CN116103406A - Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application - Google Patents

Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application Download PDF

Info

Publication number
CN116103406A
CN116103406A CN202310390823.9A CN202310390823A CN116103406A CN 116103406 A CN116103406 A CN 116103406A CN 202310390823 A CN202310390823 A CN 202310390823A CN 116103406 A CN116103406 A CN 116103406A
Authority
CN
China
Prior art keywords
gene
primer
epb41l3
sox1
squamous intraepithelial
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202310390823.9A
Other languages
Chinese (zh)
Other versions
CN116103406B (en
Inventor
倪晓龙
刘伟
董晨
丁聪聪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hangzhou Dian Biotechnology Co ltd
Original Assignee
Hangzhou Dian Biotechnology Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hangzhou Dian Biotechnology Co ltd filed Critical Hangzhou Dian Biotechnology Co ltd
Priority to CN202310390823.9A priority Critical patent/CN116103406B/en
Publication of CN116103406A publication Critical patent/CN116103406A/en
Application granted granted Critical
Publication of CN116103406B publication Critical patent/CN116103406B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A90/00—Technologies having an indirect contribution to adaptation to climate change
    • Y02A90/10—Information and communication technologies [ICT] supporting adaptation to climate change, e.g. for weather forecasting or climate simulation

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Immunology (AREA)
  • Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application thereof, which is designed to detect SOX1 and EPB41L3 genes in cervical exfoliated cells by methylation detection, so as to realize the effect of early screening the high-level squamous intraepithelial lesions and cervical cancer, realize the detection of the cervical high-level squamous intraepithelial lesions and cervical cancer lesions and detect a plurality of CpG sites of each target gene. Compared with single-target detection, the detection method has higher specificity and sensitivity and stronger persuasion.

