CN112322749A - Kit for simultaneously detecting STR locus and SNP locus and use method thereof - Google Patents
Kit for simultaneously detecting STR locus and SNP locus and use method thereof Download PDFInfo
- Publication number
- CN112322749A CN112322749A CN202011292726.9A CN202011292726A CN112322749A CN 112322749 A CN112322749 A CN 112322749A CN 202011292726 A CN202011292726 A CN 202011292726A CN 112322749 A CN112322749 A CN 112322749A
- Authority
- CN
- China
- Prior art keywords
- seq
- artificial sequence
- dna
- kit
- snp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Abstract
The invention discloses a kit for simultaneously detecting STR loci and SNP loci and a using method thereof, wherein the kit comprises specific amplification primers for amplifying the following 51 STR loci and 54 SNP loci. Compared with the prior art, the invention has the following advantages: (1) the kit can simultaneously detect 105 genetic markers including autosomal STR, Y chromosome STR and SNP genetic markers; the conventional STR typing method based on capillary electrophoresis is broken through, the types and the number of detected genetic markers are increased, and meanwhile, the base sequence can be analyzed, so that more genetic information data are provided for the identification of the genetic relationship and the difficult cases; (2) the kit improves the accuracy and sensitivity of a detection result; (3) by adopting the kit and the provided operation steps, the complex library construction process which takes longer time can be avoided, the enrichment degree of the target fragments is high, the non-specific fragments are few, and the high-throughput application of various genetic markers in the forensic field is realized.
Description
Technical Field
The invention belongs to the field of molecular biology, and relates to a kit suitable for high-throughput detection, in particular to a kit for simultaneously detecting STR loci and SNP loci and a use method thereof.
Background
Short tandem repeat loci (STRs) are currently a commonly used genetic marker. STR detection kit based on capillary electrophoresis technology has become the most common method for detecting STR genetic marker in forensic field at present. However, this technique has the following major drawbacks due to the limitations of the capillary electrophoresis technique: 1. a limited number of loci are detected; 2. DNA sequencing cannot be carried out to obtain real sequence information; 3. the sequence information of the SNP genetic marker cannot be detected. For major problems in forensic fields such as difficult cases, complex genetic relationship identification and the like, more STR genetic markers and even related SNP genetic markers need to be detected to obtain related clues.
With the development and application of high throughput sequencing technologies, the above problems are solved: 1. the number of detected loci can reach hundreds, hundreds or even more; 2. the STR sequence can be detected, and more variation information can be found; 3. the SNP genetic markers can be detected simultaneously, and more genetic information can be obtained. However, the STR locus contained in the current detection kit based on the second generation sequencing cannot meet the wide application requirements in the forensic field, and the Y-STR locus and SNP genetic markers contained in the detection kit are fewer, so that the application of cases is limited.
Disclosure of Invention
The technical problem to be solved is as follows: in order to overcome the defects of the prior art and obtain a kit which is suitable for a high-throughput sequencing technology and can simultaneously detect an STR locus and an SNP genetic marker, the invention provides a kit for simultaneously detecting the STR locus and the SNP locus and a using method thereof.
The technical scheme is as follows: the kit for simultaneously detecting STR loci and SNP loci comprises specific amplification primers for amplifying the following 51 STR loci and 54 SNP loci; wherein, the 51 STR loci are: amel, CSF1PO, D10S1248, D10S1435, D12S391, D13S317, D16S539, D18S51, D19S253, D19S433, D2S1338, D2S441, D3S1358, D3S3045, D6S1043, D8S1132, D8S1179, DYF387S1, DYS ab, DYS389I, DYS389II, DYS391, DYS437, DYS438, DYS443, DYS446, DYS448, DYS456, DYS458, DYS460, DYS508, DYS510, DYS520, DYS522, DYS527 567, DYS549, DYS552, DYS557, DYS570, DYS576, DYS596 622, DYS596, DYS635, DYS643, DYS 10, DYS 35th, a-3645, and gaox 3526 a; the 54 SNP loci are: rs1015250, rs1031825, rs10741584, rs10776839, rs1079597, rs1109037, rs11652805, rs1197062, rs13182883, rs13218440, rs1413212, rs1454361, rs1498553, rs1586861, rs16891982, rs1800414, rs1834619, rs192655, rs1979255, rs200354, rs2016276, rs2111980, rs214955, rs2593595, rs260690, rs2814778, rs2830795, rs 198 3213213214439, rs366178, rs3780962, rs3823159, rs3825663, rs3827760, rs4244304, rs 8842409, rs430046, rs4364205, rs4749305, rs 499148825, rs 18618664, rs 5757575961, rs 591, rs 10765659, rs 756251729780, rs 7572979, rs 75729780 and rs 927680 are numbered in the table of SNP.
Preferably, the sequence of the specific amplification primer is as follows: amel, SEQ ID NO. 1-2; CSF1PO, SEQ ID NO. 3-4; D10S1248 and SEQ ID NO. 5-6; D10S1435, SEQ ID NO. 7-8; D12S391, SEQ ID NO. 9-10; D13S317, SEQ ID NO. 11-12; D16S539, SEQ ID NO. 13-14; D18S51, SEQ ID NO. 15-16; D19S253, SEQ ID NO. 17-18; D19S433, SEQ ID NO. 19-20; D2S1338, SEQ ID NO. 21-22; D2S441, SEQ ID NO. 23-24; D3S1358, SEQ ID NO. 25-26; D3S3045, SEQ ID NO. 27-28; D6S1043, SEQ ID NO. 29-30; D8S1132, SEQ ID nos. 31-32; D8S1179, SEQ ID No. 33-34; DYF387S1, SEQ ID NO. 35-36; DYS385ab, SEQ ID NO. 37-38; DYS389I, SEQ ID NO. 39-40; DYS389II, SEQ ID NO. 41-42; DYS391, SEQ ID NO. 43-44; DYS437 and SEQ ID NO. 45-46; DYS438, SEQ ID NO. 47-48; DYS443, SEQ ID NO. 49-50; DYS446, SEQ ID NO. 51-52; DYS448, SEQ ID NO. 53-54; DYS456, SEQ ID NO. 55-56; DYS458, SEQ ID NO. 57-58; DYS460, SEQ ID NO. 59-60; DYS481, SEQ ID NO. 61-62; DYS508 SEQ ID NO. 63-64; DYS510, SEQ ID NO. 65-66; DYS520, SEQ ID NO. 67-68; DYS522, SEQ ID NO. 69-70; DYS527ab, SEQ ID NO. 71-72; DYS549, SEQ ID NO. 73-74; DYS552, SEQ ID NO. 75-76; DYS557, SEQ ID NO. 77-78; DYS570, SEQ ID NO. 79-80; DYS576, SEQ ID NO. 81-82; DYS596, SEQ ID NO. 83-84; DYS622, SEQ ID NO. 85-86; DYS635 and SEQ ID NO. 87-88; DYS643, SEQ ID NO. 89-90; DYS645, SEQ ID NO. 91-92; FGA, SEQ ID NO. 93-94; TH01, SEQ ID NO. 95-96; TPOX, SEQ ID NO. 97-98; Y-GATA-A10, SEQ ID NO. 99-100; vWA, SEQ ID NO. 101-102; rs1015250, SEQ ID NO. 103-104; rs1031825, SEQ ID NO. 105-106; rs10741584, SEQ ID NO. 107-108; rs10776839, SEQ ID NO. 109-110; rs1079597, SEQ ID NO. 111-112; rs1109037, SEQ ID NO. 113-114; rs11652805, SEQ ID NO. 115-116; rs1197062, SEQ ID NO. 117-118; rs13182883, SEQ ID NO. 119-120; rs13218440, SEQ ID NO. 121-122; rs1413212, SEQ ID NO. 123-124; rs1454361, SEQ ID NO. 125-126; rs1498553, SEQ ID NO. 127-128; rs1586861, SEQ ID NO. 129-130; rs16891982, SEQ ID NO. 131-132; rs1800414, SEQ ID NO. 133-134; rs1834619, SEQ ID NO. 135-136; rs192655, SEQ ID NO. 137-138; rs1979255, SEQ ID NO. 139-140; rs200354, SEQ ID NO. 141-142; rs2016276, SEQ ID NO. 143-144; rs2111980, SEQ ID NO. 145-146; rs214955, SEQ ID NO. 147-148; rs2593595, SEQ ID NO. 149-150; rs260690, SEQ ID NO. 151-152; rs2814778, SEQ ID NO. 153-154; rs2830795, SEQ ID NO. 155-156; rs321198, SEQ ID NO. 157-158; rs354439, SEQ ID NO. 159-160; rs366178, SEQ ID NO. 161-162; rs3780962, SEQ ID NO. 163-164; rs3823159, SEQ ID NO. 165-166; rs3825663, SEQ ID NO. 167-; rs3827760, SEQ ID NO. 169-170; rs4244304, SEQ ID NO. 171-172; rs4288409, SEQ ID NO. 173-174; rs430046, SEQ ID NO. 175-; rs4364205, SEQ ID NO. 177-178; rs4749305, SEQ ID NO. 179-180; rs4891825, SEQ ID NO. 181-182; rs4918664, SEQ ID NO. 183-; rs576261, SEQ ID NO. 185-186; rs595961, SEQ ID NO. 187-188; rs671, SEQ ID NO. 189-190; rs6875659, SEQ ID NO. 191-192; rs7251928, SEQ ID NO. 193-194; rs728404, SEQ ID NO. 195-196; rs735480, SEQ ID NO. 197-198; rs7520386, SEQ ID NO. 199-200; rs870347, SEQ ID NO. 201-202; rs881929, SEQ ID NO. 203-204; rs907100, SEQ ID NO. 205-206; rs987640, SEQ ID NO. 207-208; rs9905977, SEQ ID NO. 209-210.
Preferably, the concentrations of the specific amplification primers are as follows: the concentration of the specific amplification primers of the 51 STR loci is 0.01-0.1 mu M; the concentration of specific amplification primers for 54 SNP sites is 0.01-0.05. mu.M.
TABLE 1 specific amplification primer sequences and concentrations
Preferably, the 5' end of the specific amplification primer is connected with an anchor sequence, wherein the anchor sequence of the upstream primer is SEQ ID NO. 211: TACACGACGCTCTTCCGATCT, the downstream primer anchor sequence is SEQ ID NO. 212: CAGACGTGTGCTCTTCCGATCT are provided.
Preferably, the kit comprises a reaction buffer for premixing PCR amplification enzyme, positive control DNA and a sequencing joint; wherein the reaction buffer solution of the premixed PCR amplification enzyme comprises 1-5U Taq DNA polymerase and 2-10mM Mg2+0.2-1mM dNTP, 10-100mM Tris-HCl, 0.1-1mg/mL BSA, 0.01% -0.1% glycerol; the positive control is 9948 DNA; the sequencing joint is F501 and SEQ ID NO. 213; f502, SEQ ID No. 214; f503, SEQ ID NO. 215; f504, SEQ ID NO. 216; f505, SEQ ID No. 217; f506, SEQ ID No. 218; f507, SEQ ID NO. 219; f508, SEQ ID NO. 220; r701, SEQ ID NO. 221; r702, SEQ ID No. 222; r703, SEQ ID No. 223; r704, SEQ ID No. 224; r705, SEQ ID NO. 225; r706, SEQ ID NO. 226; r707, SEQ ID NO. 227; r708, SEQ ID No. 228; r709, SEQ ID NO. 229; r710, SEQ ID No. 230; r711, SEQ ID No. 231; r712 and SEQ ID NO. 232.
The sequencing joint is used for sample marking and sequencing, and the sample marking is used for distinguishing different samples. The sequencing adaptor comprises 8F sequences (No. 501-508) and 12R sequences (No. 701-712), and different F adaptor sequences and R adaptor sequences can be combined to carry out adaptor amplification for sample labeling and distinguishing different samples.
TABLE 2 sequencing linker sequences
The use method of the kit for simultaneously detecting the STR locus and the SNP locus comprises the following steps:
s1, targeted enrichment
Preparing a target enrichment reaction system according to the following volume ratio, premixing a reaction buffer solution of PCR amplification enzyme, namely a specific amplification primer, namely a sample 3:1:2, centrifuging the reaction system for a short time, and then placing the reaction system in a PCR instrument for amplification according to the following procedures: at 95 ℃ for 10 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃,30s, 8 cycles; at 95 ℃ for 30 s; 72 ℃,1min, 15 cycles; 72 ℃ for 5 min;
s2, target purification
Performing target purification by a magnetic bead method, adding water into each reaction product of S1 according to the volume ratio of a targeted enrichment reaction system to water being 3:7, adding magnetic beads into the targeted enrichment reaction system according to the volume ratio of purified magnetic beads being 3:8, uniformly mixing, standing at room temperature, placing on a magnetic frame, clarifying, and removing supernatant; adding 80% ethanol solution, keeping on a magnetic frame, standing at room temperature, discarding ethanol, and repeating the steps once; continuously placing the magnetic beads on a magnetic frame, completely removing residual ethanol, and drying in the air until the magnetic beads are cracked; then adding water, mixing uniformly, standing at room temperature until the mixture is clarified, and sucking the clarified solution into a new PCR tube;
s3 sequencing adaptor ligation amplification
Adding a reaction buffer solution of premixed PCR amplification enzyme and a sequencing adaptor into the target purified product of S2, placing the mixture into a PCR instrument after short-time centrifugation, and reacting according to the following procedures: at 95 ℃ for 10 min; at 95 ℃ for 30 s; at 66 ℃ for 30 s; 72 ℃,30s, 13 cycles; 72 ℃ for 5 min;
s4 library purification
Purifying the reaction product of S3 by a magnetic bead method, adding magnetic beads into the reaction product of S3, uniformly mixing, standing at room temperature, placing on a magnetic frame until the mixture is clarified, and removing the supernatant; adding 80% ethanol solution, keeping on a magnetic frame, standing at room temperature, discarding ethanol, and repeating the steps once; continuously placing the magnetic beads on a magnetic frame, completely removing residual ethanol, and drying in the air until the magnetic beads are cracked; then adding water, mixing uniformly, standing at room temperature until the mixture is clarified, sucking the clarified solution into a new PCR tube, and storing at-25 to-15 ℃;
s5, sequencing and data analysis
And (3) performing quantitative computer sequencing on the library, performing data comparison through data analysis software, and analyzing the detected 105 genetic marker information.
