon, wherein hemorrhage, edema of cecum mucosa and visible part mucomembranous defect, and vascular lake disappears; Adjacent mucous membrane of colon edema, ulcer;
Figure 18 is that LL-pTRKH2 organizes the dying Golden Hamster enteric cavity and the microscope sketch map of colon among the embodiment 3, and wherein dying Golden Hamster enteric cavity is slightly expanded, tension force increases, and edema, congestion, colonic do not have shaping feces;
Figure 19 is the microscope sketch map of LL-pTRKH2 group caecum among the embodiment 3, wherein organizes the cecum mucosa edema, is dispersed in petechia and erosion;
Figure 20 is the microscope sketch map of LL-pNBCL2003 group and LL-pNBCL1003 group intestinal tube and colon among the embodiment 3, and wherein these two groups of intestinal tubes are not expanded, and do not have obvious congestion and hemorrhage sign, and tension force is normal, and colonic has shaping feces;
Figure 21 is the microscope sketch map of LL-pNBCL1003 group caecum among the embodiment 3, and wherein cecum mucosa does not have obvious edema, and vascular lake is clear;
Figure 22 is the microscope sketch map of LL-pNBCL2003 group caecum among the embodiment 3, and wherein cecum mucosa does not have obvious edema, and vascular lake is clear;
Figure 23 is the microscope sketch map of embodiment 3 empty matched group Golden Hamster caecums, blank group mucomembranous defect wherein, and body of gland destroys, and is extensively hemorrhage, and submucosa showed edema has medium to a large amount of neutrophil infiltration;
Figure 24 is the microscope sketch map of LL-pTRKH2 group caecum among the embodiment 3, and wherein LL-pTRKH2 group mucomembranous defect is light than the blank group, and a small amount of hemorrhage and a large amount of neutrophil infiltration are arranged under the mucosa, and abscess forms;
Figure 25 is the microscope sketch map of LL-pNBCL1003 group caecum among the embodiment 3, and wherein LL-pNBCL1003 group mucous epithelium is slight impaired complete, and tela submucosa has a large amount of neutrophil infiltration, and crypts shoals;
Figure 26 is the microscope sketch map of LL-pNBCL2003 group caecum among the embodiment 3, and wherein LL-pNBCL2003 group mucomembranous defect is lighter, and a small amount of neutrophil infiltration is only arranged;
Figure 27 is embodiment 3 empty matched groups, LL-pTRKH2 group, LL-pNBCL1003 rents and the LL-pNBCL2003 group reaches histopathology scoring comparison diagram substantially; Wherein a and blank group compare p=0.000; B and LL-pTRKH2 group be p=0.000 relatively, and c and LL-pNBCL2003 be p=0.616 relatively;
Figure 28 is serum and the anti-clostridium difficile A of intestinal juice toxin specific antibody IgG and IgA testing result figure among the embodiment 3, wherein compares P＜0.05 with the blank group; Compare with non-recombiant plasmid breast chain bacterium group, P=0.116 is compared in P＜0.000 with LL-pNBCL1003;
Figure 29 be among the embodiment 3 anti-TETC-14CDTA serum to the Cytotoxic figure of influence of clostridium difficile A toxin, wherein A. normal control group; B.A toxin processed group; C. serum is incubated group in advance; D. serum processed group.
The specific embodiment
Below in conjunction with accompanying drawing the present invention is done further elaboration, but content of the present invention is not limited thereto.
The live bacterial vaccines and the preparation process thereof of intestinal infection due to the male clostridium difficile of first's control Toxin A Toxin A (Clostridium difficile clone seq5)
Embodiment 1
1. the carrier of vaccine antigen expressed (express bacterium)
Adopt streptococcus acidi lactici (Streptococcus lactis; Lactococcus lactis) as the carrier of the 14CDTA protein molecular (antigen) of expressing clostridium difficile, streptococcus acidi lactici is a kind of gram-positive cocci, is a kind of facultative anaerobe; Be considered to a kind of harmless; (generally regarded as safe GRAS), also is a kind of food industry bacterium to safer antibacterial; Be widely used in dairy processing industry, for example the streptococcus acidi lactici of Chinese industrial microorganism fungus kind preservation center preservation (CICC numbering: 6023) etc.
Streptococcus acidi lactici with the M17 culture medium (Difco, Detroit, Mich) or similar culture medium culturing; Be incubated in 30 ℃ of anaerobism or the aerobic environment; For ThyA gene defection type streptococcus acidi lactici, in culture medium, to add thymidine (thymidine), its concentration is about 20 μ M; The culture medium that the M17 culture medium is produced by Difco company can be used after only needing to add the distilled water high pressure.
2. adopt adhesion area (TxAC314, i.e. 14CDTA, the 14C-terminal toxin A repeats) albumen of the Toxin A Toxin A (Clostridium difficile clone seq5) molecule that streptococcus acidi lactici expresses following as antigenic characteristic:
2.1 the adhesion area (TxAC314 of Toxin A Toxin A (Clostridium difficile clone seq5) molecule; Be 14CDTA; 14C-terminal toxin A repeats) albumen is avirulent; The nucleotide sequence of clostridium difficile A toxin C terminal repeat 14CDTA is shown in SEQ ID NO.3, and aminoacid sequence is shown in SEQ ID NO.4.
2.2 for the benefit of the 14CDTA molecule stimulates body to produce immunoreation; The 14CDTA molecule is the secretory protein formal representation; For reaching this purpose; Hold the signal peptide sequence that will add newborn chain bacterium secreted protein 45 (L.lactis secreted protein Usp45 gene) at 5 ' of 14CDTA molecular sequences, the nucleotide sequence of the signal peptide sequence SPUsp45 of streptococcus acidi lactici secreted protein 45 genes is shown in SEQ ID NO.1, and aminoacid sequence is shown in SEQ ID NO.2.
2.3 in order the secreting type 14CDTA that expresses to be anchored to the expression of streptococcus acidi lactici; With enhancement antigen property; The gene of construction expression film anchorin from the emm6 gene of streptococcus pyogenes in the coding proteic film anchor series of M6 (CWAM6) (1479-2111; GeneBank accession No.M11338), the nucleotide sequence of the proteic film anchor series of its streptococcus pyogenes M6 CWAM6 is shown in SEQ ID NO.7, and aminoacid sequence is shown in SEQ ID NO.8.
2.4 for the immunoreation of enhancing body for 14CDTA, except that 14CDTA being anchored to the streptococcus acidi lactici surface, the antigenicity of strengthening 14CDTA is crucial technical step; A kind of biovaccine that this vaccine adopts; Be avirulence tetanus toxin C fragment (TETC) sequence (GeneBank accession no.M12739,367-1719), but in order to help the expression of TETC in newborn chain bacterium; Codon according to newborn chain bacterium; The gene order of design TETC, the TETC nucleotide sequence that is used for this vaccine is shown in SEQ ID NO.5, and aminoacid sequence is shown in SEQ ID NO.6.
The reorganization live bacterial vaccines structure
3.1 newborn chain bacterium is expressed the structure of expression system
(promoter 59 3.1.1 the promoter 59 of the Streptococcus cremoris (Lactococcus lactis subsp.cremoris) that is suitable for using in the newborn chain bacterium is selected in the sequence of newborn chain bacterium secretion type expression system and acquisition for use; P59) (GeneBank accession No.M24806;) as promoter; Select ribosome binding site (the Ribosome binding site of newborn chain bacterium secreted protein 45 (L.lactis secreted protein Usp45 gene) for use; RBS) and signal peptide (75-181, GeneBank accession No.M60178) sequence as RBS and signal peptide; Behind signal peptide, insert MCS, design newborn chain bacterium secreting, expressing system sequence, nucleotide sequence such as SEQ ID NO.9 and sequence shown in Figure 3 are used software DNASTAR 5.0; 1 oligonucleotide of the Design of length of the oligonucleotide of every 40bp makes two adjacent oligonucleotide have 20bp complementary each other, and (detailed method is seen Yang Xiaoqiang to the sequence PU of the method acquisition total length 341bp of employing gene splicing; Peng Chunxiu, Jiang Bo, Xing Rui; Zhang Shaorong; Chen Xueqing. the structure of newborn chain bacterium expression system and evaluation [J] thereof. No.1 Military Medical Univ.'s journal, 2005,25 (10): 1232～1235.).
3.1.2 the terminator of amplification USP45 gene is a template with plasmid pVE5247 (contain USP45 signal peptide and terminator, given by French scientist INRA doctor J.-C.Piard), the terminator (Tusp45) of amplification USP45 gene is as the terminator of expression system pNBC1000; Design following primer: forward primer T1 adds BamH I site 5 ' GAGGATCCAAAAAAGTCTTAATAAAT 3 ' (black matrix is BamH I site), and downstream primer T2 adds Xba I and Sac I site: 5 ' TGGAGCTCTCTAGATAAAAAATGATTTGACAG 3 ', and (black matrix is Sac I site; Leukorrhagia line sequence is Xba I site) (detailed method is seen Yang Xiaoqiang; Peng Chunxiu, Jiang Bo, Xing Rui; Zhang Shaorong; Chen Xueqing. the structure of newborn chain bacterium expression system and evaluation [J] thereof. No.1 Military Medical Univ.'s journal, 2005,25 (10): 1232～1235.).
3.1.3 the assembling secreting, expressing pNBC1000 of system with Eco0109I and BamH I enzyme action 3h, gets pBluescript II SK (+) plasmid that 7 μ L (about 50ng) and 1 μ L (about 15ng) carry out enzyme action and gel electrophoresis recovery with same enzyme with being connected 5h under the T4DNA ligase room temperature with gene splicing product P U after agarose gel electrophoresis reclaims.Connect product Transformed E .coli TOP10 competent cell, be tiled in and scribble 40mmol/L IPTG, on the LB agar plate that contains 75 μ g/mL ampicillin of 20%X-gal, 37 ℃ of overnight incubation.Through blue white macula screening recombiant plasmid, behind the LB fluid medium cultivation 12h that contains 100 μ g/mL ampicillin, extract plasmid with conventional plasmid extraction kit; Go out to contain the pulsating recombiant plasmid of purpose through Xba I enzyme action evaluation and screening; Called after pBS-PU is connected to pBS-PU with TUSP45, is built into pNBC1000; Adopt the terminal cessation method of the two deoxidations of Sanger ' s by Shanghai Bo Ya Bioisystech Co., Ltd, recombiant plasmid is carried out determining nucleic acid sequence with M13 forward universal primer.
3.1.4M6 albuminous coat anchor series (CWAM6) amplification is a template with the emm6 gene among the plasmid pVE5207 (being given by French scientist INRA doctor J.-C.Piard); Design and synthesize the PCR primer; In forward primer design BamH I site; Downstream primer 5 ' adds Sal I site: forward primer (EM5): 5'TCGGATCCGAAAGCTTTAGAAGAAGCA 3' downstream primer (EM3): 5'CCGTCGACTTAGTTTTCTTCTTTGCG 3'; Be mixed with 20 μ mol/L concentration with the sterilization distilled water, through pcr amplification CWAM6.(detailed method is seen Yang Xiaoqiang, Peng Chunxiu, Jiang Bo, Xing Rui, Zhang Shaorong, Chen Xueqing. the structure of newborn chain bacterium expression system and evaluation [J] thereof. and No.1 Military Medical Univ.'s journal, 2005,25 (10): 1232～1235.).
3.1.5 recombiant plasmid pNBC2000 makes up
With CWAM6 with BamH I and Sal I enzyme action 3h; Get 7 μ L (about 50ng) and 1 μ L (about 15ng) after the recovery and carry out pET-22b (+) plasmid that enzyme action and gel electrophoresis reclaim with being connected 5h under the T4DNA ligase room temperature, with elimination Sal I and Xho I site with BamH I, Xho I.Connect product Transformed E .coli TOP10 competent cell, be tiled on the LB agar plate that contains 75 μ g/mL ampicillin, cultivate 12h for 37 ℃.The picking recombiant plasmid behind LB fluid medium cultivation 12h, extracts plasmid with conventional plasmid extraction kit; Go out to contain the pulsating recombiant plasmid of purpose through BamH I and Bpu11021 enzyme action evaluation and screening, called after pET-M6 is a template with pET-M6; As forward primer, TGGAGCTCTCTAGACAAAAAACCCCTCAAGA (black matrix is Sac I site, and what leukorrhagia was rule is Xba I site) is downstream primer M6down with former forward primer EM5; In the reaction system other composition and reaction condition with before identical; Amplification has the CWAM6 gene of histidine-tagged and T7 terminator thereafter, behind BamH I and Sac I double digestion, is connected to the plasmid pBS-PU through identical enzyme action, is built into pNBC2000; After Xba I enzyme action is identified, adopt the terminal cessation method order-checking of the two deoxidations of Sanger ' s by Shanghai Bo Ya Bioisystech Co., Ltd.
3.2 the checking of newborn chain bacterium expression system in escherichia coli
3.2.1EGFP the amplification of gene
With pEGFP-N1 is template; Design 1 pair of primer amplification EGFP gene; Forward primer design EcoRI site, downstream primer 5 ' adds BamH I site, forward primer (EGFP1): 5 ' GGGAATTCTCGCCACCATGGTGAGCAA3 '; Downstream primer (EGFP2): 5 ' GGGGATCCGTCTTGTACAGCTCGTCCA3 ' strengthens green fluorescent protein (EGFP) gene with amplification.
3.2.2EGFP the structure of expression vector and the evaluation in escherichia coli
With EcoR I and Bam HI enzyme action 3 hours, be connected into plasmid pNBC2000 and pBluescript II SK (+), and be converted into E.coli Top10 behind EGFP gene amplification and the purification with identical enzyme action; Recombiant plasmid is difference called after pNBC2000-EGFP after the enzyme action checking, pBS-EGFP, and the E.coli Top10 that will contain pNBC2000-EGFP plasmid, pNBC2000 plasmid respectively adds and contains in the LB culture medium of ampicillin 100 μ g/mL; 37 ℃ of overnight incubation; Respectively get 10 μ L bacterium liquid next day and evenly coat on the microscope slide, covered is with the resinene mounting; The tinfoil parcel carries out laser focusing microscopic examination (result sees Fig. 4).
