CN112390864B - Application of Mad1 protein in regulation and control of fungal spore production and germination and plant linolenic acid metabolic pathway - Google Patents

Abstract

The invention discloses application of Mad1 protein in regulation and control of fungus spore production and germination. The invention takes Metarrhizium anisopliae as a starting strain, obtains a mad1 gene knockout strain (delta mad1) by a homologous recombination method, and determines the growth rate, sporulation and germination biological characteristics of a wild strain and the delta mad 1. The wild strain and the delta mad1 spore suspension are used for soaking the root of the peanut seedling so as to detect the transcription level of linolenic acid metabolic pathway genes of the treated peanut root. The experimental results show that: compared with wild strains, the germination rate and the spore yield of the delta Mad1 are obviously reduced, and the transcription of linolenic acid metabolic pathway genes is obviously inhibited after the delta Mad1 acts on plants, so that the Mad1 can promote the spore production and germination of the metarhizium anisopliae and can up-regulate the transcription level of the linolenic acid metabolic pathway genes. The invention provides theoretical support for improvement and industrial production of fungus strains and provides basic data for Mad1 induced plant response to regulate and control the interaction of metarhizium anisopliae and plants.

Description

Application of Mad1 protein in regulation and control of fungal spore production and germination and plant linolenic acid metabolic pathway

Technical Field

The invention belongs to the technical field of biology, and particularly relates to application of Mad1 protein in regulation and control of fungal spore production and germination and plant linolenic acid metabolism.

Background

Metarhizium anisopliae, a kind of entomopathogenic fungi, is used for controlling agricultural and forestry pests due to its broad insecticidal ability. Such as locust, grub, etc. Three life styles of saprophytic, plant symbiotic and insect pathogenic are derived through the long biological evolution. Metarhizium anisopliae has been developed into various biological preparations for controlling locust pests in recent years, and the biological control effect is remarkable. At present, different metarhizium anisopliae strains have different infection levels, germination rates and virulence, so that the control capability of the researched biological preparation is obviously influenced. Therefore, the research and improvement of genes for controlling the biological characteristics of fungi are needed, and the breakthrough is made in the aspect of using the metarhizium anisopliae as a green sustainable microbial preparation. Metarhizium anisopliae adhesin Mad1(adhesin-like protein1) has a hydrophobic signal peptide sequence at the N-terminal, has a highly conserved Glycosyl Phosphatidylinositol (GPI) cell wall anchor site at the C-terminal, is bridged to a core glycan through ethanolamine phosphate, and has a phospholipid structure to link a GPI anchor to the outside of a host cell membrane. Mad1 contains a tandem repeat of threonine (Thr) in the middle region. The terminal region contains proline (Pro) tandem repeat sequence, and the Mad1 structure contains a CFEM functional structural domain containing 8 cysteines, and the protein containing the structural domain can be used as a cell surface receptor, a signal transducer or an adhesion molecule interacting with a host. Research shows that after the Mad1 is knocked out, the adhesion capacity of the metarhizium anisopliae to the locust back wing is reduced, the toxicity to the locust is obviously reduced, and Mad1 influences the division of cells and the formation of cytoskeleton. However, whether Mad1 influences sporulation, germination and growth rate of fungi is not reported at present.

In recent years, the research shows that the metarhizium anisopliae can be stored in the rhizosphere of the plant and enter the plant body, and the growth of the plant is promoted. After treatment of switchgrass (Panicum virgatum) and kidney beans (Phaseolus vulgaris) with conidia of Metarrhizium anisopliae, the growth of root hair and lateral roots thereof can be promoted. After a corn (Zea mays) is inoculated with enhanced green fluorescent protein (eGFP) labeled Metarhizium anisopliae (Metarhizium anisopliae) 14d, the Metarhizium anisopliae is amplified to an eGFP fragment from corn root DNA through qualitative and quantitative PCR, hyphae which are planted in the corn root and carry green fluorescence are detected through laser confocal (LSCM) technology, and the Metarhizium anisopliae can be planted in the corn root. A linolenic acid metabolite JA is an important plant hormone for plant growth and development and resistance to adversity stress, and a plurality of researches prove that JA plays an important role in the interaction between beneficial microorganisms including arbuscular bacteria, rhizobia and the like and plants at present. Researches show that the planting of arbuscular mycorrhizal fungi on barley roots leads to the rise of endogenous JA level, and JA response genes and biosynthesis related genes are expressed in cells containing arbuscular mycorrhizal fungi, so that the increase of JA in mycorrhizal plants is possibly a necessary condition for mycorrhizal symbiosis formation. However, it is not known how Mad1 as an adhesive protein assists metarhizium anisopliae to colonize plant roots in metarhizium anisopliae-plant interaction.

Disclosure of Invention

The first purpose of the invention is to provide a new application of Mad1 protein or biological material related to Mad1 protein.

The invention provides application of Mad1 protein or biological material related to Mad1 protein in regulation and control of fungal spore production and/or germination;

the invention also provides application of the Mad1 protein or the biological material related to the Mad1 protein in regulating and controlling the expression level of the linolenic acid metabolic pathway gene of plants.

The Mad1 protein is a protein shown in a) or b) or c) or d) as follows:

a) a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table;

b) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 1 in the sequence table;

c) the protein with the same function is obtained by substituting and/or deleting and/or adding one or more amino acid residues in the amino acid sequence shown in the sequence 1 in the sequence table;

d) a protein having a homology of 99% or more, 95% or more, 90% or more, 85% or more, or 80% or more with the amino acid sequence defined in any one of a) to c) and having the same function.

The biomaterial is any one of the following A1) to A8):

A1) a nucleic acid molecule encoding Mad1 protein;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

Further, the nucleic acid molecule of A1) is a gene as shown in1) or 2) or 3) as follows:

1) the coding sequence is a DNA molecule shown in sequence 2;

2) a cDNA molecule or a genome DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by 1) and codes the Mad1 protein;

3) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence limited by 1) or 2) under strict conditions and codes the Mad1 protein.

Furthermore, the regulation of the fungal spore production is embodied as regulation of the fungal spore production;

the regulation and control of the fungus germination are embodied as regulation and control of the fungus germination rate.

The linolenic acid metabolic pathway gene is MYC2 gene and/or C74A2 gene and/or AOC4 gene and/or LOX31 gene and/or LOXX gene and/or LOX3 gene and/or 4CLL 5.

The second purpose of the invention is to provide a new application of the substance shown as b1 or b 2;

b1, substances that inhibit or reduce the activity or content of Mad1 protein in fungi;

b2, a substance inhibiting or reducing the expression of a nucleic acid encoding a Mad1 protein in a fungus or a substance knocking out a nucleic acid encoding a Mad1 protein in a fungus.

The invention provides application of a substance shown as b1 or b2 in reducing sporulation quantity and/or germination rate of fungi.

The invention also provides application of the substance shown in b1 or b2 in regulating and controlling the expression level of linolenic acid metabolic pathway genes of plants.

The invention also provides application of the Mad1 protein or the biological material in cultivating fungi with improved sporulation yield and/or improved germination rate.

The invention also provides application of the substance b1 or b2 in cultivating fungi with reduced sporulation amount and/or germination rate.

It is a third object of the present invention to provide a method for breeding fungi with reduced sporulation and/or reduced germination.

The method for cultivating the fungi with reduced sporulation amount and/or reduced germination rate comprises the steps of reducing the content and/or activity of the Mad1 protein in recipient fungi to obtain transgenic fungi; the transgenic fungus has a lower sporulation amount and/or germination rate than the recipient fungus.

Further, the method for reducing the content and/or the activity of the Mad1 protein in the recipient fungus can be realized by knocking out or inhibiting or silencing a gene encoding the Mad1 protein in the recipient fungus.

The nucleotide sequence of the Mad1 protein coding gene is a DNA molecule shown in sequence 2.

Furthermore, the substance for knocking out the coding gene of the Mad1 protein in the recipient fungus is a DNA molecule shown in sequence 3 and a DNA molecule shown in sequence 4.

The fourth purpose of the invention is to provide a method for regulating and controlling the expression level of the linolenic acid metabolic pathway gene of the plant.

The method for regulating and controlling the expression level of the linolenic acid metabolic pathway gene of the plant comprises the following steps: a step of treating the plant with the transgenic fungus constructed by the above method.

Further, the treatment method is to soak the roots of the plant seedlings with the transgenic fungus suspension.

Further, the plant is peanut.

In any of the above uses or methods, the fungus may be a fungus of the genus Metarhizium; the fungus of Metarhizium genus may be Metarhizium anisopliae, such as Metarhizium anisopliae Ma 9-41.

In any of the above applications or methods, the gene regulating linolenic acid metabolic pathway is specifically embodied to up-regulate the transcription level of MYC2, C74a2, AOC4, LOX31, LOXX, LOX3 gene and/or down-regulate the transcription level of 4CLL5 gene.

The fifth object of the present invention is to provide a substance for knocking out nucleic acid encoding Mad1 protein in fungi.

The substance for knocking out the nucleic acid encoding the Mad1 protein in the fungi provided by the invention comprises a DNA molecule shown in a sequence 3 and a DNA molecule shown in a sequence 4.