Has the advantages that: (1) the kit can simultaneously detect 105 genetic markers including autosomal STR, Y chromosome STR and SNP genetic markers; the conventional STR typing method based on capillary electrophoresis is broken through, the types and the number of detected genetic markers are increased, and meanwhile, the base sequence can be analyzed, so that more genetic information data are provided for the identification of the genetic relationship and the difficult cases; (2) the kit improves the accuracy and sensitivity of a detection result; (3) by adopting the kit and the provided operation steps, the complex library construction process which takes longer time can be avoided, the enrichment degree of the target fragments is high, the non-specific fragments are few, and the high-throughput application of various genetic markers in the forensic field is realized.
Detailed Description
The following examples further illustrate the present invention but are not to be construed as limiting the invention. Modifications and substitutions to methods, procedures, or conditions of the invention may be made without departing from the spirit and substance of the invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.
Example 1
In this embodiment, the kit is used for simultaneously detecting 22 DNA samples, and the specific operation steps are as follows:
preparation of targeting enrichment system
1. The following reagents were prepared in this kit: pre-mixing an amplification reaction solution, a specific multiplex primer pair, a positive control 9948DNA and water.
2. Each sample was formulated according to the following reaction system: pre-mixing an amplification reaction solution: 7.5 μ L, specific multiplex primer pair: 2.5. mu.L.
3. And adding 5 mu L of positive control into the positive sample reaction tube, adding 5 mu L of water into the negative reaction tube, and adding corresponding 5 mu L of extracted DNA into each sample reaction tube to be detected.
4. The system is prepared, is centrifuged for a short time and is put into a PCR instrument for the following reactions:
and (3) targeted enrichment amplification procedure: at 95 ℃ for 10 min; 8cycles (95 ℃,30 s; 60 ℃,30 s; 72 ℃,30 s); 15cycles (95 ℃,30 s; 72 ℃,1 min); 72 ℃ for 5 min.
Secondly, purifying the target spot
In this example, the magnetic bead method was used for target purification, and the steps were as follows:
1. adding 35 mu L of water into each reaction product, then adding 40 mu L of purified magnetic beads, fully and uniformly mixing, and standing at room temperature for 5 min;
2. placing on a magnetic frame for 5min until clarification; discarding the supernatant;
3. adding 80% ethanol with new configuration, keeping on a magnetic frame, and standing at room temperature for 30 s; discarding the ethanol;
4. repeating the step 3 once;
5. keeping the PCR tube on a magnetic frame all the time, discarding residual ethanol with a10 mu L suction head, and opening the cover to dry the magnetic beads until cracks just appear (not more than 5 min);
6. taking off the PCR tube from the magnetic frame, adding 26 μ L of water, mixing well, and standing at room temperature for 3 min;
7. placing on a magnetic frame for 3min until clarification, sucking 23 μ L to a new PCR tube, and marking the corresponding number.
Third, sequencing adaptor ligation amplification
1. The following reagents were prepared in this kit: 4 types of pre-mixed amplification reaction solution and joints F501-F504; the linkers R701-R706 are 6 in total.
2. Add to 23 μ L of target purified product per tube as described above: amplification reaction solution: 25 μ L, a linker F: 1 μ L, a linker R: 1 mu L of the solution; each combination of the linker F and the linker R corresponds to one sample, and 24 combinations are provided in total, specifically: the sample selection adapters F501 and R701 for positive samples, the sample selection adapters F501 and R702 for negative samples, the sample selection adapters F501 and R703 for No.1, the sample selection adapters F501 and R704 for No.2, the sample selection adapters F501 and R705 for No.3, the sample selection adapters F501 and R706 for No.4, the sample selection adapters F502 and R701 for No.5, the sample selection adapters F502 and R702 for No.6, the sample selection adapters F502 and R703 for No.7, the sample selection adapters F502 and R704 for No.8, the sample selection adapters F502 and R705 for No.9, the sample selection adapters F502 and R706 for No.10, the sample selection adapters F503 and R701 for No.11, the sample selection adapters F503 and R702 for No.12, the sample selection adapters F503 and R703 for No.13, the sample selection adapters F503 and R704 for No.15, the sample selection adapters F503 and R705 for No.16, the sample selection adapters F503 and R706 for No.17, the sample selection adapters F701 and R504 for No.18, the sample selection adapters F504 and R703 for sample selection adapters F19, the sample selection adapters F703 for No.19 and, sample No.21 selects adaptors F504 and R705, and sample No.22 selects adaptors F504 and R706; corresponding to 22 samples to be tested, 1 positive sample and one negative sample, and recording the name of the corresponding sample of each combination.
3. The system was prepared, centrifuged briefly, and placed in a PCR instrument for the following reactions.
The PCR parameters of the adaptor ligation amplification are as follows: at 95 ℃ for 10 min; 13cycles (95 ℃,30 s; 66 ℃,30 s; 72 ℃,30 s); 72 ℃ for 5 min.
Fourthly, library purification step
In this example, the magnetic bead method was used for target purification, and the steps were as follows:
1. adding 45 mu L of purified magnetic beads into each reaction product subjected to joint amplification, fully and uniformly mixing, and standing at room temperature for 5 min;
2. placing on a magnetic frame for 5min until clarification; discarding the supernatant;
3. adding 80% ethanol with new configuration, keeping on a magnetic frame, and standing at room temperature for 30 s; discarding the ethanol;
4. repeating the step 3 once;
5. keeping the PCR tube on a magnetic frame all the time, discarding residual ethanol with a10 mu L suction head, and opening the cover to dry the magnetic beads until cracks just appear (not more than 5 min);
6. taking off the PCR tube from the magnetic frame, adding 25 μ L of water, mixing well, and standing at room temperature for 3 min;
7. placing on a magnetic frame for 3min until clarification, sucking 22 μ L to a new PCR tube, and marking the corresponding number. The prepared library was stored at-15 ℃ to-25 ℃.
Fifthly, quantifying and sequencing
According to the requirements of an illumina sequencing instrument, library quantification is carried out, and the on-machine sequencing is carried out according to the using steps of the sequencing instrument.
Sixthly, data analysis
Sequencing data obtained by an illumina sequencing instrument are compared by data analysis software, and 105 genetic marker information detected by the kit is analyzed. In this embodiment, the detection result of one sample is as follows: the result display list carries out respective statistical analysis on all STR loci and SNP loci contained in the kit, obtains the core sequence information of the STR loci and gives the repetitive patterns of the repetitive units, and directly obtains the typing results of the STR; meanwhile, the typing result of the SNP locus is also given.