3.3 the checking of newborn chain bacterium expression system in newborn chain bacterium
Respectively the P59 promoter among the P59 promoter among the pNBC2000, USP45 signal peptide gene, MCS, M6 GFP and T7 terminator and the pNBC2000-EGFP, USP45 signal peptide gene, EGFP gene, M6 GFP and T7 terminator are downcut with Xba I; And through these fragments of rear electrophoresis recovery; Be connected to E.coli and newborn chain bacterium shuttle plasmid pTRKH2 respectively through Xba I single endonuclease digestion and the processing of CIAP dephosphorylation; Be converted into E.coli TOP10; Extract plasmid and identify that with Xba I single endonuclease digestion positive plasmid is called after pNBCL2000 respectively, pNBCL2000-EGFP.Get 2 μ LpNBCL2000, the pNBCL2000-EGFP plasmid adds respectively in the 40 μ L breast chain bacterium competence cell, is converted into newborn chain bacterium through electroporation.Evenly be tiled on the SR solid medium that contains 1 μ g/mL erythromycin 30 ℃ of continuous culture subsequently 3 days.Extract the DNA of newborn chain bacterium.With Xba I the plasmid that is extracted being carried out single endonuclease digestion identifies.Adopt laser confocal microscope to observe EGFP localization and expression situation; The newborn chain bacterium that will contain pNBCL2000-EGFP plasmid, pNBCL2000 plasmid adds and contains in the GM17 fluid medium of erythromycin 5 μ g/mL, cultivates 16h, respectively gets 10 μ L bacterium liquid next day and evenly coat on the microscope slide for 30 ℃; Covered; With the resinene mounting, the tinfoil parcel carries out laser focusing microscopic examination (result sees Fig. 5).
3.4 the expression of clostridium difficile A toxin carboxyl terminal gene redundancy sequence (14CDTA) in newborn chain bacterium
3.4.1 the amplification of clostridium difficile A toxin carboxyl terminal gene redundancy sequence (14CDTA) and TA clone, order-checking
Extract the clostridium difficile genomic DNA; With reference to Genbank sequence selection design primer, forward primer TXA1:5 ' CCCTCGAGGCCTCAACTGGTTATACAAGTATTAA 3 ' (underscore shows Xho I restriction enzyme site) downstream primer TXA2:5 ' TCAAGCTTTAGGGGCTTTTACTCCATCAACAC 3 ' (underscore shows Hind III restriction enzyme site).Amplification 14CDTA; Use TA clone test kit to carry out the TA clone; The positive colony called after pTA-Toxin_A that obtains adopts the terminal cessation method of the two deoxidations of Sanger ' s by Shanghai Bo Ya Bioisystech Co., Ltd, with T7 forward and SP6 universal primer recombiant plasmid is carried out determining nucleic acid sequence.Row Blast analyzed when the NCBI network was passed through in order-checking.
3.4.2 the structure of 14CDTA breast chain bacterium expression vector
With Xho I, Hind III the 14CDTA gene is downcut from the pTA-Toxin_A plasmid that checks order correct; Directed cloning is to carrier pNBC1000 and pNBC2000 through identical enzyme action; Be tiled on the LB agar plate that contains 75 μ g/ml ampicillin, cultivate 12h for 37 ℃.The picking recombiant plasmid behind LB fluid medium cultivation 12h, extracts plasmid with conventional plasmid extraction kit; Identify recombiant plasmid with Xho I, Hind III enzyme action, difference called after pNBC1001, pNBC2001; With Xba I p59 promoter, the proteic signal peptide gene of USP45,14CDTA gene, the proteic terminator of USP45 are downcut from plasmid pNBC1001, p59 promoter, the proteic signal peptide gene of USP45,14CDTA gene, M6 film anchorin gene, T7 terminator are downcut from plasmid pNBC2001, be connected respectively with through Xba I single endonuclease digestion and through the plasmid pTRKH2 of CIAP dephosphorylation processing; Be converted into E.coli Top10, be laid on the LB agar culture medium that contains 125 μ g/ml erythromycin, cultivate 12-16h for 37 ℃; Picking colony; Behind the LB fluid medium cultivation 12h that contains erythromycin 150 μ g/ml, extract plasmid with conventional plasmid extraction kit, identify recombiant plasmid with Xba I enzyme action; Positive colony is called after pNBCL1001 respectively, pNBCL2001.Respectively get 2 μ L pNBCL1001, pNBCL2001, pTRKH2 (about 1 μ g) plasmid and add respectively in the 40 μ L breast chain bacterium competence cell, electroporation is converted in the newborn chain bacterium, extracts plasmid in the newborn chain bacterium and carries out enzyme action and identify.
3.4.2 the localization and expression of 14CDTA in newborn chain bacterium
Extract last albumin and the memebrane protein of the newborn chain bacterium that contains plasmid pNBCL1001, pNBCL2001, pTRKH2 respectively, carry out PAGE and Western-blot experiment, concrete grammar is seen document (Yang Xiaoqiang; Zhao Yagang; Sun Dayong, Jiang Bo, Chen Xueqing. the expression of clostridium difficile A toxoreceptor land gene in newborn chain bacterium. The Fourth Military Medical University's journal; 2009,30 (18): 1676～1680.)
3.5 the expression of tetanus toxin C fragment (TETC) in newborn chain bacterium
3.5.1TETC the design of gene order and acquisition
Sequence (GeneBank accession no.M12739 according to TETC; 367-1719), in conjunction with the hobby of newborn chain bacterium to some codons, designing institute is with the TETC gene order of splicing; 5 ' end at TETC adds Sal I restriction enzyme site, and 3 ' end adds Xho I and Hind III restriction enzyme site.(nucleotide sequence is shown in SEQ ID NO.5, and aminoacid sequence is shown in SEQ ID NO.6.); Use software DNASTAR 5.0,1 oligonucleotide of the Design of length of the oligonucleotide of every 40bp makes two adjacent oligonucleotide have 20bp complementary each other; (detailed method is seen Yang Xiaoqiang to the sequence of the method acquisition total length 1383bp of employing gene splicing, military treasure, Jiang Bo; Zhao Yagang, Chen Xueqing. external splicing tetanus toxin C fragment gene [J]. Nanfang Medical Univ's journal, 2008; 28 (3): 363～365,369～369.).
3.5.2TETC the structure of newborn chain bacterium expression vector
The TETC gene is connected to the plasmid pBluescript II SK (+) through identical enzyme action with behind Sal I and the Hind III double digestion; Connect product Transformed E .coli TOP10 competent cell; Extract the plasmid of positive colony; Go out to contain the pulsating recombiant plasmid of purpose through Sal I and Hind III double digestion evaluation and screening; Called after pBS-TETC adopts the terminal cessation method of the two deoxidations of Sanger ' s by Shanghai Bo Ya Bioisystech Co., Ltd, with M13 forward and the reverse universal primer of M13 recombiant plasmid is carried out determining nucleic acid sequence.