In order to research the biological influence of the adhesin Mad1 on the metarhizium anisopliae, the invention takes the metarhizium anisopliae Ma9-41 as a starting bacterium, obtains a Mad1 gene knockout strain (delta Mad1) by a homologous recombination method, and determines the biological characteristics of the growth rate, sporulation amount and germination rate of wild strains Ma9-41 and delta Mad1 so as to determine the action of the Mad1 in the growth, sporulation and germination of the metarhizium anisopliae. The test result shows that: compared with wild type metarhizium anisopliae, the germination rate and the spore yield of the mad1 gene knockout strain delta mad1 are obviously reduced, which shows that mad1 has no influence on the growth rate of the metarhizium anisopliae, but can promote the spore production and germination of the metarhizium anisopliae. In order to research the action path of the adhesin Mad1 for inducing plants, the invention also analyzes the response of linolenic acid metabolic pathway genes after the wild strain Ma9-41 and the knockout strain delta Mad1 act on peanut roots. The test result shows that: compared with wild strains, the delta mad1 obviously inhibits the transcription of linolenic acid metabolic pathway genes after acting on plants, and is shown in that the transcription levels of MYC2, C74A2 and AOC4 genes are obviously reduced, the reduction times are respectively 0.66 time, 0.52 time and 0.49 time of wild strains, and the reduction times are respectively 0.74 time, 0.3 time and 0.64 time of lipoxygenase gene LOX31, LOXX and LOX 3. Only one gene 4CLL5 appears up-regulated expression, the up-regulation multiple is 1.34 times, which shows that Mad1 can obviously up-regulate the transcription level of most genes of linolenic acid metabolism and promote the biosynthesis of plant JA, and Mad1 can be used as a signal molecule for plant microorganism identification and further promote the colonization of microorganisms by promoting the biosynthesis of JA. The invention provides theoretical support for improvement and industrial production of fungus strains and provides basic data for Mad1 induced plant response to regulate and control the interaction of metarhizium anisopliae and plants.

Drawings

FIG. 1 shows the sequences of S1, S2 and hyg amplification. M: DL5000 DNA marker; 1: s1; 2: s2; 3: hyg.

FIG. 2 shows the construction of the target vector. a is a carrier S1-hyg; b is vector hyg-S2.

FIG. 3 shows the amplification sequences S1+ hyg and hyg + S2. M: DL5000 DNA marker; 1-4: s1+ hyg; 5-6: hyg + S2.

FIG. 4 shows the amplification sequences S1+2/3hyg, 2/3hyg + S2. M: DL5000 DNA marker; 1: s1+2/3 hyg; 2: 2/3hyg + S2.

FIG. 5 shows the protoplast of Metarrhizium anisopliae Ma 9-41.

FIG. 6 shows the genomic DNA verification of suspected mutant strains by mad1 gene knockout. Note: the first row is mad1 gene; the second row is hyg gene.

FIG. 7 shows cDNA verification of suspected mutant by mad1 gene knockout.

FIG. 8 is a comparison of the growth rates of wild Metarrhizium anisopliae strain Ma9-41 and Δ mad 1.

FIG. 9 shows the germination rates of wild Metarrhizium anisopliae strain Ma9-41 and Δ mad 1. Note: "x" indicates a very significant difference with respect to the control, p <0.01, "x" indicates a significant difference with respect to the control, p < 0.05.

FIG. 10 shows the relative expression levels of linolenic acid metabolism genes induced in peanut by the strains. The letters represent the significance of the differences between the different treatments, p < 0.05.

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The test methods in the following examples are conventional methods unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

The test plant peanut (Arachis hypogaea) strain No. 11 in the examples described below is described in the literature "Hao K, Wang F, Nong X, et al, response of peanut Arachis hypogaea roots to the presence of fire and pathogenic fungi by transgenic animals, 2017,7(1): 964", publicly available from the plant protection research institute of the Chinese academy of agricultural sciences, and the biological material is used only for the repetition of the experiments related to the present invention and is not used for other purposes.

Metarhizium anisopliae Ma9-41 in the following examples is described in the literature "Liu Shao Fang, Cao Guangchun, nong oriented species, etc.. two promoters affect the fluorescent expression of egfp in Metarhizium anisopliae [ J ]. Chinese agricultural science 2015,48:23-31.

The plasmid pKH-KO in the following examples is described in "functional study of Trichoderma butyricum Th-33 Galpha III gene thga3 [ D ].2017 ], publicly available from plant protection research institute of Chinese academy of agricultural sciences, and the biomaterial is used only for repeating the experiments related to the present invention and is not used for other applications.

The sources of reagents and media in the following examples are as follows: the cloning vector PBM23 is a product of the bmede organism. The Prime script TM 1st strand cDNA synthesis kit reverse transcription kit is a product of Beijing Weizhi Biotechnology GmbH. Restriction enzymes XbaI, HindIII, T4 DNA ligase are products of TaKaRa. The Biomed recovery kit, lyase Lysing Enzyme from Trichoderma is a product of Willebon Biotechnology, Inc.

The media formulations in the following examples are as follows:

potato sucrose agar medium (PSAY): 1000mL contains 200g of potatoes, 20g of cane sugar, 18g of agar and 5g of yeast powder.

Producing a hypha culture medium: 1000mL contains 2g of magnesium sulfate, 20g of sucrose, 10g of yeast powder and 5g of dipotassium hydrogen phosphate.

Protoplast buffer: snail enzyme 0.2g was dissolved in 20mL of sterile 0.7M NaCl solution and filtered through a 0.45 μ M sterile filter.

STC buffer: sucrose 200g (20%), 1M Tris-HCl (pH 8.0)50mL (10mM), CaCl₂5.55g (50mM), constant volume to 1L, high pressure sterilization, room temperature placement.

PTC buffer: 40g of PEG8000 was dissolved by heating with 100mL of STC Buffer, and filtered through a 0.45 μm sterile filter.

TB3 liquid medium: 3g of yeast powder, 3g of casamino acid, 200g of sucrose and distilled water, wherein the volume is fixed to 1L, and the autoclave is sterilized.

TB3 solid medium: adding 10-15% agar powder into TB3, and autoclaving.

The data processing method in the following embodiment is as follows: the analysis was performed using SPSS20, and multiple comparisons were performed using the Duncan method. The results of the analysis were graphed using GraphPad Prism 6 software.

Example 1 construction of Mad1 knock-out Strain (. DELTA.mad 1) and measurement of biological Properties thereof

First, construction of Mad1 knock-out Strain (. DELTA.mad 1)

1. Construction of the target vector

1) Acquisition of hyg sequence and homologous sequences S1, S2

The hygromycin hyg sequence (size 1406bp) is amplified by taking the plasmid pKH-KO as a template and hyg-F/hyg-R as primers. Extracting metarhizium anisopliae Ma9-41 genome DNA as a template, respectively using S1-F/S1-R and S2-F/S2-R as primers, and respectively amplifying to obtain upstream and downstream homologous sequences of mad1 gene with lengths of 1092bp and 1014bp (S1, S2). The results of electrophoresis of the hyg sequence and the homologous sequences S1 and S2 are shown in FIG. 1.

2) Obtaining of S1-hyg vector

The mad1 homologous forearm S1 and hygromycin resistance screening gene hyg are respectively connected to a cloning vector PBM23 to obtain a PBM23-S1 vector and a PBM23-hyg vector. PBM23-hyg vector is used as a template, XbaI-hyg-F/HindIII-hyg-R is used as a primer for PCR amplification, and hyg genes XbaI-hyg-HindIII with XbaI and HindIII enzyme cutting sites at two ends are obtained. The PBM23-S1 vector and the XbaI-hyg-HindIII gene are subjected to double enzyme digestion by taking XbaI and HindIII as enzyme digestion sites, the enzyme digested XbaI-hyg-HindIII gene and the enzyme digested PBM23-S1 vector are connected under the action of T4 ligase to obtain an S1-hyg vector, and the structural schematic diagram of the S1-hyg vector is shown in FIG. 2 a.

3) Obtaining of hyg-S2 vector

The mad1 homologous hind arm S2 was ligated to the cloning vector PBM23 to obtain the PBM23-S2 vector. The vector PBM23-S2 was used as a template, and XbaI-S2-F/HindIII-S2-R was used as a primer for PCR amplification to obtain the S2 gene XbaI-S2-HindIII with XbaI and HindIII at both ends. The PBM23-Hyg vector and the XbaI-S2-HindIII gene are subjected to double enzyme digestion by taking XbaI and HindIII as enzyme digestion sites, and the enzyme digested XbaI-S2-HindIII gene fragment and the enzyme digested PBM23-Hyg vector are connected for 6 hours at 16 ℃ under the action of T4 ligase to obtain the Hyg-S2 vector, wherein the structural schematic diagram of the Hyg-S2 vector is shown in figure 2 b.

4) Verification of object carriers

Carrying out PCR amplification by taking the S1-hyg vector as a template and the S1-F, hyg-R as a primer to obtain an S1+ hyg fragment with the size of 2518 bp. PCR amplification is carried out by taking hyg-S2 vector as a template and hyg-F, S2-R as a primer to obtain a hyg + S2 fragment with the size of 2444 bp. The electrophoresis detection result of the amplification product is shown in FIG. 3, and the result proves that the target vector is successfully constructed.

2. Obtaining target fragments

Carrying out PCR amplification by taking an S1-hyg vector as a template and taking S1-F and 2/3hyg-R as primers to obtain an S1+2/3hyg fragment with the size of 2037bp, wherein the nucleotide sequence of the fragment is shown as a sequence 3. PCR amplification is carried out by using the hyg-S2 vector as a template and 1/3hyg-F, S2-R as a primer to obtain a 2/3hyg + S2 fragment with the size of 1954bp, and the nucleotide sequence of the fragment is shown as a sequence 4.

PCR reaction (50. mu.L): 2 × Taq PCR Master Mix 25 μ L, primer F4 μ L, primer R4 μ L, cDNA 2 μ L, complement ddH₂O to 50. mu.L. PCR reaction procedure: pre-denaturation at 94 ℃ for 5min, followed by denaturation at 94 ℃ for 30s, annealing at 58 ℃ for 30s, extension at 72 ℃ for 2min, 35 cycles, and extension at 72 ℃ for 10 min.