TABLE 3 STR typing results
TABLE 4 SNP site typing results
The operation flow and the result of the embodiment show that the high-throughput detection kit containing the STR and the SNP genetic markers provided by the invention can simultaneously detect dozens of STR genetic markers and dozens of SNP genetic markers, breaks through the conventional STR typing method based on capillary electrophoresis, increases the types and the number of the detected genetic markers, can analyze the base sequence, and provides more genetic information data for the identification of the genetic relationship and difficult cases; by adopting the kit and the provided operation steps, the complex library construction process which takes longer time can be avoided, the enrichment degree of the target fragments is high, the non-specific fragments are few, and the high-throughput application of various genetic markers in the forensic field is realized.
Sequence listing
<110> tin-free Zhongde-Mei-Bing Biotechnology Ltd
<120> kit for simultaneously detecting STR locus and SNP locus and using method thereof
<160> 232
<170> SIPOSequenceListing 1.0
<210> 1
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
atgaaatcaa cagaggcttg catgt 25
<210> 2
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gcccactgca gtccaatc 18
<210> 3
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
acagaagtct gggatgtgga 20
<210> 4
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 4
gcgttggtca aatctcctcc ttcaa 25
<210> 5
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
gtaggggtct aagagcttgt aaaaag 26
<210> 6
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
tgtttgtgtg tgcatctgta agcat 25
<210> 7
<211> 18
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
gaagggctgt gtttcagg 18
<210> 8
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 8
ggctgtgcgc tggtcttact c 21
<210> 9
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 9
attcctgtgg gctgaaaagc tc 22
<210> 10
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 10
aggcaaaatt caaagggtat ctg 23
<210> 11
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
gtaaatggca attcctactg gc 22
<210> 12
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
tgcctacatc cctagtacct agcat 25
<210> 13
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 13
gttgctaacc accctgtgtc tc 22
<210> 14
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 14
atttcctgtg tcagaccctg tt 22
<210> 15
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 15
aggaggttga ggctgcaaaa ag 22
<210> 16
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 16
gcacccatta cccgaataaa aatc 24
<210> 17
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 17
gataagaata atcagtatgt gacttgga 28
<210> 18
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 18
caaaggatag atagagacag gatagatg 28
<210> 19
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 19
tcagcctaag gtggacatgt tgg 23
<210> 20
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 20
gagttcttga gcccagaagg tta 23
<210> 21
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 21
tcatacagaa tggcactctt attcatc 27
<210> 22
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 22
ttgtatgagc cacttcccat 20
<210> 23
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 23
acctcatcct gggcaccctg g 21
<210> 24
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 24
aggcttgagg ccaaccatca g 21
<210> 25
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 25
gggctctttc tgcccacacg gc 22
<210> 26
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 26
tcactgtatc gtatcccat 19
<210> 27
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 27
gtgatagtag tttcttctgg tgaagga 27
<210> 28
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 28
ttcagcctcc atatcacttg agc 23
<210> 29
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 29
ggctgcaggg cataacatta 20
<210> 30
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 30
tcacggtctg aaatcgaaaa t 21
<210> 31
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 31
ttaagaccca cggccagaaa g 21
<210> 32
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 32
gttcactctc cttcccaaat gtt 23
<210> 33
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 33
catgaacaat cagtaaaaag caaacc 26
<210> 34
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 34
gcaactctgg ttgtattgtc ttcat 25
<210> 35
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 35
ttcctcattt tatttcggtc cct 23
<210> 36
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 36
cagaccttaa acttagaatt tctactt 27
<210> 37
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 37
agacagtggc ataaatcagg acc 23
<210> 38
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 38
tatgaggacg gttgacatct gc 22
<210> 39
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 39
agtggagatt acccctatgt gc 22
<210> 40
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 40
gtcaattcct ataataaatg ccctct 26
<210> 41
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 41
aactccagtg ttgaggaaca aatg 24
<210> 42
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 42
ccaagattgc accactgcac t 21
<210> 43
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 43
ctagattcca ttttacccct aacaag 26
<210> 44
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 44
tctgtgtatc agtgctggtg cc 22
<210> 45
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 45
aaggaaggag aaagaaagta aaaaaga 27
<210> 46
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 46
ctatctattc caattacata gtcctcct 28
<210> 47
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 47
gtatccaact ctcatctgta ttatctatg 29
<210> 48
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 48
gaacacaatt atccctgagt agcag 25
<210> 49
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 49
gtatccaact ctcatctgta ttatctatg 29
<210> 50
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 50
gaacacaatt atccctgagt agcag 25
<210> 51
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 51
tgtgagattt tgtctgtcca tttag 25
<210> 52
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 52
attgccatag agggataggt agg 23
<210> 53
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 53
catgcccatc cggtctacct a 21
<210> 54
<211> 29
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 54
gtagatagac atcattcaca gatgataga 29
<210> 55
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 55
gggaatagtt gaacggtaaa cagta 25
<210> 56
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 56
tttcagcctg ggcaacaaga 20
<210> 57
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 57
tgatccgctt ccatttacac tt 22
<210> 58
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 58
aaaagctcaa ggcatagttc aatt 24
<210> 59
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 59
gctcaattat tttcagtctt gtcct 25
<210> 60
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 60
gctgagcttg taccactgca ctca 24
<210> 61
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 61
gcttcaatgg agattagaaa tagaga 26
<210> 62
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 62
ggccggtctg gaaatttatc t 21
<210> 63
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 63
tctgttgtgg gaccttgtga taat 24
<210> 64
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 64
tgtgttcagt cactggttct tttatac 27
<210> 65
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 65
tggaggttac tgtgagtcaa gattg 25
<210> 66
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 66
ctcccaaagt tctggcatta caa 23
<210> 67
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 67
tcatctatcc tctgcctatc atttat 26
<210> 68
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 68
ggatttcttt tttcctctac cctga 25
<210> 69
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 69
aaggaatgtg gctaacgctg t 21
<210> 70
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 70
gccccacaac ccaagaagag 20
<210> 71
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 71
ctttatacaa tggcaatccc aaattc 26
<210> 72
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 72
agaacaaata aggtgggatg gatag 25
<210> 73
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 73
gaacaacaag ttagaaacaa agaagg 26
<210> 74
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 74
tatctatctg cctaatcatc catcc 25
<210> 75
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 75
ctcaggagtt agagaacagc ctgc 24
<210> 76
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 76
aagcaatttg ctttcctcaa cct 23
<210> 77
<211> 27