Description

Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application
Technical Field
The application relates to the cervical cancer auxiliary detection field, in particular to a primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application thereof.
Background
Cervical cancer is the second most common cancer that is harmful to the life and health of women, next to breast cancer, and the age of onset of cervical cancer has tended to be younger in recent years. High-risk HPV persistent infection is the main cause of cervical cancer and precancerous lesions. In China, according to statistics of the world health organization International cancer research institute, about 11 ten thousand and 5.9 ten thousand new cases and death cases of cervical cancer in China in 2020 account for 18% and 17% of the new cases and death cases in the world respectively.
At present, cervical cancer screening methods mainly comprise cervical cytology and high-risk HPV detection, and the cytology examination is to judge the pathological changes of the cervix by observing the morphology of cervical exfoliated cells under a microscope, but the method needs to rely on the interpretation results of pathologists, the diagnosis results are greatly influenced by subjective factors, the accuracy is low, the repeatability is poor, the phenomena of missed diagnosis and misdiagnosis are easy to occur, the specificity of the method for lesions (namely CIN2+) of cervical intraepithelial neoplasia (cervical intraepithelial neoplasia, CIN) grade 2 and above is more than 90%, and the sensitivity is only 53% -81%. The high-risk HPV persistent infection is closely related to cervical precancerous lesions and occurrence of cervical cancer, and whether HPV infection can be used for primary screening of cervical cancer is judged by detecting DNA or mRNA of HPV, and the method belongs to etiology inspection. The HPV detection method has high sensitivity, but has poor specificity, the false positive rate is higher, whether the HPV is persistent infection or not can not be distinguished by single detection, most of the HPVs are disposable infection and cannot develop into cervical precancerous lesions or cervical cancers, and the HPV positive result easily causes unnecessary panic of the testee. In addition, colposcopic biopsy is a "gold standard" for current cervical cancer and precancerous lesion diagnosis, and invasive examination and treatment are required to determine the cancer risk of the patient based on HPV virus detection or cytological primary screening results, which is detrimental to the health condition and quality of life of women and results in a significant waste of medical resources.
DNA methylation, a common epigenetic modification in humans, is one of the most deeply studied epigenetic regulatory mechanisms. Gene methylation is closely related to the genomic stability and transcriptional silencing of tumor suppressor genes, and gene silencing by promoter hypermethylation is related to the occurrence and progression of human cancers, including cervical cancer. Gene methylation is an early event of tumor occurrence, and gene methylation detection gradually becomes an early screening means of various tumors, and researches show that the methylation of various genes is related to cervical cancer and can be used as a biomarker for cervical cancer screening.
More and more research focuses on the relationship of SOX1 promoter methylation to cervical cancer or squamous intraepithelial lesions. Cervical cancer and precursor lesions are generally thought to be caused by high-risk Human Papillomaviruses (HPV). At high risk HPV viral infection, the methylation level of SOX1 is significantly elevated. In cases without high risk HPV infection and SOX1 unmethylated events, the prevalence of cin2+ is very low. When one of the factors (HPV infection or SOX1 methylation) is present, the prevalence of cin2+ is slightly higher, but when both factors are considered at the same time, the prevalence of cin2+ is significantly increased. The real-time fluorescence PCR technology is widely used for molecular diagnosis of various diseases, but products for methylation detection of cervical cancer related genes based on the technology platform are few at present, and lack of sensitivity and specificity, so that in order to further improve the efficacy of cervical cancer screening, a specific, sensitive and clinically applicable molecular detection method needs to be developed.
Disclosure of Invention
The invention aims to provide a primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application thereof, and methylation detection is carried out on SOX1 and EPB41L3 genes in cervical exfoliated cells so as to realize the effect of early screening of the high-level squamous intraepithelial lesions and cervical cancer.