The PCR product was subjected to 1.5% agarose gel electrophoresis and purified and recovered by using a Biomed recovery kit. The results of the electrophoretic detection of the target fragment are shown in FIG. 4.

3. Vector construction and fragment acquisition primer and sequence information thereof

TABLE 1 vector construction and target fragment specific primers

4. Protoplast transformation

Transferring the S1+2/3hyg and 2/3hyg + S2 fragments into a metarhizium anisopliae wild strain Ma9-41 protoplast by using a PEG mediated protoplast transformation method to obtain a regenerative cell and screen a transformant. The method comprises the following specific steps:

1) hypha culture

Collecting Metarrhizium anisopliae Ma9-41 spore on PSAY culture medium, preparing spore suspension, inoculating 5mL of spore suspension with concentration of 3 × 10⁸Culturing spore/mL spore suspension in 100mL hypha-producing culture medium at 27 deg.C under shaking at 180r/min for 30h to obtain young hypha. The hyphae were collected by filtration through a Miracloth membrane and sterile funnel and washed twice with 10mL of 0.7M NaCl solution.

2) Enzymolysis

Putting about 0.1g of collected wet mycelia into a 50mL centrifuge tube, adding 20mL of protoplast buffer, carrying out enzymolysis at 30 ℃ for 3h at 80r/min, filtering redundant mycelia by using a Miracloth membrane after the enzymolysis is finished, obtaining a filtrate of the protoplast, centrifuging for 15min at 4000rpm, discarding the supernatant, and collecting precipitated protoplasts.

3) Protoplast acquisition

The precipitated protoplasts were washed twice with 20-30mL of 0.7M NaCl solution and twice with STC buffer, and the protoplasts were suspended in 600. mu.L of STC buffer, counted in a microscope and adjusted to a final concentration of (2-5). times.10⁷one/mL. The protoplasts obtained after enzymatic digestion of the wild strain Ma9-41 are shown in FIG. 5.

4) Protoplast transformation

Adding 200 mu L of protoplast of Metarrhizium anisopliae Ma9-41 strain into 15mL of centrifuge tube, respectively adding 30 mu L of constructed S1+2/3hyg and 2/3hyg + S2 fragments, slowly blowing up and down, uniformly mixing, standing at room temperature for 20min, adding 1.25mL of PTC solution, reversing, uniformly mixing, and standing at room temperature for 20 min; 5mL of TB3 liquid medium (Amp concentration is 100. mu.g/mL) was added, and the mixture was shaken overnight at 100rpm/min at room temperature (27 ℃) for 12 hours to produce white flocs, which were regenerated protoplasts.

5) Culture of transformants

The protoplast regenerant was centrifuged at 4000rpm at room temperature for 10min, the supernatant was discarded, the resulting pellet was resuspended in 200. mu.L of LSTC solution, 50. mu.L and 100. mu.L of the above suspensions were added to 15mL each of TB3 solid medium containing low-melting agarose (containing Amp at 100. mu.g/mL and hygromycin at 300. mu.g/mL) as a lower layer medium, mixed well, and cultured overnight at 27 ℃ for 12 h. Then 10mL of TB3 solid medium (Amp concentration 100. mu.g/mL, hygromycin concentration 300. mu.g/mL) containing low-melting agarose was poured into the upper layer as the upper layer medium, and the medium was placed in an incubator at 27 ℃ for 2-3 days in the dark until transformants appeared.

5. Verification of transformants

Selecting a plurality of assumed transformants (preferably 20-100), transferring the transformants to a PSAY culture medium (the hygromycin concentration is 300 mu g/mL) containing hygromycin, subculturing for 5 generations, scraping hyphae, extracting genome DNA by using a fungus extraction kit (desert organisms), amplifying a hygromycin resistance gene hyg by using hyg-F/hyg-R as a primer and amplifying a mad1 gene by using mad1-F/mad1-R as a primer. Transformants containing the hyg gene but not the mad1 gene band were saved as suspected knock-out strains. The following suspected mad1 mutants 2-21, 2-24, 1-11, 1-19, 1-26, 1-27 and 1-29 were obtained by screening, and their cDNAs were verified as shown in FIG. 6.

6. Validation of transformant cDNA

Activating a suspected knockout strain obtained by genome DNA verification, extracting RNA, performing reverse transcription to obtain cDNA, verifying whether a mad1 gene exists by taking the cDNA as a template and respectively taking mad1-F/mad1-R as primers, and if the gene is not transcribed, determining that the strain is the knockout strain. The verification results are shown in fig. 7, and the results show that: the mad1 genes of the 4 suspected mutant strains 1-11, 1-19, 1-26 and 1-27 were successfully knocked out.

II, biological assay of wild bacteria Ma9-41 and knockout strain delta mad1

1. Comparison of growth rate and sporulation amount of wild strain Ma9-41 and knockout strain delta mad1

Preparing conidia of the activated Metarrhizium anisopliae wild strain Ma9-41 and the knock-out strain delta mad1 into a mixture with the concentration of 1.0 multiplied by 10 by 0.1 percent of Tween-80⁶spore/mL suspension, different strains were inoculated by drop-seeding onto PSAY plates. Inoculating on the middle of the surface of the culture plate, wherein each point is a circular inoculating surface, and each point is inoculated with 10 mu L of spore suspension, each strainRepeat 4 times. Measuring the diameter of the colony 1 time by using an electronic digital display caliper every 1 day by adopting a cross method from the beginning of the growth of the colony, taking the average value, observing for 9d in total, measuring the growth diameter of the colony from the 72 th hour when the fungus starts to germinate and grow into the colony, and comparing the growth speeds of the colonies of different strains until the fungus starts to produce spores. After the spore production of the metarhizium anisopliae is finished, a punch with the diameter of 5mm is used for punching a bacterial cake at a position 1/2 from the center of a bacterial colony as the central point of the bacterial cake, the bacterial cake is placed in quantitative 0.1% Tween-80 sterile water, and the spore is fully dispersed by oscillation. The spore concentration was measured using a hemocytometer and converted into the amount of spore produced per unit area, and each strain was repeatedly measured 3 times.

Statistical results of colony diameters were shown by SPSS analysis: there was no significant difference in hyphal growth rate between the wild strain Ma9-41 and Δ mad1 (FIG. 8). The sporulation amount counted by the blood counting plate is shown by SPSS analysis: the sporulation quantity of the wild strain Ma9-41 is obviously different from that of delta mad1 (Table 2), and the knockout of mad1 obviously inhibits the sporulation of fungi. The Mad1 has no influence on the growth of hyphae, but the Mad1 can regulate the sporulation of metarhizium anisopliae.

TABLE 2 comparison of sporulation yields of wild type strains with. DELTA.mad 1

Bacterial strains	Number of spores (number/cm)2)
		Ma9-41	5.06×108±1.26
Δmad1	2.85×108±0.35

2. Germination rates of wild bacteria Ma9-41 and knockout strain delta mad1 are compared

The conidia of the activated Metarrhizium anisopliae wild strain Ma9-41 and the knock-out strain delta mad1 are placed in a 5mL SDAY test tube, so that the concentration of the conidia is 10⁶spore/mL, dripping 10 mu L of spore suspension on a glass plate, coating the suspension into a circle with the diameter of about 1cm, carefully placing the suspension in a culture dish paved with 2 layers of filter paper, performing moisture preservation culture at 28 ℃, inducing the germination of metarhizium anisopliae on a glass slide, observing the spore germination conditions after 6h, 12h, 24h and 48h, calculating the germination rate of conidia, repeating the sample at each time point for 3 times, wherein the visual field of each observation is not less than 100 spores, and in order to avoid the influence of environmental change on spore germination during observation, discarding the sample after each observation and not using the sample for subsequent observation. Conidiophores germination rate (%) ([ total number of spores germination/total number of investigated spores)]×100％。

As a result, as shown in FIG. 9, both the wild type strains Ma9-41 and Δ mad1 could germinate, and it was found that the germination rate of Δ mad1 was significantly lower than that of the wild type strain. At germination time of 24h, the germination rate of the wild strain reaches more than 70%, while the delta mad1 only reaches half of that of the wild strain. When the wild strain germinates for 48 hours, the germination rate of the wild strain reaches 98 percent, and the germination rate of the delta mad1 has 90 percent. Indicating that Δ mad1 inhibited fungal germination. Thus proving that mad1 can regulate and control the expression of the germination related gene of the metarhizium anisopliae, thereby maintaining or promoting the germination of the fungus.

Thirdly, analysis of the Effect of Mad1 knockout strain (. DELTA.mad 1) on peanut plants

Soaking roots of peanut seedlings in two leaf periods in 0.1% Tweens (blank control group), wild strain Ma9-41 (control group) and delta mad1 spore suspension (experimental group), and respectively detecting the transcription levels of linolenic acid metabolic pathway genes MYC2 (sequence 5), C74A2 (sequence 7), AOC4 (sequence 8), LOX31 (sequence 11), LOXX (sequence 10), LOX3 (sequence 9) and 4CLL5 (sequence 6) of the peanut roots after soaking for 6 hours by adopting RT-qPCR. The method comprises the following specific steps:

1. preparation of spore suspension

Inoculating Ma9-41 and knockout strain delta mad1 on PSAY medium, culturing at 26 deg.C for 14 days, collecting conidia, formulating with sterilized 0.1% Tween-80 water solution, and adjusting to final concentration of 1 × 10⁸Conidia per mL of conidia suspension.

