CN112391397B

CN112391397B - Tobacco flavone monooxygenase gene NtCYP75B2 and application thereof

Info

Publication number: CN112391397B
Application number: CN202011345538.8A
Authority: CN
Inventors: 李正风
Original assignee: China Tobacco Yunnan Industrial Co Ltd
Current assignee: China Tobacco Yunnan Industrial Co Ltd
Priority date: 2020-11-25
Filing date: 2020-11-25
Publication date: 2023-01-31
Anticipated expiration: 2040-11-25
Also published as: CN112391397A

Abstract

The invention discloses a tobacco flavone monooxygenase gene NtCYP75B2 and application thereof. A tobacco flavone monooxygenase gene NtCYP75B2 has a base sequence shown as SEQ ID No.1, wherein a specific nucleic acid fragment is 2 to 432 bases. According to the invention, through preliminary research on specific tobacco flavone monooxygenase CYP75B2, the tobacco flavone monooxygenase is found to be highly related to the content of chlorogenic acid in tobacco, and the content of the chlorogenic acid in the tobacco is obviously reduced after the gene is silenced. Based on the characteristic, a certain application basis and reference can be provided for the cultivation of new tobacco varieties with low phenol content.

Description

Tobacco flavone monooxygenase gene NtCYP75B2 and application thereof

Technical Field

The invention relates to the technical field of tobacco gene engineering, in particular to a tobacco flavone monooxygenase gene NtCYP75B2 and application thereof.

Background

Phenol is one of 7 representative harmful components which are mainly controlled by the national tobacco agency, and after being inhaled along with smoke, phenol can be rapidly distributed in all tissues, has obvious mucosal permeability, and causes tissue necrosis and corrosion and shedding. Prolonged inhalation of phenol-containing gases can lead to wheezing of the upper respiratory tract, respiratory distress and even failure, and in addition, to headaches, dizziness, kidney damage and diseases of the heart system, and cancer [1-7]. Phenol also has toxic effects such as mutagenicity and genotoxicity, and is listed in the EPA list of harmful components (us.epa, 2002). At present, the source and the precursor of the phenol in the flue gas are already clear, so that the application of biotechnology to interfere the content of the related precursor is a strategy for effectively reducing the content of the phenol in the flue gas. Tobacco leaf proteins (mainly Tyr), free Tyr and chlorogenic acid (CGA) are the main precursors of smoke phenol.

CGA is synthesized by a phenylalanine metabolic pathway, and a plurality of enzymes of the metabolic pathway are all involved in the synthesis of CGA. Phenylalanine Ammonia Lyase (PAL) catalyzes the production of cinnamic acid from phenylalanine, and then CGA is finally formed via cinnamic acid and coumarin. The biosynthetic route of CGA in plants is not completely understood, and the phenylpropanoid pathway controls the synthesis of lignin, chlorogenic acid of flowers, signal molecules, and a number of compounds involved in the defense of plants against pathogens and ultraviolet light. Over 15P 450-dependent reactions have been found in this pathway, with different P450s catalyzing different reactions. CYP75 plays an important role in the regulation of the entire pathway.

The influence of the genes on the CGA accumulation rule is researched by searching CGA regulation key genes, the genes which have obvious influence on the metabolism of the CGA content and have no obvious influence on other physiological processes of the tobacco are selected as CGA regulation potential genes, and the CGA content of the tobacco can be regulated from the source by changing the CGA content. Chinese patent CN201911325441.8 discloses a tobacco chlorogenic acid synthetic gene NtHQT and application thereof, the full length of the gene 4086 bp comprises 1 intron and 2 exons, and the coding region length is 1128 bp. The transferase coded by the tobacco chlorogenic acid synthetic gene NtHQT contains 375 amino acids. Based on the existing tobacco genetic engineering, the inventor clones and obtains a new tobacco HQT gene (NtHQT) related to the content of chlorogenic acid. In the process of further functional verification, the inventor carries out over-expression on the gene, and the result shows that the content of chlorogenic acid in a new transgenic plant is obviously improved after the gene is over-expressed. This further proves that the gene is indeed related to the content of chlorogenic acid in the tobacco leaves. Based on the result, a certain application foundation and reference can be established for quality regulation and new tobacco variety cultivation in the tobacco growth process. In addition, chinese patent CN201911317951.0 discloses a tobacco polyphenol oxidase NtPPO4 gene and application thereof, and the base sequence of the gene is shown in SEQ ID NO. 1. Tobacco polyphenol oxidase ntpp 4 consists of 588 amino acid residues with 3 typical conserved domains. The protein is related to the content of chlorogenic acid in plant leaves, and the content of chlorogenic acid in the leaves is obviously increased after the expression of the gene is reduced. According to the invention, through preliminary research on the tobacco polyphenol oxidase NtPPO4, the high correlation with the content of the chlorogenic acid in the tobacco is found, and the content of the chlorogenic acid in the tobacco leaves is obviously increased after the gene is silenced.