In a first aspect, the present solution provides a primer probe combination for detecting cervical high-grade squamous intraepithelial lesions, comprising a SOX1 primer probe combination for detecting methylation of a SOX1 gene, and an EPB41L3 primer probe combination for detecting methylation of an EPB41L3 gene, wherein the SOX1 primer probe combination comprises: the sequence is shown in SEQ ID NO:1, and the sequence of the SOX1 forward primer F is shown as SEQ ID NO:2, and the sequence of the SOX1 negative primer R is shown as SOX1 probe P shown as SEQ ID NO. 3; wherein the EPB41L3 primer probe combination comprises: EPB41L3 forward primer F shown in SEQ ID NO. 4, EPB41L3 reverse primer R shown in SEQ ID NO. 5, and EPB41L3 reverse primer R shown in SEQ ID NO: EPB41L3 probe P shown in FIG. 6.
The sequences of the EPB41L3 primer probe combination and the SOX1 primer probe combination are shown in the following Table one:
Figure SMS_1
in some embodiments, the SOX1 primer pair detects the No.79.82 locus of the SOX1 gene.
The SOX1 gene is as follows:
AAGACGGCGATTTCGATCGTCGGTTTTTTTGGTAAGTGGTTTGTGTATTAGGAGAAATTTTTTATTTGCGAGTCGAATCGGCGTCGAGTGCGTGTGTTTTTGTTTTTTTTTGTTGTCGTTGTTTTTATTTTTTTTTATTTTTTTTTTCGTTAGGATTTTTTCGTTTTCGTTTTATTTCGTTTGAATTTTTTTTCGTTTTTTTTTTATTTCGGTCGTTTATGTTTTAGGTTTTTTTTTCGCGGTGTCGGTGAATTCGTTAGTCGTTTCGATGTATAGTATGATGATGGAGATCGATTTGTATTCGTTCGGCGGCGTTTAGGTTTTTACGAATTTTTCGGGTTTCGTCGGGGCGGGCGGCGGCGGGGGCGGAGGCGGGGGCGGCGGCGGCGGCGGGGGCGTTAAGGTTAATTAGGATCGGGTTAAACGGTTTATGAACGTTTTTAT。
in some embodiments, the EPB41L3 primer pair detects the No.65.71.75 locus of the EPB41L3 gene.
The EPB41L3 gene is as follows:
GACTAGGGACGAGCAGAGAGGTGCTTTGAGGGGGACAGAGGGCTTGCGCCCGGTTTAAGCTGACCGGGATCGACCGCCTGCGCGCTGTGTTGGAGCTGCCGCGGAAGCCGGGCGCGGCGCCTCTGCGAACCCCAGAGCTAGTGCGCGGGGCCCGGCGAGCGCACCAGTCTTCGGTTCCTCGGAGCCCAAGGCCCTGGAGGACGTCATCCCTCTCCGCTCGGGCAACTCCTCCTCCGCCCCCTCTTGCCTCCACCCCTCCGCGCCGGCCGTTTAGCCTATTCCGAGACTCTGTGCTTTTGCCAGCGCGCGCTAGTTGCTGCTGTCACTCCCCTCCCCGCCCTCGCCGGAGTTGGAGCGACCTGGGGTCTGGCTCCCCGGTCCCGGC。
in some embodiments, the 5' end of the SOX1 probe P, EPB L3 probe P is fluorescently labeled with FAM; the 3 'end of the SOX1 probe P is marked by BHQ1, and the 3' end of the EPB41L3 probe P is marked by DABCYL. Of course, other fluorescent modifications may be selected for the 5' end of the probe, such as ROX/CY5 gene, etc., and quenching genes corresponding to the fluorescent genes selected for the 5' end, such as BHQ2/SQ1/TAMRA, etc., may be selected for the 3' end.
In some embodiments, the primer probe combination comprises an internal reference gene primer probe combination, the internal reference gene of the present scheme is selected to be an ATCB gene, wherein the internal reference gene primer probe combination comprises a sequence of SEQ ID NO:7, the forward primer F of the reference gene has a sequence shown in SEQ ID NO:8, and the sequence of the negative primer R of the reference gene is shown as a reference gene probe P shown as SEQ ID NO. 9. The reference gene selected in the scheme is ACTB gene.
The sequence of the internal reference gene primer probe combination is shown in the following table two:
exterior two internal reference gene primer probe combination
Figure SMS_2
In some embodiments, the 5' end of the reference gene probe P is modified with VIC; the 3' -end of the reference gene probe P is modified by TAMRA.
The sequence NCBI database numbers of the SOX1 gene detected in this scheme are NC_000013.11 and NC_000018.10, respectively, of the EPB41L3 gene.
In some embodiments, the primer probe combination that detects cervical high-grade squamous intraepithelial lesions detects SOX1 gene methylation and EPB41L3 gene methylation simultaneously.
In some embodiments, the primer probe combination for detecting cervical high-grade squamous intraepithelial lesions detects SOX1 gene methylation, EPB41L3 gene methylation, and the reference gene simultaneously, and the corresponding degree of gene methylation is determined by the difference between the SOX1 gene methylation and/or EPB41L3 gene methylation detection target Ct value and the reference Ct value of the reference gene.
In a second aspect, the present solution provides the use of the above mentioned combination of primer probes for detecting cervical high-grade squamous intraepithelial lesions for the preparation of a diagnostic reagent or kit for detecting cervical high-grade squamous intraepithelial lesions.
In a third aspect, the present invention provides a diagnostic reagent or kit for detecting cervical high-grade squamous intraepithelial lesions, comprising a primer probe combination as described above for detecting cervical high-grade squamous intraepithelial lesions.
In some embodiments, the diagnostic reagent or kit for detecting cervical high grade squamous intraepithelial lesions further comprises 10 x PCR Buffer, taq enzyme, dNTPs, nuclease-free water, positive controls and negative controls, wherein the positive controls comprise genomic DNA from human methylation; the negative control included 293T cell line DNA from human unmethylation.