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 77
atagatgata gatgaataga taggcgg 27
<210> 78
<211> 25
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 78
tgtgctggaa gacagagtca taaac 25
<210> 79
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 79
gtagcaaaaa aggaaggaag aagg 24
<210> 80
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 80
agattagcca caacataagt aaggtagt 28
<210> 81
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 81
ggcataagtg gtaatgtccc ct 22
<210> 82
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 82
gcaattaggt aggtaaagag gaagat 26
<210> 83
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 83
ccatagtgcc gaggtcaagt t 21
<210> 84
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 84
catcaccaag tgtcccctag 20
<210> 85
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 85
gactattttt tctgtgccaa gcc 23
<210> 86
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 86
gttctaatgc accttgaggg atg 23
<210> 87
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 87
agaggagatt aggagcacag tgatac 26
<210> 88
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 88
aagctgaaat gcagatattc ccta 24
<210> 89
<211> 26
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 89
aacatagcaa gacctcatct ctgaat 26
<210> 90
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 90
atcagtatgg cagtctcatt tcct 24
<210> 91
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 91
tgacatgtac aggtccaaag gc 22
<210> 92
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 92
gtctaggtat gagatgaaat tgactatg 28
<210> 93
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 93
cactccagcc tcggtgataa 20
<210> 94
<211> 28
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 94
gtatgtccca gaaatgtagg tatgaaat 28
<210> 95
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 95
aaatgcccaa tggaatgctc t 21
<210> 96
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 96
caaggctcca tctcaaacaa ca 22
<210> 97
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 97
gtcattgaac ctcatgctct gtg 23
<210> 98
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 98
gcaggatggt gagggataaa a 21
<210> 99
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 99
gttctttggt tttggttacg gg 22
<210> 100
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 100
taccttccac acacgtccac tc 22
<210> 101
<211> 23
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 101
ctacctacct atccacctgc cat 23
<210> 102
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 102
atggagatag tgggtggatt gata 24
<210> 103
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 103
aaaaggttac taagtgatgg 20
<210> 104
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 104
tgtcgatact taggtggatt 20
<210> 105
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 105
attatggtcc ttaacctatt 20
<210> 106
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 106
agaaagtaac aatataggaa 20
<210> 107
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 107
ccatggggca tctagaagga 20
<210> 108
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 108
acataaggaa gttgtttctt 20
<210> 109
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 109
ccagagagag gggacccagt 20
<210> 110
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 110
cagacggcgt cgagacgatc 20
<210> 111
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 111
tatacatgat cctaagggca 20
<210> 112
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 112
tgcctctcct ccccgggtct 20
<210> 113
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 113
tggtgagggt ggagatttta 20
<210> 114
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 114
gctggaactc tggggcccaa 20
<210> 115
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 115
atggtcccta cccctcaaag 20
<210> 116
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 116
agtcctggtc cttctctcgg 20
<210> 117
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 117
cctgccaggc acaaaccatc 20
<210> 118
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 118
gggataactg aagttgtcgt 20
<210> 119
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 119
ccttctggcc tagtagaggg 20
<210> 120
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 120
tccttctttc attgcctctc 20
<210> 121
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 121
tctgctgtgg actgaaactt 20
<210> 122
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 122
caaccccgac gaactccatg 20
<210> 123
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 123
gctgcaacat tccattatcc 20
<210> 124
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 124
tcctccaaca actggtccta 20
<210> 125
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 125
gctgtccatc atcagtaaga 20
<210> 126
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 126
catccccagc atctgagata 20
<210> 127
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 127
agataaatca gaccaggatg 20
<210> 128
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 128
cttcacgact cttcccttct 20
<210> 129
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 129
ctggctcaga agtcagtcta 20
<210> 130
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 130
aaaaggtggt attctcgacg 20
<210> 131
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 131
gagagaaaga cttacaagaa 20
<210> 132
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 132
agcatctact ctttgagaca 20
<210> 133
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 133
tcccaacact gtcaggcatt 20
<210> 134
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 134
agacgtgttg gaagactgag 20
<210> 135
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 135
tgtggtatat gaatgatatc 20
<210> 136
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 136
tcccaggtgt acctttcgga 20
<210> 137
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 137
aaaactccag tagttattct 20
<210> 138
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 138
tctggggtat agggatctcg 20
<210> 139
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 139
tgaatcatag cttgtgttgg 20
<210> 140
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 140
gtaaactgga tttatggtag 20
<210> 141
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 141
ctgccttgga actgggctgc 20
<210> 142
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 142
acaaatcgtc gtaggagacc 20
<210> 143
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 143
ggaaattgta ccttgccact 20
<210> 144
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 144
ctccgaccct acgtttatga 20
<210> 145
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 145
gcaagatctt tgccagtgag 20
<210> 146
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 146
ttttacaaat gttgtaccga 20
<210> 147
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 147
tttattctgg cagcccttgg 20
<210> 148
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 148
ttcaactact tttagtacaa 20
<210> 149
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 149
acttctgcaa tactttcctg 20
<210> 150
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 150
tgcccgtagg tacccgtttc 20
<210> 151
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 151
tgtggccaac gtaaaagggc 20
<210> 152
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 152
tttcttaagt taaacgaaag 20
<210> 153
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 153
ccctgtccct gcccagaacc 20
<210> 154
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 154
tcgggaagac agacgcccgg 20
<210> 155
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 155
actgggttca cttctataga 20
<210> 156
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 156
cgagtaggac taagtctcgg 20
<210> 157
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 157
cctacacaca ggcttcaggt 20
<210> 158
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 158
ctaaagtgga catatttcac 20
<210> 159
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 159
gcaggttgcg atagaaaaca 20
<210> 160
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 160
ccctttctct tcggtggtct 20
<210> 161
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 161
acctcatgag gaaggaaatt 20
<210> 162
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 162
cttataaata acgtagttac 20
<210> 163
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 163
aacaaagaaa catgggatga 20
<210> 164
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 164
gcgatggcgt cttatgtgtg 20
<210> 165
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 165
gctgatacat gttatttctt 20
<210> 166