The disclosed patents all research how to obtain a new tobacco variety with high chlorogenic acid content through gene regulation, and no research on obtaining a new tobacco variety with low chlorogenic acid content through gene regulation exists, so that the CGA content of the tobacco can be regulated from the source, the goal of reducing phenol precursors is realized, and reference and basis are provided for the production of the tobacco with low phenol content.

Disclosure of Invention

In order to overcome the defects of the prior art, the invention aims to provide a tobacco flavone monooxygenase gene NtCYP75B2 and application thereof.

In order to solve the problems, the invention adopts the following technical scheme:

the base sequence of the tobacco flavone monooxygenase gene NtCYP75B2 is shown in SEQ ID No.1, wherein a specific nucleic acid fragment is 197 to 1565 base groups.

The invention also provides application of the tobacco flavone monooxygenase gene NtCYP75B2 in regulating and controlling the content of chlorogenic acid in tobacco.

Preferably, the content of chlorogenic acid in the tobacco is regulated and controlled by regulating the expression level of CYP75B2 protein in the tobacco by using a gene silencing technology or a gene overexpression method.

The invention also provides tobacco flavone monooxygenase CYP75B2 coded by the tobacco flavone monooxygenase gene NtCYP75B2, wherein the amino acid sequence of the tobacco flavone monooxygenase CYP 2 is shown in SEQ ID NO.2 and consists of 455 amino acid residues, and the amino acids from the 2 nd to the 432 th are conserved p450 structural domains.

The invention also provides application of the tobacco flavone monooxygenase CYP75B2 in regulating and controlling the content of chlorogenic acid in tobacco.

Preferably, the tobacco flavone monooxygenase CYP75B2 is related to the content of chlorogenic acid in plant leaves, and the content of chlorogenic acid in the tobacco leaves is obviously reduced after the expression of the tobacco flavone monooxygenase CYP75B2 protein is reduced.

The invention also provides a method for cultivating the new variety of tobacco, which comprises the following steps:

(1) Designing a primer sequence, and carrying out PCR amplification on a cDNA template of tobacco by using the primer sequence to obtain a tobacco flavone monooxygenase gene NtCYP75B2;

(2) Constructing a virus-induced silencing vector TRV2-NtCYP75B2 containing tobacco flavone monooxygenase CYP75B2 by using the tobacco flavone monooxygenase gene NtCYP75B2;

(3) The constructed silent vector TRV2-NtCYP75B2 is used for transforming tobacco, and a new tobacco variety with variable chlorogenic acid content is obtained through screening.

Preferably, the primer sequence is:

NtCYP75B2-F：5’-ACCGAATTCGCTCAGACTGGAAGGAAACA- 3’，

NtCYP75B2-R：5’-ACCGGATCCGCTTTAATGTCCTCACCACC- 3’。

compared with the prior art, the invention has the technical effects that:

according to the invention, through preliminary research on specific tobacco flavone monooxygenase CYP75B2, the tobacco flavone monooxygenase is found to be highly related to the content of chlorogenic acid in tobacco, and the content of the chlorogenic acid in the tobacco is obviously reduced after the gene is silenced. Based on the characteristic, a certain application basis and reference can be provided for the cultivation of new tobacco varieties with low phenol content.

Additional advantages, objects, and features of the invention will be set forth in part in the description which follows and in part will become apparent to those having ordinary skill in the art upon examination of the following or may be learned from practice of the invention.

It will be appreciated by those skilled in the art that the objects and advantages that can be achieved with the present invention are not limited to the specific details set forth above, and that these and other objects that can be achieved with the present invention will be more clearly understood from the detailed description that follows.

Drawings

FIG. 1 is a comparison of the phenotypes of the tobacco TRV2-PDS, TRV2-GFP and TRV2-NtCYP75B2 vector-transformed groups according to the present invention;

FIG. 2 shows the relative expression levels of the NtCYP75B2 gene silencing plants compared to control plants in the examples of the present invention;

FIG. 3 is a comparison of the content of major chlorogenic acids in tobacco leaves subjected to virus-induced gene silencing and control tobacco leaves according to an embodiment of the present invention.

Detailed Description

The embodiments of the present invention are described below with reference to specific embodiments, and other advantages and effects of the present invention will be easily understood by those skilled in the art from the disclosure of the present specification. The invention is capable of other and different embodiments and of being practiced or of being carried out in various ways, and its several details are capable of modification in various respects, all without departing from the spirit and scope of the present invention.

It is to be understood that the processing equipment or apparatus not specifically identified in the following examples is conventional in the art.

Furthermore, it is to be understood that one or more method steps mentioned in the present invention does not exclude that other method steps may also be present before or after the combined steps or that other method steps may also be inserted between these explicitly mentioned steps, unless otherwise indicated; moreover, unless otherwise indicated, the numbering of the various method steps is merely a convenient tool for identifying the various method steps, and is not intended to limit the order in which the method steps are arranged or the scope of the invention in which the invention may be practiced, and changes or modifications in the relative relationship may be made without substantially changing the technical content.

Biological material:

tobacco K326, a commonly used tobacco material, was planted in a Zhengzhou tobacco institute planting base in the following examples, seedling was grown in a seedling pot, two weeks after germination were divided, planted in a plastic pot (10 cm. Times.10 cm), and subjected to daily fertilizer and water management under conditions of 22 ℃ and 16 hours of light/8 hours of dark. The related primer synthesis and sequencing work is synthesized and provided by Zhengzhou Optingke Biotechnology Limited.

The VIGS vector used in the following examples is a viral vector (TRV) derived from tobacco rattle virus, and specifically, TRV2, which is stored in the Zheng tobacco institute Gene center, carries Kanna selection marker and 35S promoter, and TRV2 carries multiple cloning sites such as EcoR I and BamH I, and can be used to carry and transform foreign genes.

The experimental reagent:

LB liquid medium, 1L content contains: 10 g bacterial peptone (bacteriological peptone); 10 g sodium chloride (NaCl); 5g yeast extract (yeast extract), autoclaving;

YEB liquid culture medium, 1L content contains: 5g beef extract (beef extract); 5g bacterial peptone (bacterial peptone); 5g sucrose (sucrose); 1 g yeast extract (yeast extract); 2 mL 1M magnesium sulfate (MgSO) ₄ ) Sterilizing at high temperature and high pressure;

1M 2- (N-morpholine) ethanesulfonic acid (MES) stock solution: ddH ₂ Dissolving O, filtering, sterilizing, and storing at-20 ℃ for later use;

200 Stock solution of mM Acetosyringone (Acetosyringone, as): dissolving Dimethyl Sulfoxide (DSMO), and storing at-20 deg.C;

MMA（100 mL）：1 mL（1 M）MgCl ₂ ；1 mL（1 M，pH5.6）MES；75 μL（200 mM）As。

example 1

The construction process of the tobacco NtCYP75B2 gene cloning and silencing vector is briefly described as follows.

(1) Tobacco NtCYP75B2 gene cloning

According to the previous research on the tobacco genome and the related CYP75B2 gene, based on an NCBI database, the existing HQT gene sequence and the related BLAST analysis result, a specific coding sequence is selected as a target segment, and a primer sequence for PCR amplification is designed as follows:

NtCYP75B2-F：5’-AATTACGTGTTCCCACCAGC- 3’，

NtCYP75B2-R：5’-CTTACCCGTCAAAGGCAAGA- 3’；

carrying out PCR amplification by taking cDNA of tobacco K326 leaves as a template to obtain a tobacco flavone monooxygenase gene NtCYP75B2; the cDNA of the tobacco K326 leaf is synthesized by reverse transcription after RNA is extracted by adopting the conventional plant RNA rapid extraction kit.