With Sal I, Hind III the TETC gene is downcut from the pBS-TETC plasmid that checks order correct; Directed cloning is converted into E.coli Top10 to carrier pNBC1000 and pNBC2000 (to eliminate Xho I and Sal I restriction enzyme site) through Xho I and Hind III enzyme action, and positive colony extracts plasmid; Identify recombiant plasmid with Xba I single endonuclease digestion; Difference called after pNBC1002, pNBC2002 downcuts p59 promoter, the proteic signal peptide gene of USP45, TETC gene, the proteic terminator of USP45 with Xba I from plasmid pNBC1002; P59 promoter, the proteic signal peptide gene of USP45, TETC gene, M6 film anchorin gene, T7 terminator are downcut from plasmid pNBC2002; Be connected respectively with through Xba I single endonuclease digestion and through the plasmid pTRKH2 of CIAP dephosphorylation processing, Transformed E .coli Top10 identifies recombiant plasmid with Xba I enzyme action; Positive colony is called after pNBCL1002 respectively, pNBCL2002.With pNBCL1002; The pNBCL2002 electroporation transforms newborn chain bacterium; The reorganization breast chain bacterium that obtains is called LL-pNBCL1002 and LL-pNBCL2002 respectively; Extract secretory protein and film anchorin that the newborn chain bacteria plasmid of reorganization carries out extracting respectively after enzyme action is identified the newborn chain bacterium of reorganization, carry out proteic PAGE and Western-blot experiment.(result sees Fig. 6, and Fig. 7 sees Yang Xiaoqiang for details, Zhao Yagang, and Sun Dayong, etc. the expression of tetanus toxin C fragment in newborn chain bacterium. Guangdong medical science, 2011,32 (7): 1644～1647.)
3.6TETC-14CDTA the structure of fusion rotein breast chain bacterium expression vector
With Xho I, Hind III the 14CDTA gene is downcut from the pTA-Toxin_A plasmid that checks order correct; Directed cloning is to carrier pNBC1002 and pNBC2002 through identical enzyme action; Be converted into E.coli Top10; Extract the positive colony plasmid and identify recombiant plasmid with Xho I, Hind III enzyme action; Difference called after pNBC1003, pNBC2003; With XbaI, ApaLI pNBC1003 and pNBC2003 being carried out double digestion (because of pNBC1003, pNBC2003 are big or small close with pBluescript II SK (+) with the fragment that Xba I downcuts, can not separate when agarose gel electrophoresis, thereby with ApaLI pBluescript II SK (+) is cut into less fragment; Big fragment is the purpose fragment for reclaiming then); Reclaim the fragment that has the fragment of p59 promoter, the proteic signal peptide gene of USP45, TETC gene, 14CDTA gene, the proteic terminator of USP45 and have p59 promoter, the proteic signal peptide gene of USP45, TETC gene, 14CDTA gene, M6 film anchorin gene, T7 terminator respectively, be connected Transformed E .coli Top10 respectively with through Xba I single endonuclease digestion and through the plasmid pTRKH2 of CIAP dephosphorylation processing.Identify recombiant plasmid with Xba I enzyme action, positive colony is called after pNBCL1003 respectively, pNBCL2003.With pNBCL1003, pNBCL2003 is transformed into newborn chain bacterium through electroporation, extracts newborn chain bacteria plasmid and identifies the plasmid that extracts with Xba I enzyme action.The newborn chain bacterium (LL-pNBCL2003) that obtains having the newborn chain bacterium (LL-pNBCL1003) of plasmid pNBCL1003 and have plasmid pNBCL2003.The culture supernatant albumen and the film anchorin that extract newborn chain bacterium LL-pNBCL1003 of reorganization and LL-pNBCL2003 carry out PAGE and Western-blot detection expression of recombinant proteins.(result sees Fig. 8, Fig. 9.)
3.7thyA the acquisition of the reorganization of genetic flaw breast chain bacterium
The expression-secretion type 14CDTA that makes up is a kind of gene recombinant protein; It has comprised the signal peptide part of streptococcus acidi lactici USP45 gene; Coding proteic film anchor series of M6 and avirulence tetanus toxin C fragment in the emm6 gene of streptococcus pyogenes have also been comprised; Common primordial is because of ceneme (to call 14CDTA gene expression unit in the following text), and its structural representation is seen A among Fig. 1.
Often adopt the method for plasmid conversion with bacterial expression albumen.That is to say genes of interest is inserted in the expression plasmid carrier of antibacterial,, screen with the positive bacteria that has plasmid according to the labellings such as Drug resistance of plasmid further with the plasmid transform bacteria.Carry out the translation and the expression of genes of interest by the positive bacteria that has plasmid.But this antibacterial that has plasmid is unsafe as vaccine, also possibly cause biological pollution to environment.Therefore, need structure not have plasmid and streptococcus acidi lactici that can express 14CDTA gene expression unit, this streptococcus acidi lactici is inviable in external natural environment simultaneously.In order to reach this purpose, this vaccine adopts 14CDTA gene expression unit is substituted the thyA gene in the streptococcus acidi lactici genome fully.Owing to lack thymidine in the natural environment, and certain density thymidine is arranged in the intestinal, so thyA gene defection type streptococcus acidi lactici can not survive in natural environment, can not cause biological pollution.The technical step of the thyA gene defection type streptococcus acidi lactici of expression 14CDTA gene expression unit is following:
3.7.1thyA the structure of genetic flaw plasmid
With the upper reaches (being called for short thyA-up) of polymerase chain reaction (PCR) technology clone streptococcus acidi lactici thyA gene and the genetic fragment of each 1000-1500bp of downstream (being called for short thyA-down); The expression 14CDTA gene expression unit bodies that will build with gene clone technology is inserted into outward between thyA-up and the thyA-down, is built into thyA gene knockout unit (shown in B among Fig. 1); Concrete grammar is following:
Extract newborn chain bacterium
Figure BDA00001761171400141
gene DNA, design Up forward primer Up1 5 ' GGAAGCTTCATTCTCCCAAGATTTCTCCTGTAAAA 3 ' (runic shows Hind III restriction enzyme site) and downstream
(2) dilution of above-mentioned culture is inoculated in does not solidly contain any resistance but contain in the fixedly M17 culturing gene of thymidine, pick out single streptococcus acidi lactici clone.With plasmid extract, the erythromycin resistance is cultivated and do not contain method such as thymidine cultivation identifies that the single streptococcus acidi lactici clone who is selected does not have any plasmid and resistance, and streptococcus acidi lactici can not synthesize thymidine.This through gene knochout technique, has been substituted the thyA gene in the recombination lactic acid streptococcus that the surface obtained by 14CDTA gene expression unit;
(3) further the above-mentioned recombination lactic acid streptococcus that filters out is identified that with PCR and outer-gene sequence measurement 14CDTA gene expression unit substitutes the rejecting result's of thyA gene generation reliability;
(4) will filter out a plurality of and through identifying that containing genes of interest (14CDTA) recombination lactic acid streptococcus is not containing any antibiosis and containing in the culture fluid of thymidine and cultivate; Expression with 14CDTA in Western blot electrophoresis and ELISA detection streptococcus acidi lactici and the culture filters out high expressed recombination lactic acid strains of streptococcus;
(5) the 14CDTA albumen composition purification that can further the recombination lactic acid streptococcus be expressed, and the correctness of mass spectral method validation protein expression.
3. route of administration and implementation method
The route of administration of this vaccine is oral, and the recombination lactic acid streptococcus of expressing 14CDTA can form with lyophilizing and preserve, and oral back stimulates intestinal to produce antibody in intestinal breeding a period of time with the viable bacteria form.
The purposes of the live bacterial vaccines of intestinal infection due to the male clostridium difficile of second portion control Toxin A Toxin A (Clostridium difficile clone seq5)
Embodiment 2
The newborn chain bacterium live bacterial vaccines field planting in the Golden Hamster intestinal of recombinating
Promptly adopt method builds among the embodiment 1 secreting, expressing to have TETC to express as the 14CDTA of biological adjuvant and film grappling and have the two kind reorganization newborn chain bacterium of TETC in order to observe the reorganization breast chain fungus oral vaccine of expressing 14CDTA as the 14CDTA of biological adjuvant;) to preventing and treating the preventive and therapeutic effect of C. difficile infection; Adopt shuttle plasmid pTRKH2 as carrier; In newborn chain bacterium, express the 14CDTA fusion rotein; (promoter 59 in experiment, to adopt the promoter 59 of Streptococcus cremoris (Lactococcus lactis subsp.cremoris); P59) (GeneBank accession No.M24806;) as promoter, RBS and signal peptide (75-181, the GeneBank accessionNo.M60178) sequence of selecting newborn chain bacterium secreted protein 45 (L.lactis secreted protein (Usp45) gene) for use are as RBS and signal peptide; The terminator of selecting the Usp45 gene for use is as terminator (1514-1553, GeneBank accession No.M60178); Behind signal peptide, insert the 14CDTA ceneme, sketch map such as Fig. 2 that expression plasmid makes up, wherein A is for only containing the newborn chain bacterium of the blank plasmid of pTRKH2; B is in the plasmid of newborn chain bacterium, includes the element of expressing the 14CDTA secretory protein, comprises TETC and 14CDTA, but does not express memebrane protein CWAM6; C is in the plasmid of newborn chain bacterium, expresses the 14CDTA fusion rotein that has memebrane protein CWAM6, P: be promoter; RBS: ribosome binding site (ribosomal binding site); The proteic signal peptide of SPUsp45:USP45 (Signal peptide ofUsp45); 14CDTA: the avirulence antigen sequence of Toxin A Toxin A (Clostridium difficile clone seq5); CWAM6: Codocyte film M6 protein sequence (sequence encoding the cell wall M6protein); TETC: the avirulent C fragment of tetanus; TUSP45 is the termination codon of chain acid streptococci USP45 gene.
(1). Golden Hamster feces breast chain bacterium separation and Culture before the inoculation; Rat feces is weighed and with the resuspended back of aseptic PBS doubling dilution in a small amount, is inoculated in the screening LC plate, after evaluation, carry out bacterium colony counting (Xiong Dexin, etc.The inspection manual of Clinical Anaerobic Bacteria.China Science Tech Publishing House.Beijing.1994 the 1st edition).Whether this step has the field planting of newborn chain bacterium for confirming in the preceding Golden Hamster intestinal of inoculation.
(2). adopt the method for irritating stomach with 5 * 10 9The CFU newborn chain bacterium of recombinating (is respectively secreting, expressing and has TETC as among newborn bacterium LL-PNBCL1003 Fig. 2 of the 14CDTA of biological adjuvant shown in the B; Have the group breast chain bacterium LL-PNBCL2003 of TETC with film grappling expression as the 14CDTA of biological adjuvant; Among Fig. 2 shown in the C) and the newborn chain bacterium of non-reorganization (the newborn chain bacterium LL-pTRKH2 that contains non-recombiant plasmid pTRKH2, among Fig. 2 shown in the A) inoculation Golden Hamster;
(3). 1 week of inoculation back separation and Culture breast chain bacterium from feces; Rat feces is weighed and with the resuspended back of aseptic PBS doubling dilution in a small amount, is inoculated in the screening LC plate, after evaluation, carry out bacterium colony counting (Xiong Dexin, etc.The inspection manual of Clinical Anaerobic Bacteria.China Science Tech Publishing House.Beijing.1994 the 1st edition).
(4). the clostridium difficile A toxin antibody of producing with German Biocam company detects reorganization 14CDTA expression in the inoculation Golden Hamster intestinal juice, adopts the ELISA method.
The result is following:
(5) all Golden Hamster all fail to turn out newborn chain bacterium before the inoculation, and inoculation newborn chain bacterium group of 1 all backs reorganization and the newborn chain bacterium group of non-reorganization all separation are turned out newborn chain bacterium, and the newborn chain bacterium of secreting, expressing 14CDTA is 6.2 * 10 7The newborn chain bacterium that 14CDTA is expressed in CFU, film grappling is 6.5 * 10 7CFU, non-recombiant plasmid breast chain bacterium are 5.9 * 10 7CFU compares not statistically significant between each group;
(6) detection of ELISA method shows that the titre of secreting, expressing 14CDTA is 3.2 ± 0.8 * 10 2, the titre that 14CDTA is expressed in the film grappling is 6.3 ± 1.1 * 10 2, but not the newborn chain bacterium group titre of recombinating is 0.
Embodiment 3
Recombinate newborn chain bacterium live bacterial vaccines to preventing and treating the effect of clostridium difficile enteritis
Secreting, expressing has TETC expresses as the newborn bacterium LL-PNBCL1003 of the 14CDTA of biological adjuvant, film grappling and has TETC (building process of newborn chain bacterium LL-pTRKH2 that contains non-recombiant plasmid pTRKH2 is with embodiment 2 as the group breast chain bacterium LL-PNBCL2003 of the 14CDTA of biological adjuvant and non-reorganization breast chain bacterium.
1. the male Syria Golden Hamster (hereinafter to be referred as Golden Hamster) that experiment is divided into groups and immunization method is got 32 body weight 100-130 grams; Be divided into 4 experimental grouies at random; Every group 8, the 1st group (8) give normal saline and irritate stomach as the blank group, and the 2nd group (8) give non-recombiant plasmid breast chain bacterium (LL-pTRKH2) as positive control (Fig. 2 A); The 3rd group (8) give the newborn chain bacterium (LL-pNBCL1003) (Fig. 2 B) of secreting, expressing 14CDTA; The 4th group (8) give the newborn chain bacterium (LL-pNBCL2003) (Fig. 2 C) that 14CDTA is expressed in the film grappling, adopt the mode of irritating stomach to carry out immunity, and each newborn chain bacterium group all gives 5 * 10 9CFU breast chain bacterium is irritated stomach (OD600 is about 1.0), and the newborn chain bacterium that will have different plasmids with the 0.2M sodium bicarbonate that contains 5% casein hydrolysate, 0.5% glucose processes 5 * 10 9The bacterial suspension of CFU/mL is irritated stomach respectively at the Golden Hamster of giving different groups on the the 0th, 1,2,7,14,23 day, carries out intestinal microbial population analysis once (as shown in Figure 3) in the 7th, 14 day respectively before the filling stomach.