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 166
ttattaaaat tttaaagaaa 20
<210> 167
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 167
cccaggagga cctcggctgg 20
<210> 168
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 168
caccactagt ttttcctctt 20
<210> 169
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 169
atccctcttc aggccgaagc 20
<210> 170
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 170
cgtaagccga tcagaagagc 20
<210> 171
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 171
acacctgtct agaaggtagc 20
<210> 172
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 172
cctaagtgaa ctcagaaacc 20
<210> 173
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 173
tcaaggtcac ctgggggatg 20
<210> 174
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 174
cgtagactca cacggagtcc 20
<210> 175
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 175
acaaggtcat acaatgaatg 20
<210> 176
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 176
ctttattctt ctcgggtatc 20
<210> 177
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 177
agcaattcca gtcctagata 20
<210> 178
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 178
agtatcaacg gggtttgacc 20
<210> 179
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 179
ctactcctct gcagtctttc 20
<210> 180
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 180
aggaaccaaa cggtgaaaca 20
<210> 181
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 181
caactcacat aaaagtgtaa 20
<210> 182
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 182
ggatctctaa gggggaggga 20
<210> 183
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 183
agctatggtg gacacccaaa 20
<210> 184
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 184
aaccagtctt gagaacggta 20
<210> 185
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 185
tcaacctctt ttgtgcctcc 20
<210> 186
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 186
atagtagttg tttgtttgtt 20
<210> 187
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 187
gccaggggct tttgctcccc 20
<210> 188
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 188
cggtaacggt gtgggttagt 20
<210> 189
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 189
gtcggggagt ggccgggagt 20
<210> 190
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 190
ccccgagtcc cggacaaccc 20
<210> 191
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 191
catacacaca cacaggcaca 20
<210> 192
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 192
tcgtgcaaag atctcggtcc 20
<210> 193
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 193
ccactcagaa ttcccatctg 20
<210> 194
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 194
tcggagaacg gggtggggga 20
<210> 195
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 195
ggcctgccct tcagggccag 20
<210> 196
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 196
ccctttccga gatatttcta 20
<210> 197
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 197
gaccatgagt ttgaggtaag 20
<210> 198
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 198
tcgtctatct cccggttcca 20
<210> 199
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 199
tgaccaggac tgtacgtgtg 20
<210> 200
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 200
ccctgtctca gaagaaccca 20
<210> 201
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 201
gatctgtcag atcacatatc 20
<210> 202
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 202
tttttccaaa aggaaagggg 20
<210> 203
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 203
acccagtggt tctgagctct 20
<210> 204
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 204
ggtccatcga cctccccttt 20
<210> 205
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 205
ataacgattc tgaaggaaaa 20
<210> 206
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 206
acaaaaggtt ccgaaccttt 20
<210> 207
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 207
gaacttgttc attacaggta 20
<210> 208
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 208
ctgctaccgt acccgaatca 20
<210> 209
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 209
tcatgagctg gtgtccaagg 20
<210> 210
<211> 20
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 210
gagggaccga acagtcgaaa 20
<210> 211
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 211
tacacgacgc tcttccgatc t 21
<210> 212
<211> 22
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 212
cagacgtgtg ctcttccgat ct 22
<210> 213
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 213
aatgatacgg cgaccaccga gatctacact gaaccttaca ctctttccct acacgacgct 60
cttcc 65
<210> 214
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 214
aatgatacgg cgaccaccga gatctacact gctaagtaca ctctttccct acacgacgct 60
cttcc 65
<210> 215
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 215
aatgatacgg cgaccaccga gatctacact gttctctaca ctctttccct acacgacgct 60
cttcc 65
<210> 216
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 216
aatgatacgg cgaccaccga gatctacact aagacacaca ctctttccct acacgacgct 60
cttcc 65
<210> 217
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 217
aatgatacgg cgaccaccga gatctacacc taatcgaaca ctctttccct acacgacgct 60
cttcc 65
<210> 218
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 218
aatgatacgg cgaccaccga gatctacacc tagaacaaca ctctttccct acacgacgct 60
cttcc 65
<210> 219
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 219
aatgatacgg cgaccaccga gatctacact aagttccaca ctctttccct acacgacgct 60
cttcc 65
<210> 220
<211> 65
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 220
aatgatacgg cgaccaccga gatctacact agacctaaca ctctttccct acacgacgct 60
cttcc 65
<210> 221
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 221
caagcagaag acggcatacg agatcgtgat gtgactggag ttcagacgtg tgctcttc 58
<210> 222
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 222
caagcagaag acggcatacg agatacatcg gtgactggag ttcagacgtg tgctcttc 58
<210> 223
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 223
caagcagaag acggcatacg agatgcctaa gtgactggag ttcagacgtg tgctcttc 58
<210> 224
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 224
caagcagaag acggcatacg agattggtca gtgactggag ttcagacgtg tgctcttc 58
<210> 225
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 225
caagcagaag acggcatacg agatcactgt gtgactggag ttcagacgtg tgctcttc 58
<210> 226
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 226
caagcagaag acggcatacg agatattggc gtgactggag ttcagacgtg tgctcttc 58
<210> 227
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 227
caagcagaag acggcatacg agatgatctg gtgactggag ttcagacgtg tgctcttc 58
<210> 228
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 228
caagcagaag acggcatacg agattcaagt gtgactggag ttcagacgtg tgctcttc 58
<210> 229
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 229
caagcagaag acggcatacg agatctgatc gtgactggag ttcagacgtg tgctcttc 58
<210> 230
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 230
caagcagaag acggcatacg agataagcta gtgactggag ttcagacgtg tgctcttc 58
<210> 231
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 231
caagcagaag acggcatacg agatgtagcc gtgactggag ttcagacgtg tgctcttc 58
<210> 232
<211> 58
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 232
caagcagaag acggcatacg agattacaag gtgactggag ttcagacgtg tgctcttc 58
Claims (6)
1. The kit for simultaneously detecting STR loci and SNP loci is characterized by comprising specific amplification primers for amplifying the following 51 STR loci and 54 SNP loci; wherein, the 51 STR loci are: amel, CSF1PO, D10S1248, D10S1435, D12S391, D13S317, D16S539, D18S51, D19S253, D19S433, D2S1338, D2S441, D3S1358, D3S3045, D6S1043, D8S1132, D8S1179, DYF387S1, DYS ab, DYS389I, DYS389II, DYS391, DYS437, DYS438, DYS443, DYS446, DYS448, DYS456, DYS458, DYS460, DYS508, DYS510, DYS520, DYS522, DYS527 567, DYS549, DYS552, DYS557, DYS570, DYS576, DYS596 622, DYS596, DYS635, DYS643, DYS 10, DYS 35th, a-3645, and gaox 3526 a; the 54 SNP loci are: rs1015250, rs1031825, rs10741584, rs10776839, rs1079597, rs1109037, rs11652805, rs1197062, rs13182883, rs13218440, rs1413212, rs1454361, rs1498553, rs1586861, rs16891982, rs1800414, rs1834619, rs192655, rs1979255, rs200354, rs2016276, rs2111980, rs214955, rs2593595, rs260690, rs2814778, rs2830795, rs 198 3213213214439, rs366178, rs3780962, rs3823159, rs3825663, rs3827760, rs4244304, rs 8842409, rs430046, rs4364205, rs4749305, rs 499148825, rs 18618664, rs 5757575961, rs 591, rs 10765659, rs 756251729780, rs 7572979, rs 75729780 and rs 927680 are numbered in the table of SNP.
2. The kit for simultaneously detecting STR loci and SNP sites according to claim 1, wherein the specific amplification primers have the following sequences: amel, SEQ ID NO. 1-2; CSF1PO, SEQ ID NO. 3-4; D10S1248 and SEQ ID NO. 5-6; D10S1435, SEQ ID NO. 7-8; D12S391, SEQ ID NO. 9-10; D13S317, SEQ ID NO. 11-12; D16S539, SEQ ID NO. 13-14; D18S51, SEQ ID NO. 15-16; D19S253, SEQ ID NO. 17-18; D19S433, SEQ ID NO. 19-20; D2S1338, SEQ ID NO. 21-22; D2S441, SEQ ID NO. 23-24; D3S1358, SEQ ID NO. 25-26; D3S3045, SEQ ID NO. 27-28; D6S1043, SEQ ID NO. 29-30; D8S1132, SEQ ID nos. 31-32; D8S1179, SEQ ID No. 33-34; DYF387S1, SEQ ID NO. 35-36; DYS385ab, SEQ ID NO. 37-38; DYS389I, SEQ ID NO. 39-40; DYS389II, SEQ ID NO. 41-42; DYS391, SEQ ID NO. 43-44; DYS437 and SEQ ID NO. 45-46; DYS438, SEQ ID NO. 47-48; DYS443, SEQ ID NO. 49-50; DYS446, SEQ ID NO. 51-52; DYS448, SEQ ID NO. 53-54; DYS456, SEQ ID NO. 55-56; DYS458, SEQ ID NO. 57-58; DYS460, SEQ ID NO. 59-60; DYS481, SEQ ID NO. 61-62; DYS508 SEQ ID NO. 63-64; DYS510, SEQ ID NO. 65-66; DYS520, SEQ ID NO. 67-68; DYS522, SEQ ID NO. 69-70; DYS527ab, SEQ ID NO. 71-72; DYS549, SEQ ID NO. 73-74; DYS552, SEQ ID NO. 75-76; DYS557, SEQ ID NO. 77-78; DYS570, SEQ ID NO. 79-80; DYS576, SEQ ID NO. 81-82; DYS596, SEQ ID NO. 83-84; DYS622, SEQ ID NO. 85-86; DYS635 and SEQ ID NO. 87-88; DYS643, SEQ ID NO. 89-90; DYS645, SEQ ID NO. 91-92; FGA, SEQ ID NO. 93-94; TH01, SEQ ID NO. 95-96; TPOX, SEQ ID NO. 97-98; Y-GATA-A10, SEQ ID NO. 99-100; vWA, SEQ ID NO. 101-102; rs1015250, SEQ ID NO. 103-104; rs1031825, SEQ ID NO. 105-106; rs10741584, SEQ ID NO. 107-108; rs10776839, SEQ ID NO. 109-110; rs1079597, SEQ ID NO. 111-112; rs1109037, SEQ ID NO. 113-114; rs11652805, SEQ ID NO. 115-116; rs1197062, SEQ ID NO. 117-118; rs13182883, SEQ ID NO. 119-120; rs13218440, SEQ ID NO. 121-122; rs1413212, SEQ ID NO. 123-124; rs1454361, SEQ ID NO. 125-126; rs1498553, SEQ ID NO. 127-128; rs1586861, SEQ ID NO. 129-130; rs16891982, SEQ ID NO. 131-132; rs1800414, SEQ ID NO. 133-134; rs1834619, SEQ ID NO. 135-136; rs192655, SEQ ID NO. 137-138; rs1979255, SEQ ID NO. 139-140; rs200354, SEQ ID NO. 141-142; rs2016276, SEQ ID NO. 143-144; rs2111980, SEQ ID NO. 145-146; rs214955, SEQ ID NO. 147-148; rs2593595, SEQ ID NO. 149-150; rs260690, SEQ ID NO. 151-152; rs2814778, SEQ ID NO. 153-154; rs2830795, SEQ ID NO. 155-156; rs321198, SEQ ID NO. 157-158; rs354439, SEQ ID NO. 159-160; rs366178, SEQ ID NO. 161-162; rs3780962, SEQ ID NO. 163-164; rs3823159, SEQ ID NO. 165-166; rs3825663, SEQ ID NO. 167-; rs3827760, SEQ ID NO. 169-170; rs4244304, SEQ ID NO. 171-172; rs4288409, SEQ ID NO. 173-174; rs430046, SEQ ID NO. 175-; rs4364205, SEQ ID NO. 177-178; rs4749305, SEQ ID NO. 179-180; rs4891825, SEQ ID NO. 181-182; rs4918664, SEQ ID NO. 183-; rs576261, SEQ ID NO. 185-186; rs595961, SEQ ID NO. 187-188; rs671, SEQ ID NO. 189-190; rs6875659, SEQ ID NO. 191-192; rs7251928, SEQ ID NO. 193-194; rs728404, SEQ ID NO. 195-196; rs735480, SEQ ID NO. 197-198; rs7520386, SEQ ID NO. 199-200; rs870347, SEQ ID NO. 201-202; rs881929, SEQ ID NO. 203-204; rs907100, SEQ ID NO. 205-206; rs987640, SEQ ID NO. 207-208; rs9905977, SEQ ID NO. 209-210.
3. The kit for simultaneously detecting STR loci and SNP sites according to claim 1, wherein the concentrations of the specific amplification primers are as follows: the concentration of the specific amplification primers of the 51 STR loci is 0.01-0.1 mu M; the concentration of specific amplification primers for 54 SNP sites is 0.01-0.05. mu.M.
4. The kit for simultaneously detecting STR loci and SNP sites according to claim 1, wherein the 5' end of the specific amplification primer is connected with an anchor sequence, wherein the upstream primer anchor sequence is SEQ ID No.211, and the downstream primer anchor sequence is SEQ ID No. 212.
5. The kit for simultaneously detecting STR locus and SNP locus according to claim 1, which comprisesIs characterized in that the kit comprises a reaction buffer solution of premixed PCR amplification enzyme, positive control DNA and a sequencing joint; wherein the reaction buffer solution of the premixed PCR amplification enzyme comprises 1-5U Taq DNA polymerase and 2-10mM Mg2+0.2-1mM dNTP, 10-100mM Tris-HCl, 0.1-1mg/mL BSA, 0.01% -0.1% glycerol; the positive control is 9948 DNA; the sequencing joint is F501 and SEQ ID NO. 213; f502, SEQ ID No. 214; f503, SEQ ID NO. 215; f504, SEQ ID NO. 216; f505, SEQ ID No. 217; f506, SEQ ID No. 218; f507, SEQ ID NO. 219; f508, SEQ ID NO. 220; r701, SEQ ID NO. 221; r702, SEQ ID No. 222; r703, SEQ ID No. 223; r704, SEQ ID No. 224; r705, SEQ ID NO. 225; r706, SEQ ID NO. 226; r707, SEQ ID NO. 227; r708, SEQ ID No. 228; r709, SEQ ID NO. 229; r710, SEQ ID No. 230; r711, SEQ ID No. 231; r712 and SEQ ID NO. 232.