Specifically, the diagnostic reagent or the kit for detecting cervical high-grade squamous intraepithelial lesions provided by the scheme comprises a SOX1 gene amplification system and an EPB41L3 gene amplification system, wherein the SOX1 gene amplification system comprises SOX1 PCR reaction liquid and Taq enzyme, and the SOX1 PCR reaction liquid comprises the following components in concentration: 1 XPCR Buffer, 0.5 mM dNTP, 0.5. Mu.M SOX1 forward primer F, 0.5. Mu.M SOX1 reverse primer R, 0.3. Mu.M SOX1 probe P, 0.1. Mu.M reference gene forward primer F, 0.1. Mu.M reference gene reverse primer R, 0.1. Mu.M reference gene probe P.
In some embodiments, the SOX1 gene amplification system is 30. Mu.L, and then the SOX1 gene amplification system is 30. Mu.L containing 14.3. Mu. L, taq enzyme, 0.7. Mu.L of SOX1 PCR reaction solution, and 15. Mu.L of the converted DNA template.
In some embodiments, the EPB41L3 gene amplification system comprises 1 XPCR Buffer, 0.5 mM dNTP, 0.5. Mu.M EPB41L3 forward primer F, 0.5. Mu.M EPB41L3 reverse primer R, 0.3. Mu.M EPB41L3 probe P, 0.1. Mu.M reference gene forward primer F, 0.1. Mu.M reference gene reverse primer R, 0.1. Mu.M reference gene probe P.
In some embodiments, the EPB41L3 gene amplification system is 30 μl, and the EPB4L3 gene amplification system comprises: EPB41L3 PCR reaction solution 14.3. Mu. L, taq enzyme 0.7. Mu.L, and DNA template 15. Mu.L after transformation.
In some embodiments, the DNA of the cervical exfoliated cells is extracted and sulfite converted, and the diagnostic reagent or kit for detecting cervical high-grade squamous intraepithelial lesions provided by the scheme is used for simultaneous detection of SOX1 gene and EPB41L3 gene.
In some embodiments, the SOX1 gene and EPB41L3 gene are detected simultaneously using fluorescent quantitative PCR techniques, the PCR amplification procedure is shown in table three below:
table three PCR amplification procedure
Figure SMS_3
And fluorescence was collected during 35 seconds at 55.5 ℃.
In some embodiments, when the CT value of the reference gene is.ltoreq.34, the methylation degree of each of the SOX1 gene and the EPB41L3 gene is calculated from the ΔCT values of the SOX1 gene and the EPB41L3 gene. The relation between the methylation degree and fluorescence value of the SOX1 gene and the EPB41L3 gene is:
delta Ct of SOX1 gene is more than 7, MI of SOX1 gene is less than or equal to 0, delta Ct is less than or equal to 5 and less than or equal to 7, MI of SOX1 gene is less than 1, delta Ct is less than 5, MI of SOX1 gene is less than 2;
the delta Ct of the EPB41L3 gene is more than 6, the MI of the EPB41L3 gene is less than or equal to 0, the delta Ct is less than or equal to 4 and less than or equal to 6, the MI of the EPB41L3 gene is less than 1, the delta Ct is less than 4, and the MI of the EPB41L3 gene is less than 2;
and adding the MI values of the 2 genes to obtain a total MI value, wherein the total MI value is more than or equal to 1, judging that the sample is positive for cervical cancer methylation, and judging that the sample is negative for cervical cancer methylation if the total MI value is less than 1.
When the CT value of the reference gene is more than 34, judging that the sample size is insufficient or the inhibitor exists, and the PCR reaction is invalid and repeating the experiment or sampling; the calculation formula of the delta Ct is=fam Ct-VIC Ct.
Compared with the prior art, the scheme has the following characteristics and beneficial effects:
(1) The proposal can detect a plurality of CpG sites of each target gene by detecting SOX1 and EPB41L3 gene methylation so as to realize the detection of cervical high-level squamous intraepithelial lesions and cervical cancer lesions. Compared with single-target detection, the detection method has higher specificity and sensitivity and stronger persuasion.
(2) The primer probe designed by the invention has high combination specificity and sensitivity, can stably detect 1% methylation rate, and can distinguish methylated DNA from unmethylated DNA.
(3) The kit adopts the human housekeeping gene ACTB as an internal standard, is used for quality control of clinical samples, avoids CpG sites of the gene when designing a primer probe, ensures that the clinical samples can stably detect the internal standard gene, and can better control the quality of the clinical samples.
Drawings
FIG. 1 is a schematic diagram of the sulfite conversion principle.
FIG. 2 is a graph showing methylation positive detection results of SOX1 gene and EPB41L3 gene in the examples of the present scheme.
FIG. 3 is a graph showing methylation negative detection results of SOX1 gene and EPB41L3 gene in the examples of the present scheme.
Detailed Description
The following description of the embodiments of the present invention will be made clearly and completely with reference to the accompanying drawings, in which it is apparent that the embodiments described are only some embodiments of the present invention, but not all embodiments. All other embodiments, which are derived by a person skilled in the art based on the embodiments of the invention, fall within the scope of protection of the invention.
It will be appreciated by those skilled in the art that in the present disclosure, the terms "longitudinal," "transverse," "upper," "lower," "front," "rear," "left," "right," "vertical," "horizontal," "top," "bottom," "inner," "outer," etc. refer to an orientation or positional relationship based on that shown in the drawings, which is merely for convenience of description and to simplify the description, and do not indicate or imply that the apparatus or elements referred to must have a particular orientation, be constructed and operated in a particular orientation, and therefore the above terms should not be construed as limiting the present invention.
Embodiment one:
1. design of primer probe combination:
in the present invention, the Primer and probe combinations are synthesized by the Bai Lig Biotechnology (Shanghai) Co., ltd, using the Methylprimer 2.0 and Primer Premier 5.0 software designs based on the human genome sequence disclosed by NCBI (national center for Biotechnology information).
The table of the primer probe combination designed by the scheme is shown in the following table IV:
surface four primer probe combination
Figure SMS_4
In the SOX1 probe P, EPB L3 probe P of the scheme, the 5 'end is preferably modified by FAM fluorescence, and the 5' end of the reference gene probe is preferably modified by VIC fluorescence; the 3' -end of the SOX1 probe P preferably employs a BHQ1 quenching group, the 3' -end of the EPB41L3 probe P preferably employs a DABCYL quenching group, and the 3' -end of the internal reference gene probe preferably employs a TAMRA quenching group.
2. And (3) designing a kit:
in addition to the primer probe combinations described above, 10 XPCR Buffer, taq enzyme, dNTPs, nuclease-free water, positive controls, and negative controls are included, the positive controls preferably including DNA from a human methylated cell line (wherein the methylation rate of SOX1 and EPB41L3 genes is 100%); the negative control preferably comprises DNA from a human non-methylated 293T cell line (where methylation rates of SOX1 and EPB41L3 genes are 0%).
Nuclease-free water, 10 XPCR Buffer, taq enzyme and dNTPs of this protocol are preferably purchased from Yu Luoshi diagnostic products (Shanghai) Inc.
The components of a particular kit are shown in table five below;
meter five kit
Figure SMS_5
3. The kit is used:
clinical samples were taken from dean diagnostic technologies group, inc., and 7 ASC-US (atypical squamous cells with no definitive diagnostic significance), 16 LSIL (low-grade squamous intraepithelial lesions) and 15 HSIL (high-grade squamous intraepithelial lesions) were selected.
(1) Collecting a cervical exfoliated cell specimen:
the cervical cells are brushed by the cervical cell brushing sheet and stored in a cell preservation solution, wherein the cell preservation solution is a cadia cell preservation solution, a Hao Luo Jie PreservCyt cell preservation solution and the like.
(2) Clinical sample (cervical exfoliated cells) genomic DNA extraction:
the sample is cervical exfoliated cells, the collected sample is fully oscillated for 1min, 0.5-1.5 ml of cell preservation solution is taken and centrifuged for 10min at 6000 rpm in a centrifuge tube, the supernatant is discarded, PBS is used for washing for 1-2 times, and about 200 mu L is reserved;
adding 350 μL guanidine salt lysate, mixing by vortex, standing for 10-15 min;
adding 40-50 μl of magnetic beads and 250 μl of absolute ethanol, mixing by vortex, and standing on 1000rpm oscillator for 30min;
centrifuging briefly, placing on a magnetic rack for 2min, and removing the supernatant with a 3ml suction tube;
adding 800 μl of lotion A, vortex mixing, centrifuging briefly, standing on a magnetic rack for 2min, and removing supernatant with a 3ml pipette; washing liquor A is guanidine salt solution;
adding 800 μl of lotion B, mixing with vortex, centrifuging briefly, standing on a magnetic rack for 2min, and removing supernatant with a 3ml pipette; adding 400 mu L of washing liquid B, mixing by vortex, centrifuging briefly, placing in a magnetic rack for 2min, and removing the supernatant by a 3ml suction pipe; wash solution B was 85% ethanol solution;
centrifuging briefly, removing supernatant, drying at 23deg.C for 8-10min, adding 50-55 μL of Elutation, and vortex oscillating at 23deg.C and 1000rpm for 10min;
taking out the centrifuge tube, centrifuging briefly, placing the centrifuge tube on a magnetic rack suitable for a 2mL centrifuge tube, adsorbing for 2-4min, and transferring the eluent containing DNA into a new centrifuge tube.
(3) The extracted DNA sample was sulfite converted and purified:
sulfite conversion step:
1. the constant temperature oscillating metal bath was set to: 80 ℃ for 45min without oscillation for standby; sequentially adding 150 μl sulfite solution, 25 μl DNA protective solution, and DNA sample (recommended DNA amount is 500-2000ng, adding the solution to 100 μl volume) into a 2ml centrifuge tube, vortex mixing, and centrifuging for a short time; place 2mL centrifuge tube containing reaction solution into a constant temperature shaker at 80 ℃ and incubate for 45min, note: the vibration is not needed;
bisDNA purification step:
2. the constant temperature oscillator is set as follows: the temperature is 23 ℃, the shaking speed is 45min and 1000rpm for standby; taking out a 2mL centrifuge tube filled with the converted reaction liquid, centrifuging briefly, sequentially adding 1mL of washing liquid A working liquid and 20 mu L of freshly oscillated magnetic beads, mixing uniformly by vortex, putting the 2mL centrifuge tube into a constant-temperature oscillator at 23 ℃, and incubating at 1000rpm for 45min;
3. taking out a 2mL centrifuge tube, performing short centrifugation, placing the centrifuge tube on a magnetic rack suitable for the 2mL centrifuge tube, standing for 2-4min, and washing out the supernatant by using a 3mL suction head;
4. adding 800L of washing liquid A working solution, uniformly mixing by vortex, placing the mixture on a magnetic rack suitable for a 2mL centrifuge tube by short centrifugation, standing for 2-4min, and washing the supernatant by a 3mL suction head;
5. adding 800 mu L of washing liquid B working solution, uniformly mixing by vortex, placing the mixture on a magnetic rack suitable for a 2mL centrifuge tube by short centrifugation, standing for 2-4min, and washing the supernatant by a 3mL suction head;
6. adding 400 mu L of washing liquid B working solution, uniformly mixing by vortex, placing the mixture on a magnetic rack suitable for a 2mL centrifuge tube by short centrifugation, standing for 2-4min, and washing the supernatant by a 3mL suction head;
7. centrifuging briefly, placing the solution on a magnetic rack suitable for a 2ml centrifuge tube, standing for 2-4min, and washing residual liquid at the bottom of the tube by using a 100 mu L/200 mu L pipette;
8. placing a 2mL centrifuge tube with magnetic beads on a constant temperature oscillator, drying at 23 ℃ for 8-10min, and injecting: too high a drying temperature and too long a drying time both lead to a substantial decrease in the recovery of bisDNA;
9. eluting: adding 60 μl of eluent (solution), shaking by vortex to fully re-suspend the magnetic beads, placing 2mL centrifuge tube into a constant temperature shaker at 23deg.C at 1000rpm for 10min;
10. taking out a 2mL centrifuge tube, briefly centrifuging, placing the centrifuge tube on a magnetic rack suitable for the 2mL centrifuge tube, adsorbing for 2-4min, transferring the eluent containing bisDNA into a new 1.5/2mL centrifuge tube, and storing the bisDNA at-20+/-5 ℃ for no more than 72h if the bisDNA is not used immediately.
(4) Taking the converted DNA as a template, carrying out PCR reaction by using the primer combination, and observing a fluorescence detection result:
the instrument used was ABI 7500, the reaction system was 30. Mu.L; wherein 15. Mu.L of the converted DNA template is taken for each of 15. Mu.L of the SOX1 amplification system and the EPB41L3 amplification system;
the PCR reaction procedure was set as shown in Table III
Table three PCR amplification procedure
Figure SMS_6
Fluorescence was collected during 35 seconds at 55.5℃without ROX correction, and the quenching group was selected from None.
4. Interpretation of the results:
the threshold value of each target (FAM channel) is 50000, the threshold value of the internal standard (VIC channel) is 25000, and Δct=fam Ct-VIC Ct, and the result judgment standard is shown in table six:
table six results interpretation criteria
Figure SMS_7
Clinical samples were tested, which included ASC-US (no explicit atypical cell change), LSIL (low-grade squamous intraepithelial lesions) and HSIL (high-grade squamous intraepithelial lesions), and compared to TCT liquid-based cytology test results, as shown in table seven:
comparative analysis of methylation detection technology and TCT method of epigenetic cervical cancer gene
Figure SMS_8
By detecting the methylation states of SOX1 and EPB41L3 genes of cervical exfoliated cells, the diagnosis sensitivity of the kit provided by the scheme to ASC-US is 100%, the diagnosis sensitivity to LSIL is 93.7%, and the diagnosis sensitivity to HSIL is 93.3%.
The present invention is not limited to the above-described preferred embodiments, and any person who can obtain other various products under the teaching of the present invention, however, any change in shape or structure of the product is within the scope of the present invention, and all the products having the same or similar technical solutions as the present application are included.