2. the 15th day clostridium difficile attacked the experiment inoculation and risen in back 15 days and respectively organize Golden Hamster and give Clindamycin Hydrochloride 10mg and irritate stomach; 1 week of successive administration; Carry out intestinal microbial population analysis and clostridium difficile separation and Culture during this time; To define no flora imbalance and C. difficile infection, gave 4 * 10 in 4 hours after last 1 administration 5The clostridium difficile of CFU is attacked approximately, and the body weight of weighing Golden Hamster before attacking is attacked in back 72 hours per 4 h observation 1 time; And feces carried out clostridium difficile separation and Culture and newborn chain bacterium separation and Culture, after this observe the feces of observed in detail laboratory animal every day 4 times; Crissum; Activity, fur form, gloss, mental status, and mark.
3. evaluation index
3.1 with body weight change before and after each group mortality rate, diarrhoea incidence rate, the attack, life span is estimated the protective effect of the newborn chain bacterium of reorganization to infected animal model;
Respectively organize laboratory animal 3.2 dissect; Perusal abdominal cavity and intestinal tube pathological changes situation; Get each part of caecum and colon; Cut off along the longitudinal axis, after with 4 ℃ of normal saline the enteric cavity content being rinsed well, get the homogenate immediately of 100mg intestinal submucosa tissue and carry out clostridium difficile separation and Culture and newborn chain bacterium separation and Culture; The 200mg intestinal submucosa tissue frozen immediately in-70 ℃ of refrigerators so that extract the total RNA of intestinal tissue and enterocyte total protein, plasmosin and nucleoprotein;
Change 3.3 observe each intestinal segment general pathology, with being placed on 10% neutral formalin internal fixation, embedding, section, HE dyeing, the general pathological study of row with stereoscope and anatomic microscope;
3.4 the titre of the anti-clostridium difficile A toxin carboxyl terminal repeated fragment 14CDTA antibody that produces in the serum that employing ELISA detects and intestinal tissue and the intestinal juice is carried out immunological evaluation;
3.5 through observe serum to clostridium difficile A toxin to the Cytotoxic neutralization of CHO-K1, estimate the anti-14CDTA antibody that produces in the serum behind the Golden Hamster oral vaccine Cytotoxic antagonism to clostridium difficile A toxin;
3.6 flow cytometer detects serum and clostridium difficile A toxin-induced enterocyte is transferred the inhibitory action of dying.
4. result
4.1 each group of diarrhoea incidence rate diarrhoea incidence rate is compared all has statistical significance (P=0.000, Fig. 4) wherein blank group and LL-pTRKH2 group is the highest, and the LL-pNBCL2003 group is minimum;
4.2 mortality rate and life span are compared with the blank group; The mortality rate of other group all is starkly lower than blank group survival rate and life span all is higher than blank group (P＜0.001, Fig. 5 and Fig. 6), and the newborn chain bacterium group mortality rate of recombinating all is lower than LL-pTRKH2 group (P=0.000; Fig. 7); Life span and attack back life span all are higher than the LL-pTRKH2 group, but not statistically significant (P=0.881, Fig. 8);
4.3 before and after attacking each newborn chain bacterium group of body weight change all be higher than the blank group (P＜0.001, Fig. 8), and the newborn chain bacterium group of recombinating all be higher than the LL-pTRKH2 group (P=0.000, Fig. 8), not statistically significant between two kinds of newborn chain bacterium of reorganization (P=0.365, Fig. 8).Wherein a compares p=0.001 with the blank group; B compares p=0.000 with the LL-pTRKH2 group; C compares p=0.365 with the LL-pNBCL1003 group; D compares p=0.843 between each group each other.
4.4 general pathology is observed
Blank group Golden Hamster presented crissum, claw, hypogastric region humidity on the 2nd day in attacking the back, rolls up, and inertia, equilibrium sense disappears; Fur is shrugged one's shoulders crape disorderly, to dying performances such as IR weaken, puts to death the visible caecum expansion in back; Enteric cavity hemorrhage (Fig. 9) is cut open along the intestinal tube longitudinal axis, extensive [(Figure 10) in the visible enteric cavity; The part focus has mucomembranous defect, and pathological changes is the heaviest with caecum and colon epimere, and small intestinal is slightly expanded; Slightly increase slightly than colon, rectal lesion is slight, and colonic does not have shaping feces.LL-pTRKH2 organizes in attacking the back had 1 moribund condition to occur on the 2nd day, put to death the visible caecum in back and slightly expanded, and intestinal mucosa congested (Figure 11) is cut enteric cavity open, and a small amount of [is arranged in the intestinal mucosa, and the mucous hyperemia edema is obvious, and naked eyes are visible to be dispersed in erosion (Figure 12).Colonic does not have shaping feces; The LL-pTRKH2 group Golden Hamster caecum of when experiment finishes, putting to death does not have expansion; Intestinal mucosa does not have hyperemia, still has the intestinal mucosa Mild edema of diarrheal Golden Hamster, and colonic does not have shaping feces; The intestinal mucosa that has stopped the diarrheal Golden Hamster does not have edema, the visible feces that is shaped of colon and internal rectum.The LL-pNBCL1003 group does not have expansion with the Golden Hamster intestinal tube that LL-pNBCL2003 group (Figure 13) is put to death when experiment finishes, intestinal mucosa does not have hyperemia, edema (Figure 14,15), and colon and internal rectum all have shaping feces.
4.5 tissue pathologies change's blank group mucomembranous defect, body of gland destroys, and is extensively hemorrhage, and submucosa showed edema has medium to a large amount of neutrophil infiltration.(seeing Figure 16), LL-pTRKH2 group mucomembranous defect is light than the blank group, and a small amount of hemorrhage and a large amount of neutrophil infiltration are arranged under the mucosa, and abscess forms (seeing figure, 17).
LL-pNBCL1003 group mucous epithelium is slight impaired complete, and tela submucosa has a large amount of neutrophil infiltration, and crypts shoals (seeing Figure 18), and LL-pNBCL2003 group mucomembranous defect is lighter, and a small amount of neutrophil infiltration (seeing Figure 19) is only arranged.
Blank group, LL-pTRKH2 group, LL-pNBCL1003 group and each group of LL-pNBCL2003 group reach histopathology figure scoring substantially and relatively see and wherein compare P＜0.05 with the blank group by Figure 20; Compare with non-recombiant plasmid breast chain bacterium group, P=0.116 is compared in P＜0.000 with LL-pNBCL1003.
4.6 the separation and Culture of clostridium difficile and newborn chain bacterium
Before the attack; Each organizes in the feces of laboratory animal all not, and separation and Culture goes out clostridium difficile; Clostridium difficile is turned out in the diarrhoea feces and the intestinal tissue homogenate of blank group Golden Hamster; The LL-pTRKH2 group has the diarrhoea feces separation and Culture of 3 Golden Hamster to go out clostridium difficile, wherein has the intestinal tissue homogenate of 1 Golden Hamster to turn out clostridium difficile.Separation and Culture goes out clostridium difficile in the feces of 2 Golden Hamster of LL-pNBCL1003 group generation diarrheal, but clostridium difficile is not isolated in intestinal tissue homogenate.Have in the LL-pNBCL2003 group in the feces of 1 Golden Hamster and also isolate clostridium difficile, intestinal tissue homogenate is the separation and Culture clostridium difficile not.Give Clindamycin Hydrochloride 10mg filling stomach 1 week each treated animal of back continuously and all do not isolate lactobacillus (comprising newborn chain bacterium, lactobacillus and Lactococcus) and bacillus bifidus; And fungus appearred; Demonstrate the dysbacteriosis of III degree; After the 2nd day (promptly the 23rd day) gives newborn chain bacterium booster immunization once more after attacking; All separate in the feces that Golden Hamster and LL-pNBCL1003 organize, LL-pNBCL2003 organizes Golden Hamster of attack back the 3rd day LL-pTRKH2 group survival and turn out newborn chain bacterium; Reduce but attack the newborn chain bacterium that separated to cultivate than the 7th day in the 14th day in the back, newborn chain bacterium is all turned out in the Golden Hamster of LL-pTRKH2 group survival and LL-pNBCL1003 group, the homogenate of LL-pNBCL2003 group intestinal mucosa, but LL-pTRKH2 group intestinal mucosa still separation and Culture go out clostridium difficile.
4.7 the anti-clostridium difficile A of serum and intestinal juice toxin antibody level
The Cmin that test kit can be detected is decided to be 1 titre, and each sample greatest dilution is the titre of this sample.The result respectively organizes IgG, the IgA antibody that serum and intestinal juice have all produced anti-clostridium difficile A toxin, and LL-pNBCL2003 group serum produces 1.5 * 10 4The anti-clostridium difficile A toxin IgG antibody of titre, 6.7 * 10 2The IgA antibody of titre, intestinal juice produces 1.45 * 10 4The anti-clostridium difficile A toxin IgG antibody of titre, 1 * 10 2The IgA antibody of titre; LL-pNBCL1003 group serum produces 9.5 * 10 3The anti-clostridium difficile A toxin IgG antibody of titre, 5.6 * 10 2The Ig A antibody of titre, intestinal juice produces 9.5 * 10 3The IgG antibody of titre, 7.5 * 10 1The IgA antibody of titre; LL-pTRKH2 group serum produces 2.4 * 10 3The anti-clostridium difficile A toxin IgG antibody of titre, 3.6 * 10 2The IgA antibody of titre, intestinal juice produces 3.5 * 10 3The IgG antibody of titre, 7.5 * 10 1The IgA antibody of titre, blank group Golden Hamster serum produces 6 * 10 2The IgG antibody of titre, 2 * 10 2The IgA antibody of titre, intestinal juice produces 7.3 * 10 2The IgG antibody of titre, 6.3 * 10 1The IgA antibody of titre.Recombinate newborn chain bacterium group serum and intestinal juice IgG titre all apparently higher than blank group and empty plasmid matched group (P＜0.000), and serum IgA is higher than blank group (P＜0.05), though intestinal juice IgA is higher than the blank group, and not statistically significant (seeing Figure 21).
4.7 in the toxin and the experiment
Light microscopic is observed down, and normal control group cell size uniformity is fusiformis, and propagation phase cell is rounded; But nucleus is normal, and after handling through clostridium difficile A toxin, cell becomes circle by fusiformis, differs in size; Karyopycnosis, cracked, dissolving, serum are incubated the group cell in advance and are slightly become circle, but still can find out the fusiformis form; Serum processed group cell part cell rounding, dwindle, karyopycnosis, the part cell still slightly is fusiformis.
4.8 the anti-14CDTA serum of Flow cytometry is transferred the inhibitory action of dying to the enterocyte of clostridium difficile A toxin-induced
The flow cytometry result shows that the mortality of clostridium difficile A toxin processed group cell accounts for 41.59% of TCS; The accent cell of dying accounts for 18.34%, and serum is incubated the group dead cell in advance and accounted for 7.39%, transfers the cell of dying to account for 6.47%; Serum processed group dead cell accounts for 12%; The accent cell of dying accounts for 8.78%, and normal control group dead cell accounts for 3.9%, transfers the cell of dying to account for 3.87% (seeing Figure 22).
4.9RT-PCR detect the expression of proinflammatory cytokine mRNA such as ICAM-1, MCP-1, IL-6, Gro-1
The expression that LL-pNBCL2003 organizes the mRNA of various pro-inflammatory cytokines significantly is lower than other each group relatively (P＜0.05); The expression that LL-pNBCL1003 organizes the mRNA of various pro-inflammatory cytokines is lower than blank group and LL-pTRKH2 group (P＜0.05); The expression of LL-pTRKH2 group ICAM-1, MCP-1 is lower than the blank group, and the expression of LL-pTRKH2 group IL-6, Gro-1 is higher than the blank group, but does not have statistical significance (P＞0.05).
The foregoing description is a preferred implementation of the present invention; But embodiment of the present invention is not restricted to the described embodiments; Other any do not deviate from change, the modification done under spirit of the present invention and the principle, substitutes, combination, simplify; All should be the substitute mode of equivalence, be included in protection scope of the present invention.
Figure IDA00001761172000011
Figure IDA00001761172000021
Figure IDA00001761172000031
Figure IDA00001761172000051
Figure IDA00001761172000061
Figure IDA00001761172000071

Claims (9)

1. live bacterial vaccines of preventing and treating intestinal infection due to the male clostridium difficile of Toxin A Toxin A (Clostridium difficile clone seq5), it is characterized in that: said vaccine contains thymidylate synthetase ThyA gene defection type recombination lactic acid streptococcus.
2. the live bacterial vaccines of intestinal infection due to the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) according to claim 1 is characterized in that: described thymidylate synthetase ThyA gene defection type recombination lactic acid streptococcus obtains through following mode: the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of employing expression-secretion type replaces the thymidylate synthetase ThyA gene order of streptococcus acidi lactici.
3. the live bacterial vaccines of intestinal infection due to the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) according to claim 2; It is characterized in that: the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of described expression-secretion type obtains in the following manner: with signal peptide sequence SPUsp45, clostridium difficile A toxin C terminal repeat 14CDTA and the avirulence tetanus toxin C fragment sequence TETC of streptococcus acidi lactici secreted protein 45 genes, be connected to form the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of expression-secretion type with engineered method by correct reading frame.
4. the live bacterial vaccines of intestinal infection due to the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) according to claim 2; It is characterized in that: the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of described expression-secretion type obtains in the following manner: with signal peptide sequence SPUsp45, clostridium difficile A toxin C terminal repeat 14CDTA, avirulence tetanus toxin C fragment sequence TETC and the proteic film anchor series of the streptococcus pyogenes M6 CWAM6 of streptococcus acidi lactici secreted protein 45 genes, be connected to form the fusion rotein of the anti-Toxin A Toxin A (Clostridium difficile clone seq5) of expression-secretion type with engineered method by correct reading frame.
5. according to the live bacterial vaccines of the intestinal infection due to claim 3 or the male clostridium difficile of 4 described control Toxin A Toxin A (Clostridium difficile clone seq5)s, it is characterized in that: said streptococcus acidi lactici is a food stage industry bacterium.
6. the method for preparing of the live bacterial vaccines of intestinal infection due to the male clostridium difficile of each described control Toxin A Toxin A (Clostridium difficile clone seq5) of claim 1-4; It is characterized in that: after above-mentioned thymidylate synthetase ThyA gene defection type recombination lactic acid streptococcus was cultivated in containing the culture medium of thymidine, acquisition prevented and treated the live bacterial vaccines of the intestinal infection due to the male clostridium difficile of Toxin A Toxin A (Clostridium difficile clone seq5).
7. the method for preparing of the live bacterial vaccines of intestinal infection due to the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) according to claim 6 is characterized in that: the concentration of said thymidine is 10 ~ 30 μ M.
8. the live bacterial vaccines of intestinal infection due to the male clostridium difficile of control Toxin A Toxin A (Clostridium difficile clone seq5) according to claim 6, it is characterized in that: the dosage form of said live bacterial vaccines is an oral agents.
9. the purposes of the live bacterial vaccines of intestinal infection in the medicine of the intestinal infection effect due to preparation has control Toxin A Toxin A (Clostridium difficile clone seq5) male clostridium difficile due to the male clostridium difficile of each described control Toxin A Toxin A (Clostridium difficile clone seq5) of claim 1-4.
CN 201210194915 2012-06-13 2012-06-13 Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof Pending CN102743746A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN 201210194915 CN102743746A (en) 2012-06-13 2012-06-13 Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN 201210194915 CN102743746A (en) 2012-06-13 2012-06-13 Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof

Publications (1)

Publication Number Publication Date
CN102743746A true CN102743746A (en) 2012-10-24

Family

ID=47024471

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 201210194915 Pending CN102743746A (en) 2012-06-13 2012-06-13 Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof

Country Status (1)

Country Link
CN (1) CN102743746A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103690948A (en) * 2013-12-13 2014-04-02 山东国际生物科技园发展有限公司 Oral colon-specific preparation for neutralizing anti-clostridium difficile toxin IgY (Immunoglobulin Y)
CN112442472A (en) * 2020-11-30 2021-03-05 四川大学华西医院 Recombinant lactococcus lactis for resisting clostridium difficile, live vector vaccine and preparation method of vaccine
CN113329766A (en) * 2018-11-16 2021-08-31 马特里瓦克斯公司 Clostridium difficile multicomponent vaccine

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103690948A (en) * 2013-12-13 2014-04-02 山东国际生物科技园发展有限公司 Oral colon-specific preparation for neutralizing anti-clostridium difficile toxin IgY (Immunoglobulin Y)
CN103690948B (en) * 2013-12-13 2016-01-20 山东国际生物科技园发展有限公司 Neutralize the oral colon location preparation of anti-clostridium difficile toxin IgY
CN113329766A (en) * 2018-11-16 2021-08-31 马特里瓦克斯公司 Clostridium difficile multicomponent vaccine
CN112442472A (en) * 2020-11-30 2021-03-05 四川大学华西医院 Recombinant lactococcus lactis for resisting clostridium difficile, live vector vaccine and preparation method of vaccine

Similar Documents

Publication Publication Date Title
CN101974072B (en) Escherichia coli TolC antigen as well as antibody and application thereof
Heidary et al. Colonization and investigation of vibrio cholera recombination protein in e-coli
JP4583607B2 (en) Attenuated microorganisms for the treatment of infectious diseases
CN104560860B (en) The recombinant spore and preparation method of a kind of bacillus subtilis GC5 surface displays GCRV VP7 albumen
CN102281895A (en) A vaccine for porcine post-weaning diarrhea caused by enterotoxigenic escherichia coli
CN110327460A (en) Streptococcus suis-Haemophilus parasuis bigeminy subunit vaccine and preparation method
CN102276730A (en) Preparation method for staphylococcus aureus Iron-regulated surface determinant B immunodominant fragment (IsdBid)-target of RNAIII activating protein (TRAP) fusion protein and application thereof
CN107529534A (en) A kind of protective antigens of secondary poultry bacillus and its expression and application
Mehr et al. A DNA vaccine against Escherichia coli O157: H7
CN102743746A (en) Live bacterial vaccine for controlling intestinal infection caused by clostridium difficile, preparation method thereof and application thereof
CN102181457B (en) Clostridium difficile exotoxin B amino-terminal gene sequence with optimized codon and nucleic vaccine of clostridium difficile exotoxin B
CN102816246A (en) Human cytomegalo virus immunogen fusion protein as well as preparation method and usage thereof
CN105861402A (en) Novel vaccine form for submitting heterologous protein to surface of escherichia coli outer membrane vesicles
CN101693900A (en) Application of utilizing bacillus subtilis spore coat protein CotX as molecular carrier adopting spore surface to display exogenous proteins
Geriletu et al. Immunogenicity of orally administrated recombinant Lactobacillus casei Zhang expressing Cryptosporidium parvum surface adhesion protein P23 in mice
Li et al. Oral vaccination with recombinant Lactobacillus casei with surface displayed OmpK fused to CTB as an adjuvant against Vibrio mimicus infection in Carassius auratus
CN104894045A (en) Recombinant lactobacillus for coexpression of foot and mouth disease virus VP1 gene and immunoadjuvant cattle IL-6 gene, and preparation method and application of recombinant lactobacillus
CN115850404B (en) Recombinant erysipelothrix rhusiopathiae surface protection antigen A with tandem dominant epitope and application thereof
CN103194471B (en) Transmissible gastroenteritis of swine S/N protein fusion gene and Recombinant Lactococcus lactis and application
CN106047783A (en) Pseudomonas plecoglossicida ExoU gene knockout mutant strain and application thereof
CN103468626A (en) Engineering strains for preparing specific salmonella H: 6 diagnosis serum and construction method thereof
CN102741414B (en) By recombination yeast oral/method of mucosal vaccination vaccine
CN102153632A (en) Antibody of escherichia coli resistant TolC tricosanoic peptide and application
CN102676570B (en) Recombinant bacillus subtilis immunoglobulin binding protein functional-domain expression vector and application thereof
CN101386831A (en) Recombinant bacterium of brucella abortus with immunity labeling and use thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C12 Rejection of a patent application after its publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20121024