2. Peanut planting and inoculation treatment

The surface of the peanut seeds is disinfected by soaking in a 70% ethanol solution for 1min, washing with sterile water for 3 times, soaking in a 1% sodium hypochlorite solution for 15min, and washing with sterile water for 3 times. Place the sterilized seeds in a medium containing 50mL ddH₂Placing the seeds with the same germination length in a culture dish with the diameter of O of 15cm in a dark incubator at 28 ℃ for accelerating germination for 24h, selecting healthy and uniformly germinated seeds, sowing the seeds in a flowerpot filled with sterilized vermiculite, culturing the seeds in a culture room (L: D is 14:10, 28 ℃) for 14D with the relative humidity of 40% -60%, selecting uniformly grown plants on the 7 th day, carefully taking out the plants with roots, washing the vermiculite at the root with distilled water, and adding 1 × 10 of the seeds⁸The peanut roots are soaked in spore suspension of Metarhizium anisopliae Ma9-41 and knockout strain delta mad1 in a spore/mL manner, and three strains are repeated in each treatment. After 6h treatment the roots were removed, blotted dry with absorbent paper and immediately placed in liquid nitrogen. The roots were cut rapidly to 5-8mm, mixed and divided into 3 portions with the same treatment but different repetition, and stored at-80 ℃ for future use.

3. RNA extraction and reverse transcription

Taking a peanut root sample, grinding the peanut root sample in liquid nitrogen, and then using the peanut root sample

Isolation kit (Invitrogen) extracts total RNA. The reverse transcription was carried out using Prime script TM 1st strand cDNA synthesis kit (TaKaRa Co.) to obtain cDNA. And the concentration was measured with a NanoPhotometer micro spectrophotometer (impelen, germany).

4. Real-time fluorescent quantitative PCR

Linolenic acid metabolic pathway genes were determined based on previous transcriptome analysis, and primer sequences were designed as shown in Table 2, and 60s ribosomal protein L7(RPL7) was used as an internal reference gene. The reaction was carried out using a SYBR Green fluorescent quantitation kit (TaKaRa) on a model 7500 (ABI) real-time fluorescent quantitation PCR system. The reaction system was 2 XSSYBR Green Master Mix 10. mu.L, forward and reverse primers 1. mu.L each, cDNA 0.8. mu.L, complement ddH₂O to 20. mu.L. The primer sequences are shown in Table 3. The PCR amplification procedure was pre-denaturation at 95 ℃ for 2min, denaturation at 95 ℃ for 5s, renaturation at 60 ℃ for 30s, 40 cycles. Relative gene expression with 3 technical replicates per sampleAmount adopted is 2^-ΔΔCtThe method of (3) for analysis.

TABLE 3 linolenic acid metabolic pathway genes and primers specific for same

Gene	Forward primer	Reverse primer
			MYC2	CCTTCAGTTCCTTCTCCAATCG	TGGTTGTGTTGTTGTTGCGT
C74A2	TCTCTTGGACGCTGTTTCCTT	GAGGCGATGGTGCTGATGTA
			AOC4	TCCACTTTGCCACACTCTTCC	TTCAGATGACTCAGCCTGGC
4CLL5	TTCAGTAACGAGGAAGCAAC	AGCAGCATCAGCAATGTCTG
			LOX31	TCCAAGAACGAAAGGTCCAAAG	GTTGCTCACCGTAATCGCAC
LOXX	TCTCACTGCCATCTTTAGCCG	CTTGCCTTGCTCCCAATGT
			LOX3	GGCAAACGATAACAGGCACAG	TGGAAAGCAACTGAACGAC
RPL7	AGAAGAGGGAGGAGGAATGG	GGATGCGGATGATAAACAGG

The results are shown in FIG. 10. As a result, it was found that: compared with wild strains, the delta mad1 obviously regulates and controls the transcription of linolenic acid metabolic pathway genes after acting on plants, and particularly shows that the transcription levels of MYC2, C74A2 and AOC4 genes are obviously reduced, the reduction times are respectively 0.66 time, 0.52 time and 0.49 time of wild strains, and the reduction times are respectively 0.74 time, 0.3 time and 0.64 time of lipoxygenase gene LOX31, LOXX and LOX 3. Only one gene, 4CLL5, appeared up-regulated in expression by a factor of 1.34. Deletion mutation experiments prove that mad1 can significantly up-regulate the transcription level of the main node gene of the linolenic acid metabolic pathway, thereby further promoting the biosynthesis of JA. An increase in JA in mycorrhizal plants may be a prerequisite for symbiotic formation of mycorrhiza. Mad1 may be used as signal molecule for plant microbe identification to strengthen the expression of linolenic acid metabolic pathway gene, so as to provide the basis for the biosynthesis of plant JA and promote the colonization of microbes.

The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the technical principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.

Sequence listing

<110> institute of plant protection of Chinese academy of agricultural sciences

Application of <120> Mad1 protein in regulation and control of fungal spore production and germination and plant linolenic acid metabolic pathway

<160> 11

<170> PatentIn version 3.5

<210> 1

<211> 711

<212> PRT

<213> Artificial Sequence

<400> 1

Met Lys Ser Ala Leu Ser Val Val Val Ala Ala Ala Gly Val Gln Gln

1 5 10 15

Ala Ser Ala Thr Phe Gly Leu Leu Gly Gly Gly Gly Ile Ser Phe Asn

20 25 30

Phe Gly Leu Asp Trp Ser Gly Ala Lys Thr Phe Pro Cys Pro Gly Asn

35 40 45

Val Val Asn Lys Cys Thr Pro Glu Gln Glu Asn Asp Trp Asp Trp Ser

50 55 60

Asp Val Ala Thr Gly Ser Leu Asn Thr Tyr Ala Gly Phe Asn Phe Gly

65 70 75 80

Gly Gly Trp Ser Cys Glu Ser Asn Phe Gly Lys Arg Gly Asp Ile Gln

85 90 95

Gly Arg Thr Phe Gly Leu Gly Lys Val Ile Ser Gly Ser Cys Asn Gln

100 105 110

Gly Asp Glu Ala Gly Leu Ser Ile Gly Val Gly Ala Ser Ala Gly Ile

115 120 125

Asp Ala Phe Ser Ile Asn Ser Phe Asp Met Ser Thr Glu Phe Asp Ala

130 135 140

Arg Leu Glu Phe His Tyr Asp Met Pro Asp Gly Ser Val Cys Lys Gln

145 150 155 160

Thr Ser Asp Cys Lys Arg Gly Gly Ser Thr Ile Val Asn Asn Gln Cys

165 170 175

Gly Gly Ala Lys Lys Val Arg Val Ile Tyr Pro Lys Gln Ile Ile His

180 185 190

Lys Gly Ile Ser Phe Ser Lys Lys Cys Lys Ile Ser Cys His Lys Ile

195 200 205

Lys Trp His Cys Gly Lys Pro Thr Pro Lys Pro Ser Thr Ser Val Leu

210 215 220

Thr Leu Pro Ser Thr Ser Thr Gln Val Ile Gln Thr Thr Pro Val Thr

225 230 235 240

Thr Leu Gln Thr Tyr Thr Thr Pro Ser Gln Gln Thr Thr Pro Glu Lys

245 250 255

Gln Thr Thr Ser Ser Lys Glu Thr Thr Thr Ser Ala Gln Gln Thr Thr

260 265 270

Pro Gly Lys Glu Thr Thr Pro Ala Gln Gln Thr Thr Pro Ser Lys Glu

275 280 285

Thr Thr Pro Val Gln Gln Thr Thr Ser Ser Lys Glu Thr Thr Pro Ala

290 295 300

Gln Gln Thr Thr Pro Gly Lys Glu Thr Thr Pro Ser Gln Glu Thr Thr

305 310 315 320

Ser Ala His Gln Thr Thr Pro Gly Lys Glu Thr Thr Pro Ala Gln Gln

325 330 335

Thr Thr Pro Ser Lys Glu Thr Thr Pro Ala Gln Gln Thr Thr Pro Gly

340 345 350

Lys Glu Thr Thr Pro Ala Gln Gln Thr Thr Pro Gly Lys Glu Thr Thr

355 360 365

Pro Ala Gln Gln Thr Thr Pro Gly Gln Gln Thr Thr Pro Ser Gln Pro

370 375 380

Thr Thr Ala Ala Thr Thr Thr Pro Ala Thr Thr Phe Val Thr Thr Tyr

385 390 395 400

Asp Thr Thr Ser Thr Val Phe Thr Thr Ser Thr Lys Thr Ile Thr Ser

405 410 415

Cys Gly Pro Glu Val Thr Glu Cys Pro Gly Lys Thr Gly Pro His Ile

420 425 430

Val Thr Val Thr Ile Pro Val Ser Thr Thr Ile Cys Pro Val Thr Glu

435 440 445

Thr Arg Thr Gln Ser Gln Gly Val Pro Thr Thr Val Ile Leu Pro Ser

450 455 460

Lys Ser Glu Thr Thr Ile Lys Glu Gln Pro Thr Pro Glu Gln Pro Thr

465 470 475 480

Gly Glu Lys Pro Asn Pro Val Thr Ser Gln Pro Pro Gln Ser Thr Gln

485 490 495

Thr Pro Pro Cys Pro Pro Val Val Pro Arg Cys Leu Asn Thr Phe Val

500 505 510

Asp Leu Lys Ala Lys Cys Ala Asp Asn Lys Asp Ala Ser Cys Phe Cys

515 520 525

Pro Asp Lys Asp Phe Val Lys Asn Ile Phe Asp Cys Ile Tyr Ala His

530 535 540

Gly Glu Ser Asp Asn Val Ile Ser Glu Ala Ile Ser Phe Phe Gln Gly

545 550 555 560

Ile Cys Gly Arg Tyr Ile Pro Glu Asn Pro Val Ile Ala Thr Gly Ala

565 570 575

Glu Thr Ile Thr Gln Ile Ile Thr Val Thr Gly Thr Pro His Ile Thr

580 585 590

Gln Val Pro Tyr Thr Thr Val Val Val Ala Thr Thr Ile Thr Glu Asn

595 600 605

Ser Ser Thr Gln Thr Ile Ser Thr Glu Val Thr Ile Pro Asn Ile Val

610 615 620

Met Pro Thr Pro Thr Gly Gly Val Pro Asn Gln Pro Pro Ala Thr Ala

625 630 635 640

Ser Val Pro Ala Gly Gln Asn Pro Pro Pro Val Thr Gly Gln Asn Pro

645 650 655

Pro Pro Ala Val Thr Asp Gln Ser Pro Pro Pro Ala Ile Thr Thr Gly

660 665 670

Thr Gly Gly Val Ile Pro Pro Lys Pro Thr Gly Ser Val Pro Val Thr

675 680 685

Ala Gly Ser Gly Arg Val Gly Ala Gly Leu Gly Met Val Leu Ala Val

690 695 700

Ala Ala Phe Val Ala Ala Leu

705 710

<210> 2

<211> 2136

<212> DNA

<213> Artificial Sequence

<400> 2

atgaagtctg ctctttctgt tgttgttgcc gctgccggcg tgcagcaggc ttctgctact 60

ttcggcctct tgggcggtgg tggcatttct ttcaattttg gtttggattg gtctggtgca 120

aagactttcc cttgccctgg caacgttgtc aacaagtgta ctcctgagca ggagaatgat 180

tgggactgga gtgacgttgc gactggctcc ctcaacacct acgctggctt caacttcggt 240

ggcggctggt cttgcgagag caactttgga aagcgaggtg atatccaggg ccgcactttc 300

ggtctcggaa aggtcatctc cggttcctgc aatcagggag atgaggctgg tctctccatt 360

ggtgttggtg ccagtgctgg tattgatgcc ttctccatta acagcttcga catgtcgacc 420

gagttcgacg cccgtctcga attccactac gatatgcctg acggaagtgt gtgcaagcag 480

acctcggatt gcaagcgagg tggatcgact attgtcaaca accagtgcgg cggtgctaag 540

aaggttcggg tcatctaccc caagcagatc atccacaagg gaatctcctt cagcaagaag 600

tgcaagattt cttgccacaa gatcaagtgg cactgcggca agcccactcc caagcccagc 660

acctctgttc tcacactgcc tagcacctct acccaggtga tccagactac tcctgtcacc 720

actctgcaga catataccac tccttctcag cagactactc ccgaaaagca gaccacttcc 780

agcaaggaga ctactacgtc tgctcaacag accactcctg gaaaggaaac cactcctgcc 840

cagcagacta ctcccagcaa ggagactacc cccgtccagc agaccacatc tagcaaggag 900

accacacctg ctcagcagac cactcctgga aaagagacca cccccagcca ggagactacg 960

tccgctcacc agacaacccc aggcaaggag acgactcccg cccagcagac cactcccagc 1020

aaggagacta ctcctgccca gcagactaca cctggaaagg agaccacgcc tgctcagcag 1080

actactcccg gcaaggagac tactcccgcc cagcagacca ctcctggaca gcagaccaca 1140

cccagccagc cgaccactgc cgccaccacc actcctgcca ctacgtttgt cactacctac 1200

gacaccacct ctaccgtctt cacgacctcc accaagacca tcacaagctg tggacctgaa 1260

gtcaccgagt gccctggcaa gactggacct cacattgtta ctgttactat ccctgtgagc 1320

accactatct gcccagttac ggagacccgt acccagtccc agggagtccc tacgactgtc 1380

attctgccct ccaagtctga gactaccatc aaggagcagc ccacccccga gcagcctacc 1440

ggtgagaagc ccaacccggt caccagccag cctcctcagt ctactcagac tcctccttgc 1500

cctcctgttg ttcccagatg tctcaacacc ttcgtggacc tcaaggccaa gtgcgcggac 1560

aacaaggatg cctcttgctt ctgcccagac aaggacttcg tcaagaacat cttcgactgc 1620

atttacgccc acggtgagag cgacaacgtc atctccgagg ctatctcctt cttccagggt 1680

atctgcggac gctacatccc tgagaacccc gtcattgcca ccggtgccga gaccatcacc 1740

cagatcatca ctgtcactgg tactcctcac atcacccagg ttccttatac cactgtcgtt 1800

gtcgctacca caatcaccga gaacagcagc acccagacca tctcgacgga ggtcaccatt 1860

cctaacatcg tcatgcctac tcccactggc ggtgtcccca accagccccc cgccaccgcg 1920

tctgttccag ctgggcagaa ccctcctcct gtcactggcc agaaccctcc cccagctgtg 1980

accgatcaga gccctccccc cgctatcacg acaggcactg gtggtgtgat tcctcccaag 2040

cccacgggct cagtgcctgt tactgccggc tctggacgtg tcggtgccgg cctgggcatg 2100

gtcctggccg tcgctgcttt cgtcgccgct ctgtaa 2136

<210> 3

<211> 2037

<212> DNA

<213> Artificial Sequence

<400> 3

cgggtcaatt ggggctgtcg aatcatgacg gaactgtcat tttcaggaac gttgcttttt 60

gtggcgcgac aattgccatt tttaggtgta cagcgttgaa gacccctgcc aatggtatcc 120

taacgtggcc gggtgcctgg gcctcgggct agtagttgta cctcgtcggt gagcaatccc 180

tttttcgtat ggctgcacca aaagcactcc gtcttgtaag ctaatcatct ggctgcaagt 240

gaactgaatg gccgacgggt agcgtcagcg gactttcgcc tgcatcccgc cttgtgtgag 300

agagtcgcat ccagcggttc cgtcgaacga ctgcatcttc cgacccagga gcagcgaatc 360

aaaccctcac tcgacgcgca gcgcagccac gcgattgccc atggtcgtcc cgtccaactg 420

ttcctagtcg cccggccttc agaccaagcc gcaggcctgg agccatgccc ctggtttcac 480

ggccgtagtc cggccccggt tctcaactca gaccgctcga cgacatggat tcgagattgc 540

aacaagcgcc atccaccaca ccaccgcttt acacagacca ccccacttgc caccaacgtc 600

tggctgtcat ggagtctggt gatggtcttg tctccatggc gtctttgtct gcaggcttca 660

gcatgtacat accgtatccc gtccacatgc gtcccaagga cgtgccctga agggcttctt 720

cggcaaagcc atcggtgcat gggcagccgt ccagaaaacc acaccccctg gtgtgttggc 780

gacaaaggga gcccgtgtaa gtgcaaggtg cgccgcccag agcatcgttg gaccagtcct 840

cgcccgccta gtatatagat gtcgtgacca cccgacactg ggctgctgcc ttgttacact 900

ctctcatcat ctttgtcttt accttttgtt tccttttcta tttccttttc gaggcattgc 960

tgtcttcgtc gtcctacagt cgaagtcatt cgtttccttc gactaccatt cgcttaatat 1020

cacaactggt ttttgatagt actttcatag tttacgtgct tgacatccaa caacacactc 1080

actatacttg ggatgcctca gcgaattcga taactgatat tgaaggagca ttttttgggc 1140

ttggctggag ctagtggagg tcaacaatga atgcctattt tggtttagtc gtccaggcgg 1200

tgagcacaaa atttgtgtcg tttgacaaga tggttcattt aggcaactgg tcagatcagc 1260

cccacttgta gcagtagcgg cggcgctcga agtgtgactc ttattagcag acaggaacga 1320

ggacattatt atcatctgct gcttggtgca cgataacttg gtgcgtttgt caagcaaggt 1380

aagtggacga cccggtcata ccttcttaag ttcgcccttc ctccctttat ttcagattca 1440

atctgactta cctattctac ccaagcatcc aaatgaaaaa gcctgaactc accgcgacgt 1500

ctgtcgagaa gtttctgatc gaaaagttcg acagcgtctc cgacctgatg cagctctcgg 1560

agggcgaaga atctcgtgct ttcagcttcg atgtaggagg gcgtggatat gtcctgcggg 1620

taaatagctg cgccgatggt ttctacaaag atcgttatgt ttatcggcac tttgcatcgg 1680

ccgcgctccc gattccggaa gtgcttgaca ttggggagtt cagcgagagc ctgacctatt 1740

gcatctcccg ccgtgcacag ggtgtcacgt tgcaagacct gcctgaaacc gaactgcccg 1800

ctgttctcca gccggtcgcg gaggccatgg atgcgatcgc tgcggccgat cttagccaga 1860

cgagcgggtt cggcccattc ggaccgcaag gaatcggtca atacactaca tggcgtgatt 1920

tcatatgcgc gattgctgat ccccatgtgt atcactggca aactgtgatg gacgacaccg 1980

tcagtgcgtc cgtcgcgcag gctctcgatg agctgatgct ttgggccgag gactgcc 2037

<210> 4

<211> 1954

<212> DNA

<213> Artificial Sequence

<400> 4

cagcttcgat gtaggagggc gtggatatgt cctgcgggta aatagctgcg ccgatggttt 60

ctacaaagat cgttatgttt atcggcactt tgcatcggcc gcgctcccga ttccggaagt 120

gcttgacatt ggggagttca gcgagagcct gacctattgc atctcccgcc gtgcacaggg 180

tgtcacgttg caagacctgc ctgaaaccga actgcccgct gttctccagc cggtcgcgga 240

ggccatggat gcgatcgctg cggccgatct tagccagacg agcgggttcg gcccattcgg 300

accgcaagga atcggtcaat acactacatg gcgtgatttc atatgcgcga ttgctgatcc 360

ccatgtgtat cactggcaaa ctgtgatgga cgacaccgtc agtgcgtccg tcgcgcaggc 420

tctcgatgag ctgatgcttt gggccgagga ctgccccgaa gtccggcacc tcgtgcatgc 480

ggatttcggc tccaacaatg tcctgacgga caatggccgc ataacagcgg tcattgactg 540

gagcgaggcg atgttcgggg attcccaata cgaggtcgcc aacatcctct tctggaggcc 600

gtggttggct tgtatggagc agcagacgcg ctacttcgag cggaggcatc cggagcttgc 660

aggatcgccg cgcctccggg cgtatatgct ccgcattggt cttgaccaac tctatcagag 720

cttggttgac ggcaatttcg atgatgcagc ttgggcgcag ggtcgatgcg acgcaatcgt 780

ccgatccgga gccgggactg tcgggcgtac acaaatcgcc cgcagaagcg cggccgtctg 840

gaccgatggc tgtgtagaag tactcgccga tagtggaaac cgacgcccca gcactcgtcc 900

gagggcaaag gaatagagta gatgccgacc gggaacgtct gacggtattg tgctaagcag 960

ttatgaattg agctgcggcg aattctggta actattcaag gtagactttt gtatttattt 1020

tgtctcaaga ttttatcaga cacgtgtatg ctacaatcga aaaaagctta ggaggaaata 1080

aaggagactt gaggagaagc tgaagggaaa aaatttatgc ctagtatcat tctacacgat 1140

ccttacgaaa aagcatgtgg acattacggc aatcttggag actaagagga tcacatggat 1200

attgtcggac tcgagtcttg agtgagcctg acacatgctc aacaaccagt taattgaaac 1260

gcagggctgg cattctgtaa tcttaatatt gaaatttcaa cgtttgcatt ttccacgact 1320

tgactttgtg aatgtttatc cccacgtcta tctagtagta tgtatctctt tgtcttgctt 1380

cccatgatac tggtaacttg tagtccaaga aggaggtcaa ggcctagttt ccgaagtcga 1440

ttccaaactc gtaccatggc caccatttct aattcgtcaa gttgcccaat ccacactaat 1500

caatgtgtga agaggactag agtaaaacaa acaagctata caaaacggca agaattgtct 1560

atggcggtag aacacgcata cgcaggtacc ttccacaagt cttgtaagta acatggcaaa 1620

cagcacactc tacagcttgg cagccgtgtc ttttctgtcc gcgcggtcct tgtccttgag 1680

cacccggcgc agtatcttgc cgctcgcgct cttgggaata gcgtcgacga attgcacacc 1740

gcccctgagc cacttgtgcc gcgccttgtg acgctccacg tgctcgcgga cggcggcggc 1800

gacttcctcg gcggagcggc cgtccgactc gcgggcccgg acgacaaagg ccttggggac 1860

ttcgccggcg cgcgggtccg ggacggggat gacggcgcag tcggacacga aggggtgcga 1920

gaggaggtgg gcttctagtt cggcgggggc aagc 1954

<210> 5

<211> 1402

<212> DNA

<213> Artificial Sequence

<400> 5

atggaagagt tgataatttc accttcttca tcttcatctc tagtttctac cacaactcca 60

tcatcatcaa caacacaaat gcttcaacaa aaccttcagt tccttctcca atcgcaacca 120

agctggtggg tctacgccat cttctggagc accacgaagg acgacaatgg caacctctac 180

ctagcttggg gtgaaggcca tttccaaggc aacaccacca aacacaccaa aacgcaacaa 240

caacacaacc aaaacgacgc cgaatggttc tacgtcatgt cgttgaccag aaccttcccc 300

atagcaaact cttcctcttc ttctctaccc ggtaaggctt ttgctttggg ttcagtcctt 360

tggctcaaca gcaaagaaga gcttcaattc tataactgcg agagagccaa agaagctcac 420

gctcacggca tcgaaacctt gatctgtatt ccaacctcaa acggcgtcgt tgagatgggt 480

tcttacaaca ccatccctca gaactggaac ctcatcaacc atgtcaagtc cgtcttcgaa 540

gactccatgg tcaacaacaa caacaataac aataaccact gtagcaataa caatctccac 600

agcacggttc agcaaatctt cgaggacaac gatgactttt ccttcgccga gatcagtttc 660

atggccggtc tcgaagaagg cagagaacaa ggcatttcac gaaagcaggc ggacgtaacc 720

gtccctttca acaaagaaag caaggattcg tacgccgagt cggagcactc agactccgac 780

tgtccttttc taaaaacaga aaatactgaa aataaaaaca aattagaagc tccaaagagc 840

aagagaggca ggaagccggt cctcaaccgc gaaacgccgg tgaatcacgt ggaggcggag 900

aggcaacgga gggagaaact aaaccaccga ttctacgcct tgcgagcggt ggttccgaac 960

gtttcgagga tggacaaggc ttctttattg tccgacgccg ttgcttacat caacgagttg 1020

aaggcgaaga tcaaagatct tgaatccgag aaagataact atcagcgcaa gaaaaaggtg 1080

aagctcgaat ccggtgatac tatggacaat caaagcacgg tgactaattc ctcaaccgta 1140

gtggatcaag agaaatgtag caatggcgtt gttgctgagg tggatgtgaa gatcataggg 1200

gacgatgcca tggttagggt tcaaagtgag aatgtgaatc acccaggtgc gagactcatg 1260

ggagcattga gggatatgga gtttcaagtt catcatgcta gcatgacttg tgtcaatgaa 1320

ttaatgcttc aagatgttgt tggaaaagtc cccagtggaa tcctcagaag tgaagagggt 1380

attcgatctg ctattctcat ga 1402

<210> 6

<211> 1590

<212> DNA

<213> Artificial Sequence

<400> 6

atggaggaag gaagagatat agatccaaga agtgggttct gcagctcaaa ctcagtgttc 60

tacagcaaaa ggaagccact tccacttcca cagaacccat ccttggacgt caccaccttc 120

atctcatcac acgcccacca tggcaggatc gccttcatcg acgccgccac cggcaaccac 180

ttcaccttcc accaactctg gcgagctgtg gacgccgtcg cctcctccct ctacgacatc 240

ggcatccgca agggcaacgt cgtcctcctc ctctccccaa acagcatcta cttccccgtc 300

gtctgcctgg ccgtcatgtc cctcggcgcc atcatcacca ccaccaaccc tctcaacacc 360

gccgccgaaa tccgcaagca aatcaacgac tccaagcctc gcatcgcctt caccatccct 420

cctctagcct cgaaaatcgc cgccgcctcc ccctcgctcc cgatcatcct catggaggcc 480

gacaccagca gcagcttccc ttcggccgtc accaccctca gccgcatgat ggagaaagaa 540

agcagctcaa gccgagtcaa agagcgagtc aaccaggacg acacggccac cctgctctac 600

tcttccggca ccaccgggcc cagcaagggc gtcgtgtctt ctcacctcaa cctcatggct 660

atggtgcaga tcgttctcgg cagattcaac atcgaggagg gccagacctt catctgcact 720

gtcccaatgt tccatatata cgggctggtg gcgtttgcga cgggacttct ggcggcgggg 780

gcgacaatcg tggtgctgtc aaagttcgag atgcacgaca tgttgtcggc gatagagagg 840

tacaaggcga cgtacctgcc gctggtgccg ccgattctgg tagcgatgct caacaacgcc 900

gacgcgatta agggaaagta cgatttgagg tctttgcatt cggtgctttc gggtggagcg 960

ccgctgagta aagaggtgat agaaggcttc gtggagaagt atccgaacgt gaccattctt 1020

cagggttatg gcttgacgga gtccaccgga gttggtgctt ccaccgactc cttggaagag 1080

agccgcaggt acggtacggc ggggctcctc tctccgggaa cccaggctaa gnggctcagg 1140

ggtcccacca tcatgaaagg ttatttcagt aacgaggaag caacagcgtc tacgcttgat 1200

tcagaaggat ggttaagaac aggggatgtt tgcttcatcg acaatgatgg cttcatattt 1260

attgtggata ggttgaaaga gctcatcaag tacaagggat atcaggtgcc tccagcagaa 1320

ctagaggcct tgttgctcac acatccagac attgctgatg ctgctgtcat tccgtttccg 1380

gataaggagg ctgggcagtt tccaatggca tatgttgtaa gaaaggctgg aagcagcatt 1440

tcggagaagg aagtcatgga ttttgtggca aaacaggtgg ctccatacaa gagaattaga 1500

aaggtcgctt ttatatcttc cgtacccaaa aatccatctg gcaagattct aaggagggat 1560

ctcatcaacc tcgcaacctc taaactctga 1590

<210> 7

<211> 1455

<212> DNA

<213> Artificial Sequence

<400> 7

atggcttcta ccactaccaa caagattatc aagaagccac tcagagcaat ccccggaacc 60

tacggccttc ccttcttcgg acccataaag gaccgccacg actacttcta ccaccaaggc 120

cgcgacaaat tcttcctctc caagatccaa aagtataact ccaccgtcat ccgtactaac 180

atgccacctg gccccttcat ctcctccgat ccaagagtca tagctctctt ggacgctgtt 240

tccttcccta tcctcttcga caactctaag gttgagaagc gcaacgttct tgacggcacc 300

ttcatgcctt ccacctcctt cacaggaggc taccgcgtct gcgcctacct cgacacccac 360

gagcccgccc acgccgcact caagagcttc tacatcagca ccatcgcctc ccggaagcaa 420

ctgtttcttc ctctcttccg caacgttgtt gacgaatgct tcactcaaat cgagaacaac 480

ctctcttcca aaactgcaac tgctaaccta aacgacgccg tctcctccgc ctccttcaac 540

ttcatgttcc gcctcttctg caacaataag gatcctgcgg agacgaacct aggttcagag 600

gggccgaagc tgtttgacac gtggctactg ttccagctgg caccactggc aacccttggg 660

ctgccgaaga tcttcaatta catagaggat ttcttgatcc gtacggttcc attcccagct 720

ttcctggcga aatcgagcta caagaagctc tacgaagcat tctcggcgaa cgcggggaag 780

cttgtagaag aagcagagaa ggccgggatc gaaagaagcg aagccattca caatataata 840

ttcacggcgg ggttcaacgc gtacggaggg ttaaagaacc agttcccaac cctcatgaag 900

tgggtgggtt tgggcggcga gaagctccac aaggaaatag cggcagaagt tagaagcgtc 960

gtgaaagaag aaggaggcat cacgataaac ggtgttgaga gaatgagttt ggtgaaatcc 1020

attgtgtatg aagctatgag gatagagcct gtagtgccgt accaatacgc caaggcgaga 1080

gaggacataa tagtaaatag ccacgacgac tcttttcaga tcaagaaagg ggagatgttg 1140

tttgggtatc aacccttcgc cacgaaggat tctagaatct tcgagaaggc ggaggagttt 1200

gtggccagga ggttcgttgg ggaggaaggg gagaggttgt tgaagtacgt ggtgtggtcg 1260

aacgggcctg aaacggagca gcccggaccg gagaacaagc agtgcccggg aaagaatctg 1320

gtgatactac tgtgcagggt gtttctggtg gaattcttct tgcgttatga tacttttgaa 1380

tttacataca aggatattgt tttgggtcca aatgttacca tcacttctct cactaaggcc 1440

tcttctacat tctga 1455

<210> 8

<211> 774

<212> DNA

<213> Artificial Sequence

<400> 8

atggcctcat caagctatgc tttgagaaca atccctgctt cttctattag gcctgctaac 60

acatcatcaa gatcaatttt cacagcccca cctaccaaat catcactctt accattcact 120

tcatcatcaa acacatcaat cactagaagc ctcaagctta actccacttt gccacactct 180

tcctacttca cttcagttcc taagaaatca ttctcttgca agagccaggc tgagtcatct 240

gaagctgcag agagggttca agaactgagt gtttatgaga tcaatgaacg tgaccgtgga 300

agccccattt accttagatt gagccagaaa actgtgaatt cccttggtga tcttgtaccc 360

ttcaccaaca agttgtacac tggagacttt caaaagcgca taggcataac agcaggtatc 420

tgcattttga tccaaaacaa agcagagaaa ggtggtgatc gttatgaagc aatatacagt 480

ttctactttg gtgactatgg ccacattgct gttcagggtc catacttgac ctatgaagac 540

acataccttg ctgtcacagg tggttctgga atctttgaag gtgtttcagg ccaagtcaag 600

cttcatcaaa ttgtgtaccc ttttaagatc ttgtacactt tctatcttaa gggtattaag 660

gatttgccaa aggagcttat tgtcgaaact gttgagccta acccttctgt tcaggcctct 720

gatgctgcta agaatcttga gccacatgct acaattccta gttttactga ctga 774

<210> 9

<211> 2568

<212> DNA

<213> Artificial Sequence

<400> 9

atgggctttt ttgggcaaac gataacaggc acagttgtgc ttatgcaaaa gaatgtgtta 60

gacattaata gcctaactag tgttgaaggg attgttgaca caggtttggg tggtttcact 120

tcaatagttg atactgttac ttccttcttg ggtcgttcag ttgctttcca gttgatcagt 180

tctgacatag ttgattctag cggaaaagga aaagttggga atacagctta tttaaaagga 240

gccattaaca atttgccaac tttgggagac aaacaaaatg cattcaaaat tgaattcgat 300

tatgatagta acgttgggat tccgggagca ttttacgtaa agaactatat gtcaaacgag 360

ttcttgctta ttagcttgac tcttgacgat attccaaata atgttggaac catccacttt 420

gtttgcaact cctggattta caatgccaaa aactatcaat ctgatcgcat tttcttcgcc 480

aacaatactt atctaccaag taagacacca agtgcactag tgtactacag agaattggaa 540

ttgaagaatc taagaggaga tggaactgga gaacgcaaag aatgggacag aatatatgat 600

tatgatgttt acaatgattt gggtgatcca gacaaaggtg tgcaatatgc tcgtcctgtt 660

cttggaggat cttctactta tccttaccct aggaggggta gaactggcag aaaaccaaca 720

aacacagatc ctaacagtga gagtaggagc agcagtatct atatcccaag agatgaaact 780

tttggtcact tgaaatcttc agacttccta gcttatggaa ttaaatcact atcccaggat 840

gtagtccctg ctttgaaatc agtgtttgac ataaatttca caccaaatga gtttgatagc 900

tttgacgatg tgtttgatct ctatgaagga ggaattcact tgcctactga tgtgtttaag 960

gaaattactc ctttgcctgt tgtcaatgaa cttcttagaa ctgacggtga agcattcctc 1020

aagttcccag tgcctaaagt tgttcaagtg agtaaatcag catggatgac tgatgaggaa 1080

tttgctagag agattattgc tggacttaat cctggtttga ttcgtgttct gcaagagttt 1140

ccaccaaaaa gtaaactgga tagtacagtc tatggtgatc atacttgtat aataaccaaa 1200

gaacagttag agcttaactt agatggactc acaacagatg aggctatcca cgggaagaaa 1260

ttgttcatct tggatcacca tgattcaata attccatatc taaggagaat aaactcaact 1320

cccacaaagg cctatgcatc aaggaccatt cttttcttga aaaatgatgg aactttgaag 1380

ccattggcca ttgagttaag tttgccacat cctcaaggag atcaatatgg tgttgttagc 1440

aatgtctact tgcctgcaat tgaaggtgtt gagagtgcta tttggttact tgccaaggct 1500

tatgttattg taaatgactc atgctttcat cagcttgtca gtcactggtt aaacacacat 1560

gcagtagttg aaccattcgt gattgcaaca aatagacagc tgagtgtgct tcatcctatt 1620

tataagcttc tacaacctca ttatcgcgac accatgaata taaattcact agcaaggtca 1680

tccctggtca acgcagatgg tattatagaa aaaacattct tgtggggaag gtatgcaatg 1740

gaaatgtcct ctgttattta caaggattgg gtttttacag accaagcatt gcctgcggat 1800

ctcatcaaaa gaggaatggc agtggaggat ccaagttccc ctcatggtgt ccgtctaata 1860

gtagaggact acccttatgc agttgatgga ctagacattt gggacgccat taaagcatgg 1920

gtccaagaat atgtatcaat atactatcca tcaaatgaca caattcagca agactctgaa 1980

ctccaatctt ggtggcatga aattgtcact gttggccatg gtgacaaaaa agatgctcct 2040

tggtggccaa caatgcaaac tcctcaagaa ctcatacaag tctgctctac cctaatatgg 2100

atcgcttcgg cgcttcatgc agcagttaat tttggacagt atccttacgg cggtttcatc 2160

ttgaaccgcc ccacgcttag tcggcgcttc atgccggaaa aaggaactcc ggaatatgat 2220

gagctctcaa cgaatgctca gaaggcttac ctgagaacaa taactcccaa gtttcaaact 2280

ctgattgatc tttctgttat tgaaatcctg tccaggcatg cttctgatga gtactattta 2340

gggcaaagag atagtgctga cttttggaca aatgatacaa gggcacaaga agcattcaag 2400

aggtttggaa caaatttggc taatgttgag ttgcaattgg ttcagaggaa caacaatgag 2460

actttgagga acagagttgg gcctgttacc atgccttaca ctttgcttta tccttcaagt 2520

gaagaaggct tgactttcag aggaatccct aatagtatct ctatctaa 2568

<210> 10

<211> 2598

<212> DNA

<213> Artificial Sequence

<400> 10

atgtcatttc tcttcaacaa gggtcaaaag atcaagggga ctgtggtgtt gatgcccaag 60

aatgtcttgg acttcgacac catatcctcc atccccaacg gtggcgttgc cggggcattc 120

gacggcctcc tcggcactgc cactgactta cttggccatg cagttgatga tctcactgcc 180

atctttagcc gccaaatttc gcttaagttg atcagtgcta ccaagactga tggaaaggga 240

aatgggaaaa ttggaaagga aacttatgta gagaatcatc ttccaacctt acccacattg 300

ggagcaaggc aagaagcatt cgatattcat tttgattatg atgccgagtt tggaattcca 360

gcagcatttt atctcagaag ctacatgcaa actgaattct tcctcgttag tgttactctt 420

gaagacgttc caaaccatgg aaccattcac tttgtttgca actcatgggt ctacaacttc 480

aaaaattaca aaaacgaccg catcttcttt atcaacaacg tgtttttacc cagtgaaaca 540

cctgctgcac tattgaagta cagaaaagaa gagttgcaga acttaagagg agatggaaca 600

ggggagcgca aagaatacga taggatttac gattatgatg tctacaatga tttaggtaat 660

ccagatcgtg gtgaaaagta ttctcgccca atccttggag gctcttccac ttatccctat 720

cctcgaagag ttagaactgg tagaaaacca accaaaaaag atcctaaaag tgagactcca 780

ccaagggaga cttatgttcc aagagacgaa aattttggtc acttgaaatc atctgacttc 840

ctcatatatg gaatcaaatc tttgtctcaa aacgtgttgc ctcttttcga atcgttgatc 900

ttcgatttag acttcacacc gaatgagttt gatagcttcg acgaagtacg agaactctac 960

gaaggaggag tcaaactgcc cacagatatg ctgagtaaaa ttagtccctt gccggcgctc 1020

aaagaaatat ttcggactga tggcgaacaa acactcaaat tcccaccacc tcatgtaatc 1080

agagttagca aatctgcatg gatgactgat gaagaatttg caagagaaat gcttgctggt 1140

gtaaatcctt gtgtgattcg acgtcttcaa gagttcccac cccaaagcac actagatgct 1200

accatctacg gtgaccaaaa cagtaaagtt tcaaaacaag agatggagac taacctagat 1260

gggctcacag tggaacaggc acttaatggt aatagattat tcatattgga ttaccatgat 1320

gccttcatgc catatctaga aaggatcaac aaaattgcaa aggcttatgc taccagaaca 1380

ttccttttct tgagtgagaa tgggaaattg aagccagttg ccattgagtt aagtttgcca 1440

catcctagtg gagatcaata tggtgctgtt agtaaagtca tcttgcctgc ttccgaaggt 1500

gttgaaagca caatttggct attggccaag gctcatgtaa ttgtcaacga ctcgtgttat 1560

catcaactca tgagccactg gttaaacaca cacgcagtta ttgagccatt tgccatagca 1620

acaaatagga atcttagtgt gcttcacccc attagtaaac tcctacaccc tcattatcgt 1680

gacaccatca acatcaacgg acttgctcgt caagcactaa tcaatgcagg tggcatcata 1740

gagcaatcat ttttgcctgg ccccaattcc atagagatgt cttcagctgt ttacaagaat 1800

tgggtattca cagaccaagc tttaccagct gatcttgtta agaggggatt ggccattcaa 1860

gatccttctt caccttatgg ccttaaccta gtgataaagg attaccctta tgcagttgat 1920

ggactagaga tatgggatgc aatcaagaca tgggtccaag actatgtttc tttgtactac 1980

ccttcagatg aagcagttaa gaaagattca gaactgcaag catggtggaa ggaagctgta 2040

gagaggggtc atgaagactt aaaagacaag ccatggtggc caaaaatgca aagcattgaa 2100

gaattgattc aatgctgctc tatcattata tggacggctt cggcgcttca tgccgccgtt 2160

aactttggac agtatccata tggaggttac atccttaacc gtccaactct aagtagaaga 2220

tggatcccgg agaagggaac taaagattat gatgagatgg tgaagaatcc tcaaaaggct 2280

tatttgggaa caatcacacc taagtatcag acccttgttg atctctcagt gattgagatt 2340

ttgtcaaggc atgcctctga tgaagtgtac cttgggcaga gggagaatcc taactggaca 2400

agtgactcaa gggcaatcca agctttcaac aagtttggga gcaagttggc agagattgag 2460

ggtaagatta aagaaaggaa caaggattcc agtttgagca atagggttgg accggttgaa 2520

cttccctata ctttgcttct tccttctagc actgaaggct taactttcag aggtatccct 2580

aacagtatct ccatctga 2598

<210> 11

<211> 2691

<212> DNA

<213> Artificial Sequence

<400> 11

atggctgcag ggacaaagag tgttatgcta gcgctcttgg atacattccc cctacatgta 60

catcataata atgcatctcc actctgccaa gaaaggagat taatgatgct ttcatgtatt 120

agtggtcgaa ccaacaacat agttagagcg aggcagaagc aaattgcacc gaccgtagtg 180

gcggctttga ttgagagtag tgagaagagg gatttgaaca caaccaccat aaccaagtta 240

actgccgatg ttgccgtgag aagtggtaac aacaacaaca ataacaatgt gtttgcaagc 300

aacatgaaaa ctcttgtcaa catttttagg cctactgttc aaccccacgc caacaaaggt 360

cttgttctcc agcttgttag ctctgatcaa cttggtccta atggtaagga ggcaaagttg 420

agcgaggaaa tagtgttgga gtggcccgaa aacgacgtcg tattgggagg tgaaggaagc 480

atcaacacct acaaagttga attctgtgtg gactctgact ttggagtacc tggagcagtt 540

gctgtcctta atcgctatga cagtgagttc ttcttggaca gcataaacat tcaacagcta 600

aatcttcatt ttccatgcaa gtcttgggtg cagcctgaaa ataaaattga tccccacaag 660

agaattttct tctttaacaa ggtgtatctc ccttttgaga caccaattgg attgaaacaa 720

gttagagaaa gagatctaag gcagatgaga ggcgatagta gagggcgtag aaaatcatgt 780

gacagaatat atgagtatga tgtgtataat gatttaggtg atcctgacaa gggagatgag 840

tatgaaaggc caacacttgg tggccaaaac aacccttatc ccacacgttg ccgcactgga 900

cgtccaccta ctagaattga ttcacatgcg gaatcaaggc ccagtggatc agagtcaata 960

tacgttccta gagatgagga actagcagac ataaagaagc atgaccttga tcgagcgaaa 1020

ttgattgcga ttgctaggaa cattgttcct gcattattag ataagatggg caatgaaggt 1080

gttctcaaca tccataactt catcagggag tcaaggcact ctcattctaa tttgggtggc 1140

actatagaag aactttttaa atttgatcct ccaaagatat tttcaagagg aaaatcacac 1200

tttttagaag atgatgaatt tggacgccaa gttctagcag ggctaaatcc tctcagtatt 1260

gaaaggctca aggttttccc accagtgagc aaattggatc cctgtaagtc agcactaaaa 1320

gaagaacaca ttatagacca catcgatggg atgtccatcc aacaggcatt ggaagacaac 1380

aagttgttca tattggacta tcatgatatc ttcctaccct ttgttgatcg aattaatgct 1440

cttgatgacc gcaaagctta tgcaaccacc acaattttct tcctcaccaa aatgggaact 1500

ctaaaagcca ttgctataca gcttgctctg ccgacaatgg atccaaacac ttcatccaag 1560

caagtgctca cacctcctgt agacaccacc accaaatggc tctggcaact tggcaaagct 1620

catgtttgct ctaatgatgc ttttgttcat acatatctgc accactggtt aagaatacat 1680

gcaactatgg aaccattcat aattgctgct catcgacaat tgagtgttat gcatcctata 1740

tacaagcttc tgcatcccca tatgcgttac acactcaaga caaacgccac agctcgtgag 1800

acactcatca acgccggagg tatcttagag actaacttca gtcctggaaa atattctatg 1860

cagatcactt ctgctgcata cagagattgg tggcaatttg accaagaagg tcttcctacc 1920

gatctaataa gaagaggctt agcggttcct gatgaatcac aaccacaagg tgttagatta 1980

gtcattgaag attatcccta tgcagctgat ggactcctca tatggtccag catagggaaa 2040

ttggtgaaga cttatgtgaa ccattactac aaagacgttg acgccatttc atctgactat 2100

gaacttcaat cttggtacaa agaattcatc aatctcggac accctgatca taaaaacgct 2160

agctggtggc ctaaactttc cacccctgaa aatctcatct ccatcttaac caccattatt 2220

tggattgtaa cagcacaaca tgccgtgttg aactttagcc aataccacta tggtggatat 2280

gttccaatgc ggccggcgtt gatgcgaaaa ctaattccca aggagggtga tcttgactac 2340

atagactttg tcatggatcc acagagatac tttgagtcat cacttccgag tttatctcaa 2400

gcagcaaagt tcatggctgt gactagcata ggctctgcgc actcgccgga agaggagtac 2460

ataggagaca gaaatgactt gtgttcttgg ttggaagagc ccgagatctt tgatgccttc 2520

aaacaatttt caatggaaat aaaaaatatt gagacagaga ttgagaaaag aaatgctgat 2580

aaaaaactta gaaacagatg tggtgttgga gttacaccat atgaattgct tatgccatgg 2640

tcagatcaag gggtcacagg aagaggggtg ccaaatagtg taacagctta a 2691

Claims (6)

1, b1 or b2 for reducing sporulation and/or germination rate of fungi:

or, the application of the substance b1 or b2 in inhibiting the expression level of linolenic acid metabolic pathway genes in plants;

b1, a substance that inhibits or reduces the Mad1 protein content in fungi;

b2, an agent that inhibits or reduces the expression of a nucleic acid encoding a Mad1 protein in a fungus or an agent that knocks out a nucleic acid encoding a Mad1 protein in a fungus;

the Mad1 protein is a protein shown in a) or b) as follows:

a) a protein consisting of an amino acid sequence shown in a sequence 1 in a sequence table;

b) a fusion protein obtained by connecting labels to the N end or/and the C end of the protein shown in the sequence 1 in the sequence table;

the fungus is Metarrhizium anisopliae;

the plant is peanut.

2. Use of the substance represented by b1 or b2 as claimed in claim 1 for the cultivation of a fungus with reduced sporulation and/or reduced germination, said fungus being Metarrhizium anisopliae.

3. A method of breeding a fungus with reduced sporulation and/or reduced germination comprising the step of reducing the amount of Mad1 protein of claim 1 in a recipient fungus to obtain a transgenic fungus; the sporulation amount and/or germination rate of the transgenic fungus is lower than that of the recipient fungus; the fungus is Metarrhizium anisopliae.

4. The method of claim 3, wherein: the method for reducing the content of the Mad1 protein in the receptor fungus according to claim 1 is realized by knocking out or inhibiting or silencing the encoding gene of the Mad1 protein in the receptor fungus according to claim 1;

the code gene of the Mad1 protein is a DNA molecule shown in sequence 2.

5. The method of claim 4, wherein: the substance for knocking out the coding gene of the Mad1 protein in the recipient fungus is a DNA molecule shown in a sequence 3 and a DNA molecule shown in a sequence 4.

6. A method for inhibiting the expression level of a linolenic acid metabolic pathway gene in a plant, comprising the steps of: a step of treating a plant with the transgenic fungus according to claim 3 or 4; the plant is peanut.

Images