Claims (10)

1. A primer probe combination for detecting cervical high-grade squamous intraepithelial lesions, comprising a SOX1 primer probe combination for detecting SOX1 gene methylation, and an EPB41L3 primer probe combination for detecting EPB41L3 gene methylation, wherein the SOX1 primer probe combination comprises: the sequence is shown in SEQ ID NO:1, and the sequence of the SOX1 forward primer F is shown as SEQ ID NO:2, and the sequence of the SOX1 negative primer R is shown as SOX1 probe P shown as SEQ ID NO. 3; wherein the EPB41L3 primer probe combination comprises: EPB41L3 forward primer F shown in SEQ ID NO. 4, EPB41L3 reverse primer R shown in SEQ ID NO. 5, and EPB41L3 reverse primer R shown in SEQ ID NO: EPB41L3 probe P shown in FIG. 6.
2. The primer probe combination for detecting cervical high grade squamous intraepithelial lesions according to claim 1, wherein the SOX1 primer pair detects the No.79.82 locus of the SOX1 gene.
3. The primer probe combination for detecting cervical high grade squamous intraepithelial lesions according to claim 1, wherein the EPB41L3 primer pair detects the No.65.71.75 locus of the EPB41L3 gene.
4. The primer-probe combination for detecting cervical high-grade squamous intraepithelial lesions according to claim 1, comprising an internal reference gene primer-probe combination, wherein the internal reference gene is selected to be ACTB gene, and wherein the internal reference gene primer-probe combination comprises a sequence as set forth in SEQ ID NO:7, the forward primer F of the reference gene has a sequence shown in SEQ ID NO:8, and the sequence of the negative primer R of the reference gene is shown as a reference gene probe P shown as SEQ ID NO. 9.
5. Use of a primer probe combination according to any one of claims 1 to 4 for the detection of cervical high-grade squamous intraepithelial lesions for the preparation of a diagnostic reagent or kit for the detection of cervical high-grade squamous intraepithelial lesions.
6. A diagnostic reagent or kit for detecting cervical high-grade squamous intraepithelial lesions, comprising a primer probe combination according to any one of claims 1 to 4.
7. The diagnostic reagent or kit for detecting cervical high grade squamous intraepithelial lesions according to claim 6, comprising 10 x PCR Buffer, taq enzyme, dNTPs, nuclease-free water, positive controls and negative controls.
8. The diagnostic reagent or kit for detecting cervical high-grade squamous intraepithelial lesions according to claim 6, wherein the simultaneous detection of SOX1 gene and EPB41L3 gene is performed by fluorescence quantitative PCR technique after DNA of cervical exfoliated cells is extracted and sulfite converted.
9. The diagnostic reagent or kit for detecting cervical high grade squamous intraepithelial lesions according to claim 8, wherein the PCR amplification procedure is as follows:
Figure QLYQS_1
。
10. the diagnostic reagent or kit for detecting cervical high-grade squamous intraepithelial lesions according to claim 8, wherein when the CT value of the internal reference gene is 34 or less, the methylation degree of each of the SOX1 gene and the EPB41L3 gene is calculated from the Δct value of the SOX1 gene and the EPB41L3 gene.
CN202310390823.9A 2023-04-13 2023-04-13 Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application Active CN116103406B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202310390823.9A CN116103406B (en) 2023-04-13 2023-04-13 Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202310390823.9A CN116103406B (en) 2023-04-13 2023-04-13 Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application

Publications (2)

Publication Number Publication Date
CN116103406A true CN116103406A (en) 2023-05-12
CN116103406B CN116103406B (en) 2023-07-14

Family

ID=86260174

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202310390823.9A Active CN116103406B (en) 2023-04-13 2023-04-13 Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application

Country Status (1)

Country Link
CN (1) CN116103406B (en)

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110189653A1 (en) * 2008-03-21 2011-08-04 Wim Van Criekinge Detection and prognosis of cervical cancer
CN112375824A (en) * 2020-11-13 2021-02-19 山东大学齐鲁医院 Application of MSC as cervical cancer diagnosis, prognosis and/or treatment marker
CN113249485A (en) * 2021-06-24 2021-08-13 深圳市巨东生物医学工程有限公司 Primer probe combination and kit for methylation detection of cervical cancer related genes and application of primer probe combination and kit
CN114672568A (en) * 2022-04-27 2022-06-28 亚能生物技术（深圳）有限公司 Kit for detecting cervical cell gene methylation

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110189653A1 (en) * 2008-03-21 2011-08-04 Wim Van Criekinge Detection and prognosis of cervical cancer
CN112375824A (en) * 2020-11-13 2021-02-19 山东大学齐鲁医院 Application of MSC as cervical cancer diagnosis, prognosis and/or treatment marker
CN113249485A (en) * 2021-06-24 2021-08-13 深圳市巨东生物医学工程有限公司 Primer probe combination and kit for methylation detection of cervical cancer related genes and application of primer probe combination and kit
CN114672568A (en) * 2022-04-27 2022-06-28 亚能生物技术（深圳）有限公司 Kit for detecting cervical cell gene methylation

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
HELEN KELLY等: ""Performance of DNA methylation assays for detection of high-grade cervical intraepithelial neoplasia (CIN2+): a systematic review and meta-analysis"", 《BRITISH JOURNAL OF CANCER》, vol. 121, pages 954 - 965, XP036929380, DOI: 10.1038/s41416-019-0593-4 *
MEGAN A. CLARKE等: ""Discovery and validation of candidate host DNA methylation markers for detection of cervical precancer and cancer"", 《INTERNATIONAL JOURNAL OF CANCER》, vol. 141, no. 4, pages 2 - 3 *
谌媛媛等: ""宫颈脱落细胞中 PAX1 和 SOX1 基因甲基化对宫颈癌实验诊断的临床研究"", 《现代检验医学杂志》, vol. 37, no. 6, pages 46 - 51 *

Also Published As

Publication number Publication date
CN116103406B (en) 2023-07-14

Similar Documents

Publication Publication Date Title
CN110578001B (en) Detection kit for detecting methylation of cervical cancer related genes and use method thereof
CN110229908B (en) Primer, probe and kit for early detection of lung cancer gene methylation
CN110564857B (en) Composition and kit for early cervical cancer detection
CN105755169B (en) Detection and typing kit for high-risk human papilloma virus and application thereof
CN113249485B (en) Primer probe combination and kit for methylation detection of cervical cancer related genes and application of primer probe combination and kit
CN112646882B (en) Composition and diagnostic reagent for detecting cervical high-grade lesion and cervical cancer
US20130344479A1 (en) Method for early diagnosis of carcinomas of the anogenital tract
CN114672568B (en) Kit for detecting cervical cell gene methylation
CN112941189A (en) Primer probe composition and kit for methylation detection of cervical cancer early-screening molecular marker ZNF671 gene and using method
CN115820847A (en) Detection reagent for methylation of cervical cancer related genes and application thereof
CN111808962A (en) Kit for cervical cancer detection and use method
CN111793674A (en) Methylation detection method for cervical cancer related gene
CN116103406B (en) Primer probe combination for detecting cervical high-level squamous intraepithelial lesions and application
CN117089614A (en) Cervical cancer related gene DNA methylation PCR-fluorescent probe method detection kit
CN116555427A (en) Methylation gene combination, primer, probe and kit for early detection of cervical cancer
CN112391495A (en) High-risk human papilloma virus typing detection method and kit
CN113584225B (en) Primer and probe combination for detecting HPV (human papillomavirus) virus, typing detection reagent and application thereof
CN114214415A (en) Primer probe combination for methylation detection of cervical cancer related genes and application thereof
CN115976202A (en) Primer probe combination and kit for detecting methylation of cervical cancer related genes
CN106929601B (en) High-sensitivity human papilloma virus 6,11 type nucleic acid detection kit
RU2804110C1 (en) Set of oligonucleotide primers and probes for determining alleles of the rs55986091 polymorphism and method for its use
CN110904278A (en) 13 type high-risk HPV multiple fluorescence detection kit
CN114507730B (en) Application of reagent for detecting gene methylation in cervical cancer diagnosis and kit
CN115725734B (en) Application of ZNF781 gene in preparation of cervical cancer diagnostic reagent
CN114457156B (en) Primer and probe combination for methylation detection of cervical cancer, kit and use method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant