CN112375824A

CN112375824A - Application of MSC as cervical cancer diagnosis, prognosis and/or treatment marker

Info

Publication number: CN112375824A
Application number: CN202011272202.3A
Authority: CN
Inventors: 焦薪霖; 张青; 崔保霞; 孔北华
Original assignee: Qilu Hospital of Shandong University
Current assignee: Qilu Hospital of Shandong University
Priority date: 2020-11-13
Filing date: 2020-11-13
Publication date: 2021-02-19
Anticipated expiration: 2040-11-13
Also published as: CN112375824B

Abstract

The invention particularly relates to the use of MSCs as markers for the diagnosis, prognosis and/or treatment of cervical cancer. Cervical cancer is a major threat to female health, the current cervical cancer early screening method mainly adopts HPV virus detection, but the cytological detection has obvious errors, and DNA methylation detection gradually becomes a novel diagnosis method for cervical cancer premalignant lesions. The research result of the invention shows that the MSC methylation has obvious difference between a diseased patient before cervical cancer and a healthy person, can be used as a marker for early screening of cervical cancer, provides the application of MSC as a marker for diagnosis, prognosis and/or treatment of cervical cancer, and has important significance for early detection of cervical canceration to develop treatment and reduce mortality.

Description

Application of MSC as cervical cancer diagnosis, prognosis and/or treatment marker

Technical Field

The invention belongs to the technical field of cervical cancer diagnosis markers, and particularly relates to application of MSC as a cervical cancer diagnosis, prognosis and/or treatment marker.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

Cervical cancer is the fourth most common cancer in women and the fourth leading cause of death in women. According to the latest global data issued by the International Agency for Research on Cancer, 569847 new cases of cervical Cancer were shared globally in 2018, and 311365 people died from cervical Cancer. Although HPV vaccination and early cervical cancer screening have become effective strategies to prevent the disease, there is still a high morbidity and mortality of the disease in low-to-medium income countries. Despite the significant improvement in survival rates of cervical cancer patients in china, there is still a gap compared to other developed countries.

Persistent infection with high-risk Human Papillomavirus (HPV) is considered to be a major cause of the development of cervical cancer. At present, the main method for clinically applied cervical cancer screening is cervical liquid-based cytology examination and HPV virus detection, but cytology detection is greatly influenced by human, the missed diagnosis probability is high, the HPV detection specificity is low, and the over-treatment limitation exists. In recent years, with the research on epigenetics, particularly, the maturation of DNA methylation detection technology, DNA methylation detection has become an emerging diagnostic method for detecting cervical cancer-precursor lesions as an early stage of cancer development. A number of methylated genes such as SOX1, PAX1, JAM3, EPB41L3, CADM1, MAL, etc. are also considered biomarkers for cervical cancer screening. In order to further improve the screening efficiency of cervical cancer, it is of great significance to explore and develop molecular markers which are more sensitive, effective, more stable, more convenient and more easy to apply to clinic.

Disclosure of Invention

In response to the research progress and the prior art, the inventor searches and consults a large amount of literature, screens 850k methylation sites by using a genome-wide methylation chip, combines pyrophosphate sequencing, and finally screens out a batch of genes which are specifically hypermethylated in cervical squamous cell carcinoma. Through detection, verification and analysis, the invention discovers for the first time that the methylation degree of the DNA of the MSC gene is gradually increased along with the aggravation of the pathological change degree of the cervix uteri, and the MSC gene is closely related to the cervical carcinoma stage, and can be used as a molecular marker for early screening of the cervical carcinoma.

Based on the research results, the invention provides the following technical scheme:

in a first aspect of the invention, there is provided the use of MSC genes as a marker for the diagnosis, prognosis and/or treatment of cervical cancer.

The nucleotide sequence of the MSC gene is as follows:

GCGGATTCTGGACTTGGGCGCCAACTCGTAGTCCACGCTCCCCGGGGTCAGCAGAGGGGCGCTCACGCTCTCGCCACCCACCTCGCTTTCTCACCCCGCGCTTCCCGGCCTGGGTTTTTAGTCTTCCTTGGAGCGCTCTCTGGCCTCCGCCTCCGCCAGGGAGCGGAAGGCGGAGACAGCGAGACTGGCCAGGGGGGAGGAAAGAGGACGCGTGTGGGCAAGGGGGACAACGGG(SEQ ID NO:1)。

according to the research result of the invention, the sequences are mostly located in CpG islands, and most of the CpG islands in the genome are located in a promoter region, an exon region and a first intron region. During the process of generating tumors, the abnormal hypermethylation of cytosine in a promoter CpG island and the hypomethylation of the whole gene cause the instability of the whole gene and the change of the expression profile of the gene, including the inactivation of cancer suppressor genes, the failure of transcription factors to be combined with DNA to suppress transcription and the like. According to the research conclusion of the invention, the methylation degree of the MSC gene is in positive correlation with the tumor development condition, and particularly in cervical cancer, the methylation rate of the MSC gene has obvious difference in different development stages of the cervical cancer. Therefore, the detection of the methylation degree of the MSC gene has important significance in the aspects of early tumor diagnosis, stage judgment, screening and development of antitumor drugs and other non-diagnostic purposes.

In a second aspect of the present invention, there is provided a method for early diagnosis of cervical cancer, which comprises detecting the methylation degree of the MSC gene in a uterine sample.

In a third aspect of the invention, a method for determining the staging of cervical cancer is provided, which comprises detecting the methylation degree of the MSC gene in a uterine sample.

In a fourth aspect of the invention, a method for screening an anti-cervical cancer drug is provided, the method comprising detecting the methylation degree of the MSC gene in an individual uterine sample after administration of the drug.

In a fifth aspect of the invention, a medicament for treating cervical cancer is provided, wherein the medicament comprises a demethylating agent.

In a sixth aspect of the present invention, there is provided a method for detecting MSC methylation degree, the method comprising the steps of: and obtaining DNA in a sample to be detected, carrying out methylation modification, and detecting the methylation degree of MSC in the sample to be detected through real-time quantitative methylation specificity PCR.

The beneficial effects of one or more technical schemes are as follows:

the inventor firstly discovers that the methylation degree of the MSC is related to the lesion degree of the cervical cancer through a large amount of search, reading, screening 850k methylation sites, sequencing by combining pyrophosphate, and measuring, verifying and analyzing, and can be used as a molecular marker for early screening of the cervical cancer. Proved by verification, the methylation degree of the MSC as a cervical cancer molecular marker has good specificity, and meets the requirement as a clinical diagnosis index.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1 shows the results of HE staining of a typical histopathological section on the methylation chip described in example 1;

wherein (a, D) CIN3 tissue; (B, E) cervical squamous carcinoma tissue; (C, F) normal cervical epithelial tissue; the magnification of A, B and C is 100 times; the magnification of D, E and F is 200 times.

FIG. 2 is a QMSP validation MSC methylation levels as described in example 1;

and detecting the methylation level of the MSC promoter region in normal tissues, CIN and CA tissues of the paraffin samples, wherein P is less than 0.001.

FIG. 3 is a graph showing the MSC methylation rates at each site in the N, CIN, CA tissues in pyrosequencing described in example 1;

n, CIN and CA respectively select typical representatives of 10 tissues.

FIG. 4 is a histogram of the relative methylation rates of MSCs in 7 sites of normal, cervical intraepithelial neoplasia, cancer tissues as described in example 1.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments according to the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.

As introduced in the background art, cervical cancer is an important factor threatening female health, optimizing the early diagnosis technology of cervical cancer has important significance for reducing the cervical cancer mortality, and in order to solve the above technical problems, the present invention provides the application of MSC gene as a marker for cervical cancer diagnosis, prognosis and/or treatment.

In a first aspect of the invention, there is provided the use of MSCs as a marker for the diagnosis, prognosis and/or treatment of cervical cancer.

Preferably, the information provided by the MSC as a marker comprises MSC expression level, mRNA expression level, protein expression level of the MSC expression level or MSC methylation and phosphorylation degree; further, the MSC methylation level.

According to the research results of the present invention, significant differences exist in the methylation degree of the MSC gene in cervical cancer samples with different degrees. The present invention samples and tests from multiple parts of uterine tissue, and the results show that the MSC methylation degree in uterine tissue of healthy people is very low, while the MSC methylation degree is obviously increased in the cervical cancer pre-lesion (CIN) stage, and is further increased in cervical Cancer (CA) sample. Because healthy volunteers and precancerous lesion stages have obvious MSC methylation change conditions, the MSC methylation change condition serving as an early diagnosis detection marker has important significance for early detection of the diseased condition, slowing down the development process of cancer and reducing the fatality rate.

Preferably, in the therapeutic agent, the demethylating agent is an agent that eliminates methylation of an MSC gene; further, the demethylating agent is an agent that improves the degree of methylation or an agent that inhibits the degree of methylation of a gene.

Preferably, the detection method comprises the following specific steps: extracting DNA of a sample to be detected, carrying out methylation modification, and detecting the methylation degree of the MSC by real-time quantitative methylation specificity PCR reaction, wherein beta-actin is used as an internal reference in the detection process.

Further, the primers and sequences in the detection process are as follows:

primers for MSC:

MF:GATTGGTTAGGGGGGAGGAAA(SEQ ID NO:2)

MR:ACAACCCCCCAAACTCCATCT(SEQ ID NO:3)；

primers for β -actin:

MF:TGGTGATGGAGGAGGTTTAGTAAGT(SEQ ID NO:4)；

MR:AACCAATAAAACCTACTCCTCCCTTAA(SEQ ID NO:5)。

in a specific embodiment of the above preferred embodiment, the method comprises the following steps:

(1) extracting DNA of a sample to be detected and carrying out methylation modification;

(2) real-time quantitative methylation-specific PCR amplification, beta-actin:

(3) using the formula: 2^{[Ct(β-actin)-Ct(target)]}X 10,000 calculate the degree of methylation of the sample gene.

(4) The PCR reaction conditions are as follows:

in order to make the technical solutions of the present invention more clearly understood by those skilled in the art, the technical solutions of the present invention will be described in detail below with reference to specific embodiments.

Example 1

First, MSC relevant information obtained by screening whole genome methylation chip

10 cases of normal cervical tissue, CIN3 tissue and cervical cancer tissue were collected, the content of epithelial cells (normal cervix) or neoplastic cells (CIN3 or cervical cancer) in the section was ensured to be > 30% (FIG. 1), 850k Methylation sites were screened using Illumina Infinium Methylation EPIC Bead genome-wide Methylation Chip, and differential DNA Methylation site screening was performed according to the method reported by comparative analysis of DNA Methylation data with RnBeads (Nat methods.2014).

Second, validation in patients with cervical normal epithelium-precancerous lesion-cancer

1. QMSP verification

Paraffin specimens of normal cervical-precancerous lesion-cancer patients are collected in obstetrics and gynecology department in Qilu hospital, wherein the paraffin specimens comprise 36 cases of normal cervical tissues, 36 cases of CIN and 85 cases of cervical squamous cell carcinoma. After DNA was extracted from the above-described samples, it was bisulfite-modified as a template for QMSP. The application value of the QMSP in early diagnosis and screening is further verified by QMSP. As the degree of pathology increased, the degree of methylation of MSCs increased progressively with a clear difference between diagnostic components, as shown in figure 2.

1. DNA extraction of paraffin tissue specimens

A patient paraffin-embedded Tissue specimen was taken, and after xylene alcohol dewaxing, DNA was extracted using a QIAamp DNA FFPE Tissue (Qiagen, Germany) kit to obtain 100. mu.L of DNA solution.

2. DNA methylation modification

2. mu.g of the DNA solution was taken and EZ DNA Methylation-Gold was used^TM(Zymo Research, USA) kit modification, and 30. mu.L of sulfite-modified DNA solution was finally obtained.

3. Construction and optimization of a real-time Quantitative Methylation Specific PCR (QMSP) reaction system:

1) real-time primer sequences:

primers for MSC:

MF:GATTGGTTAGGGGGGAGGAAA

MR:ACAACCCCCCAAACTCCATCT

primers for β -actin:

MF:TGGTGATGGAGGAGGTTTAGTAAGT

MR:AACCAATAAAACCTACTCCTCCCTTAA

2) optimization of real-time PCR reaction system:

real-time PCR reaction set kit from Power SYBR Green PCR Master Mix (ABI, USA)

TABLE 1 real-time PCR reaction System

The detection sensitivity, specificity, positive predictive value and negative predictive value of the detection method and the verification and evaluation of the clinical specimen detection application are improved.

2. Pyrosequencing validation

MSC methylation levels of MSCs were further quantified and verified by randomly selecting N (N-10), CIN (N-10), and CA (N-10) samples from DNA samples after sulfite modification of normal cervix, precancerous lesions, and cancer patients for pyrosequencing (fig. 3 and 4).

The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

SEQUENCE LISTING

<110> Qilu Hospital of Shandong university

Application of <120> MSC as cervical cancer diagnosis, prognosis and/or treatment marker

<130> 2010

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 234

<212> DNA

<213> MSC nucleotide sequence

<400> 1

gcggattctg gacttgggcg ccaactcgta gtccacgctc cccggggtca gcagaggggc 60

gctcacgctc tcgccaccca cctcgctttc tcaccccgcg cttcccggcc tgggttttta 120

gtcttccttg gagcgctctc tggcctccgc ctccgccagg gagcggaagg cggagacagc 180

gagactggcc aggggggagg aaagaggacg cgtgtgggca agggggacaa cggg 234

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<400> 2

gattggttag gggggaggaa a 21

<210> 3

<211> 21

<212> DNA

<213> Artificial sequence

<400> 3

acaacccccc aaactccatc t 21

<210> 4

<211> 25

<212> DNA

<213> Artificial sequence

<400> 4

tggtgatgga ggaggtttag taagt 25

<210> 5

<211> 27

<212> DNA

<213> Artificial sequence

<400> 5

aaccaataaa acctactcct cccttaa 27

Claims

Use of MSC as a marker for diagnosis, prognosis and/or treatment of cervical cancer.
2. The use of the MSCs as markers for the diagnosis, prognosis and/or treatment of cervical cancer according to claim 1, wherein the information provided by the MSCs as markers comprises the amount of MSCs expressed, the amount of mrnas expressed, the amount of their proteins expressed or the degree of MSCs methylation, phosphorylation.
3. The use of MSCs as diagnostic, prognostic and/or therapeutic markers for cervical cancer according to claim 2, wherein the degree of MSC methylation is.
4. A method for the early diagnosis of cervical cancer, comprising detecting the degree of MSC gene methylation in a uterine sample.
5. A method for determining the staging of cervical cancer, which comprises detecting the methylation degree of MSC genes in a uterine sample.
6. A method for screening an anti-cervical cancer drug, which comprises detecting the methylation degree of MSC genes in a uterine sample of an individual after administration of a drug.
7. The cervical cancer treatment drug is characterized by comprising a demethylation reagent.
8. The therapeutic agent for cervical cancer according to claim 7, wherein the demethylating agent is an agent for eliminating methylation of an MSC gene;

preferably, the demethylating agent is an agent that improves the degree of methylation or an agent that inhibits the degree of methylation of a gene.
9. A method of detecting MSC methylation levels, the method comprising the steps of: and obtaining DNA in a sample to be detected, carrying out methylation modification, and detecting the methylation degree of MSC in the sample to be detected through real-time quantitative methylation specificity PCR.
10. The method for detecting the methylation level of MSCs according to claim 9, wherein said method comprises the steps of: extracting DNA of a sample to be detected, carrying out methylation modification, and detecting the methylation degree of the MSC by real-time quantitative methylation specificity PCR reaction, wherein beta-actin is used as an internal reference in the detection process;

preferably, the primers and sequences in the detection process are as follows:

primers for MSC:

MF:GATTGGTTAGGGGGGAGGAAA

MR:ACAACCCCCCAAACTCCATCT；

primers for β -actin:

MF:TGGTGATGGAGGAGGTTTAGTAAGT；

MR:AACCAATAAAACCTACTCCTCCCTTAA。