The PCR amplification procedure was: pre-denaturation at 95 ℃ for 3 min; denaturation at 95 ℃ for 15s, annealing at 55 ℃ for 15s, extension at 72 ℃ for 30s, and complete extension at 72 ℃ for 5min after 34 cycles;

and carrying out agarose gel electrophoresis detection on the PCR amplification product, and recovering the electrophoresis product for later use.

(2) Construction of recombinant TRV2-NtCYP75B2 silencing vector

Carrying out EcoRI and BamHI double enzyme digestion on the PCR amplification product in the step (1), simultaneously carrying out EcoRI and BamHI double enzyme digestion on the empty vector TRV2, respectively recovering enzyme digestion products, and utilizing T4 DNA ligase to carry out ligation;

transforming the ligation product into escherichia coli competent DH5 alpha, coating the transformation product on an LB solid culture medium containing 50mg/L Kan after the transformation operation is finished, and culturing for 24 hours at 37 ℃;

and selecting positive single colonies, amplifying, and then further performing PCR identification, and ensuring that a correctly constructed recombinant silent vector TRV2-NtCYP75B2 is obtained by combining sequencing verification.

The sequencing result shows that the tobacco flavone monooxygenase gene NtCYP75B2 comprises 1840 bases, and the base sequence is shown as SEQ ID NO.1, and specifically comprises the following steps:

ATGGCAATCTTTTCCCTACTTCTCTACACTGTCATTTTCTCTTTCCTTCTACATTCCATTCTCACCTTATTTTTTCGCAAACGTTACCCGTTGCCACTACCACCAGGTCCAAAACCATGGCCAATAATCGGAAACCTAGTCCATATGGGTCCAAAGCCACACCAATCAACTGCAGCCTTAATGCACAAGGGTGGTCGATGGCTCGAACTTACGGTCCACTCATGCACCTTAAGATGGGATTCGTGGACGTGGTGGTTGTGGCGTCTGCATCGGTGGCGGCTCAGTTCTTAAAAACTCATGACGCTAACTTCTCGAGCCGCCCTCCGAACTCGGGTGCGAAACACTTGGCTTACAATTATCAAGATCTTGTTTTTGCACCCTACGGACCAAGGTGGCGTATGCTTAGGAAAATTTGCTCTGTTCATCTTTTCTCTGCCAAGGCTTTAGATGACTTCAGCCATGTCCGCCAGGATGAAGTAAAAACACTTACGCGCGCCCTAGCGAGTGCTGGGCAAAAGCCGGTCAAGTTAGGCCAACTGTTGAACGTGTGCACCACGAATGCACTTGCGCGAGTGATGCTAGGGAGGCGGGTGTTCGCTGACGCAAGTAGCGCTGATCCACAGGCGGAAGAGTTCAAGTCAATGGTGGTGGAAGCAATGGTGCTCGCCGGCAATTTCAATATTGGCGATTTTATTCCGGCACTTGATTGGTTGGACATACAAGGTGTAGCTGCAAAGATGAAAAAGCTCCACGCGCGTTTCGACGCGTTCTTGACCTCAATTCTAGAGGAACACAAAAGCAAGCAATTTGAAGAAACGAAAGAACATGAAGACTTGTTGAGTACGTTAATCTCTTTGAAAAAAGAAGAAGGCGATAATGAAGGAGGAAAGCTCACAGATTCAGAAATTAAAGCTTTACTTTTGAACTTGTTTATAGCTGGAACAGACACGTCCTCAAGCACAGTAGAATGGGCCATTGCGGAGCTTATTCGTAATCCAAGAATTCTGGCCCAAGCCCAACATGAGATTGACAAAGTGGTTGGAAAGAACCGGCTCGTGATGGAATCCGACCTAGCCCAATTAACTTATTTGGAAGCCATAGTCAAGGAAACCTTAAGGCTTCATCCATCCACCCCTCTCTCCCTCCCTAGAATTGCATCCGAGAGTTGTGAGATTAATGGCTATTTCATTCCAAAAGGCTCAACACTTCTCGTGAACGTTTGGGCCATCGCTCGTGATCCAAATGAATGGGTTAATCCATTGGAGTTTAGGCCCGAAAGATTTCTGCCTGGTGGTGAGAAGCCCAAAGTTGATGTGCGAGGAAATGACTTTGAAGTAATTCCATTTGGAGCTGGGCGTAGAATCTGTGCTGGAATGAATTTGGGCATACGAATGGTCCAGTTGATAACCGCAACTTTAATTCATGCATTTAACTGGGATTTGCCTATTGGACAATCGTCAGAGAAACTAAACATGGAGGAAGCATTTGGGCTGACCTTACAACGGGCTGATCCGTTAGTGGTGCACCCCGGTCTTCGCCTAGAAGCCCAAGCATACATTGGGTGAAGAACGGAAACTGCCCATTCCATACGAATGGTCCAGTTGATAACCGCAACTTTAATTCATGCATTTAACTGGGATTTGCCTATTGGACAATCGTCAGAGAAACTAAACATGGAGGAAGCATTTGGGCTGACCTTACAACGGGCTGATCCGTTAGTGGTGCACCCCGGTCTTCGCCTAGAAGCCCAAGCATACATTGGGTGA。

the tobacco flavone monooxygenase CYP75B2 coded by the tobacco flavone monooxygenase gene NtCYP75B2 comprises 455 amino acids, and the amino acid sequence is shown as SEQ ID NO.2, and specifically comprises the following steps:

MARTYGPLMHLKMGFVDVVVVASASVAAQFLKTHDANFSSRPPNSGAKHLAYNYQDLVFAPYGPRWRMLRKICSVHLFSAKALDDFSHVRQDEVKTLTRALASAGQKPVKLGQLLNVCTTNALARVMLGRRVFADASSADPQAEEFKSMVVEAMVLAGNFNIGDFIPALDWLDIQGVAAKMKKLHARFDAFLTSILEEHKSKQFEETKEHEDLLSTLISLKKEEGDNEGGKLTDSEIKALLLNLFIAGTDTSSSTVEWAIAELIRNPRILAQAQHEIDKVVGKNRLVMESDLAQLTYLEAIVKETLRLHPSTPLSLPRIASESCEINGYFIPKGSTLLVNVWAIARDPNEWVNPLEFRPERFLPGGEKPKVDVRGNDFEVIPFGAGRRICAGMNLGIRMVQLITATLIHAFNWDLPIGQSSEKLNMEEAFGLTLQRADPLVVHPGLRLEAQAYIG。

example 2

Based on example 1, the inventor further transforms the constructed recombinant TRV2-NtCYP75B2 vector into tobacco plants by utilizing the agrobacterium-mediated VIGS technology, and performs verification analysis on the phenotype change conditions of the related plants, wherein the specific experimental process is briefly described as follows.

(1) Transformation of Agrobacterium

It should be noted that, referring to the operation of example 1 and the prior art, the inventors prepared TRV2-GFP and TRV2-PDS recombinant vectors as positive and negative controls of transgenes at the same time, and the specific transformation process was:

positive cloning plasmids of TRV2-GFP (vector control), TRV2-PDS (VIGS efficiency control) and TRV2-NtCYP75B2 are respectively transformed into agrobacterium GV3101 competent cells by an electric shock transformation mode, cultured and screened by using YEB plates containing 50mg/L Kan and 50mg/L Rif, and subjected to inverted culture at 28 ℃ for 2d, and then screened by colony PCR for agrobacterium carrying the target gene.

(2) Preparation of a transfection solution

Culturing the positive agrobacterium clones obtained by screening in the step (1) in YEB liquid culture medium (containing 50mg/L Kan and 50mg/L Rif) of 5mL for 24h under the conditions of 28 ℃ and 250 rpm;

inoculating 50uL of the culture into YEB liquid culture medium (containing 50mg/L Kan) of 50 mL, culturing to OD600 = 1.0-1.5, centrifuging at 4000r for 5min, collecting thallus, and adding MMA (1 mL (1M) MgCl ₂ (ii) a 1 mL (1M, ph 5.6) MES; 75. μ L (200 mM) As) was resuspended, OD600 = 1.0;

finally, 3 h was left at room temperature and used as a bacterial solution for transfection.

(3) Transient transformation

And (3) taking the K326 tobacco leaves 3~4 Zhou Miaoling as experimental materials, injecting the bacterial liquid for transfection prepared in the step (2) into the tobacco leaves by using a 1 mL specification injector, continuously culturing the injected tobacco in an artificial incubator, and observing the phenotypic change.

The phenotypic changes of tobacco 3 weeks after injection are shown in figure 1. As can be seen, the newly grown leaves of the agrobacteria impregnated plant containing TRV2-PDS have bleaching phenomenon, which indicates successful infection; the TRV2-GFP group has no obvious change, and the corresponding TRV2-NtCYP75B2 group tobacco plants have no obvious change, which indicates that the NtCYP75B2 gene has no obvious influence on other basic physiological states of tobacco.

Further, the expression condition of the NtCYP75B2 gene is detected through qRT-PCR, and the result is shown in figure 2, so that the expression quantity of the NtCYP75B2 in the infected plant of TRV2-NtCYP75B2 is obviously reduced.

Further, the inventor tests the content of chlorogenic acid in the plants in the experimental group (TRV 2-NtCYP75B 2-impregnated plants) and the control group (TRV 2-GFP impregnated plants), the test results are shown in FIG. 3, and it can be seen from FIG. 3 that the growth phenotype of the silenced plants is normal; the gene expression level is slightly reduced, and is less than 15%; the content of chlorogenic acid is reduced to about 60% of that of the control, and the result shows that the NtCYP75B2 gene is a good chlorogenic acid regulation target gene and can effectively reduce the content of the chlorogenic acid as a phenol precursor in tobacco leaves under the condition of not influencing the phenotype of tobacco plants.

The detection of the content of chlorogenic acid is determined by using an ultra-high liquid phase-triple quadrupole tandem mass spectrometry method, and specifically comprises the following steps: taking 50mg tobacco leaf samples, transferring into 1.5mL ethanol-water extracting solution (internal standard: umbelliferone 75 ng/mL), performing ultrasonic treatment for 1h at normal temperature, centrifuging at 14000rpm, and taking supernate for detection. The analysis conditions used were: the chromatographic conditions were BEH Phenyl column (2.1X 150mm,1.7 um), mobile phase 0.1% formic acid water (A) and 0.1% formic acid methanol (B); elution gradient: increasing the B phase from 5% to 15% within 0-2min, keeping the B phase from 2-10min at 15%, and increasing the B phase from 10.01-15min at 100%; the flow rate is 0.3mL/min, the column temperature is 35 ℃, and the sample injection amount is 1uL; the mass spectrum condition is electrospray ionization source ionization, the capillary voltage under the positive ion ionization mode is 4KV, the atomization gas pressure is 40psi, the dry gas flow is 12L/min, the dry gas temperature is 290 ℃, the sheath gas flow is 11L/min, the sheath gas temperature is 200 ℃, and the real-time multi-reflection detection mode scanning is adopted.

According to the invention, through preliminary research on the specific tobacco flavone monooxygenase CYP75B2, the gene is found to be highly related to the content of the tobacco chlorogenic acid, and the content of the chlorogenic acid in the tobacco is obviously reduced after the gene is silenced. Based on the characteristic, a certain application basis and reference can be provided for the cultivation of new tobacco varieties with low phenol content.

The present invention is not limited to the above-described specific embodiments, and various modifications and variations are possible. Any modifications, equivalents, improvements and the like made to the above embodiments in accordance with the technical spirit of the present invention should be included in the scope of the present invention.

Sequence listing

<110> tobacco industry Limited liability company in Yunnan

<120> tobacco flavone monooxygenase gene NtCYP75B2 and application thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 1766

<212> DNA

<213> tobacco flavone monooxygenase gene NtCYP75B2

<400> 1

atggcaatct tttccctact tctctacact gtcattttct ctttccttct acattccatt 60

ctcaccttat tttttcgcaa acgttacccg ttgccactac caccaggtcc aaaaccatgg 120

ccaataatcg gaaacctagt ccatatgggt ccaaagccac accaatcaac tgcagcctta 180

atgcacaagg gtggtcgatg gctcgaactt acggtccact catgcacctt aagatgggat 240

tcgtggacgt ggtggttgtg gcgtctgcat cggtggcggc tcagttctta aaaactcatg 300

acgctaactt ctcgagccgc cctccgaact cgggtgcgaa acacttggct tacaattatc 360

aagatcttgt ttttgcaccc tacggaccaa ggtggcgtat gcttaggaaa atttgctctg 420

ttcatctttt ctctgccaag gctttagatg acttcagcca tgtccgccag gatgaagtaa 480

aaacacttac gcgcgcccta gcgagtgctg ggcaaaagcc ggtcaagtta ggccaactgt 540

tgaacgtgtg caccacgaat gcacttgcgc gagtgatgct agggaggcgg gtgttcgctg 600

acgcaagtag cgctgatcca caggcggaag agttcaagtc aatggtggtg gaagcaatgg 660

tgctcgccgg caatttcaat attggcgatt ttattccggc acttgattgg ttggacatac 720

aaggtgtagc tgcaaagatg aaaaagctcc acgcgcgttt cgacgcgttc ttgacctcaa 780

ttctagagga acacaaaagc aagcaatttg aagaaacgaa agaacatgaa gacttgttga 840

gtacgttaat ctctttgaaa aaagaagaag gcgataatga aggaggaaag ctcacagatt 900

cagaaattaa agctttactt ttgaacttgt ttatagctgg aacagacacg tcctcaagca 960

cagtagaatg ggccattgcg gagcttattc gtaatccaag aattctggcc caagcccaac 1020

atgagattga caaagtggtt ggaaagaacc ggctcgtgat ggaatccgac ctagcccaat 1080

taacttattt ggaagccata gtcaaggaaa ccttaaggct tcatccatcc acccctctct 1140

ccctccctag aattgcatcc gagagttgtg agattaatgg ctatttcatt ccaaaaggct 1200

caacacttct cgtgaacgtt tgggccatcg ctcgtgatcc aaatgaatgg gttaatccat 1260

tggagtttag gcccgaaaga tttctgcctg gtggtgagaa gcccaaagtt gatgtgcgag 1320

gaaatgactt tgaagtaatt ccatttggag ctgggcgtag aatctgtgct ggaatgaatt 1380

tgggcatacg aatggtccag ttgataaccg caactttaat tcatgcattt aactgggatt 1440

tgcctattgg acaatcgtca gagaaactaa acatggagga agcatttggg ctgaccttac 1500

aacgggctga tccgttagtg gtgcaccccg gtcttcgcct agaagcccaa gcatacattg 1560

ggtgaagaac ggaaactgcc cattccatac gaatggtcca gttgataacc gcaactttaa 1620

ttcatgcatt taactgggat ttgcctattg gacaatcgtc agagaaacta aacatggagg 1680

aagcatttgg gctgacctta caacgggctg atccgttagt ggtgcacccc ggtcttcgcc 1740

tagaagccca agcatacatt gggtga 1766

<210> 2

<211> 455

<212> PRT

<213> tobacco flavone monooxygenase CYP75B2

<400> 2

Met Ala Arg Thr Tyr Gly Pro Leu Met His Leu Lys Met Gly Phe Val

1 5 10 15

Asp Val Val Val Val Ala Ser Ala Ser Val Ala Ala Gln Phe Leu Lys

20 25 30

Thr His Asp Ala Asn Phe Ser Ser Arg Pro Pro Asn Ser Gly Ala Lys

35 40 45

His Leu Ala Tyr Asn Tyr Gln Asp Leu Val Phe Ala Pro Tyr Gly Pro

50 55 60

Arg Trp Arg Met Leu Arg Lys Ile Cys Ser Val His Leu Phe Ser Ala

65 70 75 80

Lys Ala Leu Asp Asp Phe Ser His Val Arg Gln Asp Glu Val Lys Thr

85 90 95

Leu Thr Arg Ala Leu Ala Ser Ala Gly Gln Lys Pro Val Lys Leu Gly

100 105 110

Gln Leu Leu Asn Val Cys Thr Thr Asn Ala Leu Ala Arg Val Met Leu

115 120 125

Gly Arg Arg Val Phe Ala Asp Ala Ser Ser Ala Asp Pro Gln Ala Glu

130 135 140

Glu Phe Lys Ser Met Val Val Glu Ala Met Val Leu Ala Gly Asn Phe

145 150 155 160

Asn Ile Gly Asp Phe Ile Pro Ala Leu Asp Trp Leu Asp Ile Gln Gly

165 170 175

Val Ala Ala Lys Met Lys Lys Leu His Ala Arg Phe Asp Ala Phe Leu

180 185 190

Thr Ser Ile Leu Glu Glu His Lys Ser Lys Gln Phe Glu Glu Thr Lys

195 200 205

Glu His Glu Asp Leu Leu Ser Thr Leu Ile Ser Leu Lys Lys Glu Glu

210 215 220

Gly Asp Asn Glu Gly Gly Lys Leu Thr Asp Ser Glu Ile Lys Ala Leu

225 230 235 240

Leu Leu Asn Leu Phe Ile Ala Gly Thr Asp Thr Ser Ser Ser Thr Val

245 250 255

Glu Trp Ala Ile Ala Glu Leu Ile Arg Asn Pro Arg Ile Leu Ala Gln

260 265 270

Ala Gln His Glu Ile Asp Lys Val Val Gly Lys Asn Arg Leu Val Met

275 280 285

Glu Ser Asp Leu Ala Gln Leu Thr Tyr Leu Glu Ala Ile Val Lys Glu

290 295 300

Thr Leu Arg Leu His Pro Ser Thr Pro Leu Ser Leu Pro Arg Ile Ala

305 310 315 320

Ser Glu Ser Cys Glu Ile Asn Gly Tyr Phe Ile Pro Lys Gly Ser Thr

325 330 335

Leu Leu Val Asn Val Trp Ala Ile Ala Arg Asp Pro Asn Glu Trp Val

340 345 350

Asn Pro Leu Glu Phe Arg Pro Glu Arg Phe Leu Pro Gly Gly Glu Lys

355 360 365

Pro Lys Val Asp Val Arg Gly Asn Asp Phe Glu Val Ile Pro Phe Gly

370 375 380

Ala Gly Arg Arg Ile Cys Ala Gly Met Asn Leu Gly Ile Arg Met Val

385 390 395 400

Gln Leu Ile Thr Ala Thr Leu Ile His Ala Phe Asn Trp Asp Leu Pro

405 410 415

Ile Gly Gln Ser Ser Glu Lys Leu Asn Met Glu Glu Ala Phe Gly Leu

420 425 430

Thr Leu Gln Arg Ala Asp Pro Leu Val Val His Pro Gly Leu Arg Leu

435 440 445

Glu Ala Gln Ala Tyr Ile Gly

450 455

Claims

1. A tobacco flavone monooxygenase gene NtCYP75B2 is characterized in that the base sequence is shown in SEQ ID NO. 1.

2. The use of the tobacco flavone monooxygenase gene NtCYP75B2 of claim 1 for regulating the content of chlorogenic acid in tobacco.

3. The method for regulating and controlling the content of chlorogenic acid in tobacco by utilizing the tobacco flavone monooxygenase gene NtCYP75B2 as claimed in claim 1, characterized in that the content of chlorogenic acid in tobacco is regulated and controlled by regulating the expression level of tobacco CYP75B2 protein by utilizing a gene silencing technology or a gene overexpression method.

4. The tobacco flavone monooxygenase CYP75B2 encoded by the tobacco flavone monooxygenase gene NtCYP75B2 of claim 1, wherein the amino acid sequence thereof is shown in SEQ ID No. 2.

5. The use of the tobacco flavone monooxygenase CYP75B2 of claim 4 for modulating the chlorogenic acid content of tobacco.

6. A method for breeding a new variety of tobacco having the tobacco flavone monooxygenase gene NtCYP75B2 of claim 1, comprising the steps of:

(3) And transforming tobacco by using the constructed silent vector TRV2-NtCYP75B2, and screening to obtain a new variety of tobacco with variable chlorogenic acid content.