6. The method of using the kit for simultaneously detecting STR loci and SNP sites of any one of claims 1 to 5, wherein the method comprises the following steps:
s1, targeted enrichment
Preparing a target enrichment reaction system according to the following volume ratio, premixing a reaction buffer solution of PCR amplification enzyme, namely a specific amplification primer, namely a sample 3:1:2, centrifuging the reaction system for a short time, and then placing the reaction system in a PCR instrument for amplification according to the following procedures: at 95 ℃ for 10 min; at 95 ℃ for 30 s; 30s at 60 ℃; 72 ℃,30s, 8 cycles; at 95 ℃ for 30 s; 72 ℃,1min, 15 cycles; 72 ℃ for 5 min;
s2, target purification
Performing target purification by a magnetic bead method, adding water into each reaction product of S1 according to the volume ratio of a targeted enrichment reaction system to water being 3:7, adding magnetic beads into the targeted enrichment reaction system according to the volume ratio of purified magnetic beads being 3:8, uniformly mixing, standing at room temperature, placing on a magnetic frame, clarifying, and removing supernatant; adding 80% ethanol solution, keeping on a magnetic frame, standing at room temperature, discarding ethanol, and repeating the steps once; continuously placing the magnetic beads on a magnetic frame, completely removing residual ethanol, and drying in the air until the magnetic beads are cracked; then adding water, mixing uniformly, standing at room temperature until the mixture is clarified, and sucking the clarified solution into a new PCR tube;
s3 sequencing adaptor ligation amplification
Adding a reaction buffer solution of premixed PCR amplification enzyme and a sequencing adaptor into the target purified product of S2, placing the mixture into a PCR instrument after short-time centrifugation, and reacting according to the following procedures: at 95 ℃ for 10 min; at 95 ℃ for 30 s; at 66 ℃ for 30 s; 72 ℃,30s, 13 cycles; 72 ℃ for 5 min;
s4 library purification
Purifying the reaction product of S3 by a magnetic bead method, adding magnetic beads into the reaction product of S3, uniformly mixing, standing at room temperature, placing on a magnetic frame until the mixture is clarified, and removing the supernatant; adding 80% ethanol solution, keeping on a magnetic frame, standing at room temperature, discarding ethanol, and repeating the steps once; continuously placing the magnetic beads on a magnetic frame, completely removing residual ethanol, and drying in the air until the magnetic beads are cracked; then adding water, mixing uniformly, standing at room temperature until the mixture is clarified, sucking the clarified solution into a new PCR tube, and storing at-25 to-15 ℃;
s5, sequencing and data analysis
And (3) performing quantitative computer sequencing on the library, performing data comparison through data analysis software, and analyzing the detected 105 genetic marker information.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011292726.9A CN112322749B (en) | 2020-11-18 | 2020-11-18 | Kit for simultaneously detecting STR gene locus and SNP locus and use method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011292726.9A CN112322749B (en) | 2020-11-18 | 2020-11-18 | Kit for simultaneously detecting STR gene locus and SNP locus and use method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112322749A true CN112322749A (en) | 2021-02-05 |
| CN112322749B CN112322749B (en) | 2023-09-19 |
Family
ID=74322542
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011292726.9A Active CN112322749B (en) | 2020-11-18 | 2020-11-18 | Kit for simultaneously detecting STR gene locus and SNP locus and use method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112322749B (en) |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104212886A (en) * | 2014-07-25 | 2014-12-17 | 公安部物证鉴定中心 | Method and system for performing African, European and East Asian population genetic principal component analysis to unknown-source individual |
| CN106574263A (en) * | 2014-04-17 | 2017-04-19 | 哈佛学院院长及董事 | Methods and systems for droplet tagging and amplification |
| CN108517363A (en) * | 2018-03-08 | 2018-09-11 | 深圳华大法医科技有限公司 | A kind of individual identification system, kit and application thereof based on the sequencing of two generations |
| CN109777870A (en) * | 2018-11-07 | 2019-05-21 | 上海康黎医学检验所有限公司 | A kind of kit and its detection method for instructor's mental disease medication |
| CN110863056A (en) * | 2018-08-27 | 2020-03-06 | 深圳华大法医科技有限公司 | Method, reagent and application for accurately typing human DNA |
| CN111394477A (en) * | 2020-04-01 | 2020-07-10 | 公安部物证鉴定中心 | Reagent kit for detecting 120 gene loci based on second-generation sequencing technology and primer combination used by reagent kit |
| CN111500748A (en) * | 2020-06-04 | 2020-08-07 | 公安部物证鉴定中心 | Primer combination for detecting 617 SNPs and InDel and application thereof in forensic identification and genetic relationship identification |
-
2020
- 2020-11-18 CN CN202011292726.9A patent/CN112322749B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106574263A (en) * | 2014-04-17 | 2017-04-19 | 哈佛学院院长及董事 | Methods and systems for droplet tagging and amplification |
| CN104212886A (en) * | 2014-07-25 | 2014-12-17 | 公安部物证鉴定中心 | Method and system for performing African, European and East Asian population genetic principal component analysis to unknown-source individual |
| CN108517363A (en) * | 2018-03-08 | 2018-09-11 | 深圳华大法医科技有限公司 | A kind of individual identification system, kit and application thereof based on the sequencing of two generations |
| CN110863056A (en) * | 2018-08-27 | 2020-03-06 | 深圳华大法医科技有限公司 | Method, reagent and application for accurately typing human DNA |
| CN109777870A (en) * | 2018-11-07 | 2019-05-21 | 上海康黎医学检验所有限公司 | A kind of kit and its detection method for instructor's mental disease medication |
| CN111394477A (en) * | 2020-04-01 | 2020-07-10 | 公安部物证鉴定中心 | Reagent kit for detecting 120 gene loci based on second-generation sequencing technology and primer combination used by reagent kit |
| CN111500748A (en) * | 2020-06-04 | 2020-08-07 | 公安部物证鉴定中心 | Primer combination for detecting 617 SNPs and InDel and application thereof in forensic identification and genetic relationship identification |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112322749B (en) | 2023-09-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10704091B2 (en) | Genotyping by next-generation sequencing | |
| CN108517363B (en) | Individual recognition system based on second-generation sequencing, kit and application thereof | |
| CN107012225B (en) | STR locus detection kit and detection method based on high-throughput sequencing | |
| CN107829146B (en) | Primer group for constructing 16SrRNA gene amplicon sequencing library and construction method | |
| CN108018301B (en) | Method for determining core promoter of miR-27a gene and binding site of transcription factor Myod thereof | |
| CN107904317B (en) | Human autosomal STR polymorphic site composite amplification kit and application thereof | |
| WO2014127484A1 (en) | Spike-in control nucleic acids for sample tracking | |
| CN110643712A (en) | Five-color fluorescent STR typing method for synchronously detecting 22 gene loci and special kit thereof | |
| CN111893216A (en) | Product for detecting DNA/RNA by nucleic acid mass spectrum and detection method | |
| CN111286548A (en) | Kit for detecting 68 loci based on next-generation sequencing technology and primer combination used by kit | |
| CN112322749B (en) | Kit for simultaneously detecting STR gene locus and SNP locus and use method thereof | |
| CN110628882B (en) | Primer and kit for PCR amplification, method for detecting MSI state and application | |
| CN114480578B (en) | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method | |
| CN113913530B (en) | Molecular marker related to sheep body height and application thereof | |
| CN105886494B (en) | A kind of amplification influenza A virus full-length genome kit and preparation method and application | |
| CN112064122B (en) | Library construction method for detecting endometrial cancer related gene mutation based on high-throughput sequencing | |
| CN113969307A (en) | DNA methylation sequencing library, preparation method and DNA methylation detection method | |
| CN114774409A (en) | Secondary sequencing detection system based on 224 InDel and 57 SNP sites | |
| CN114134212A (en) | Primer probe combination and kit for plasmid quantification | |
| CN113817723A (en) | Polynucleotide and standard substance, kit and application thereof | |
| CN112553349A (en) | Identification primer, probe, kit and method for homozygote and heterozygote of Hulunbel short-tailed sheep | |
| CN105695575A (en) | Multicolor fluorescence composite detection method and kit for 55 SNP loci | |
| AU2019359771A1 (en) | Barcoding of nucleic acids | |
| CN114085895B (en) | Detection primer for rapidly detecting MSI and kit thereof | |
| CN116144743A (en) | Primer, kit and method for simultaneously realizing SNP (single nucleotide polymorphism) typing of multiple homologous sequences based on combination of multiple long PCR (polymerase chain reaction) and high-throughput sequencing |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |