CN114480578B - Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method - Google Patents
Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method Download PDFInfo
- Publication number
- CN114480578B CN114480578B CN202210335789.0A CN202210335789A CN114480578B CN 114480578 B CN114480578 B CN 114480578B CN 202210335789 A CN202210335789 A CN 202210335789A CN 114480578 B CN114480578 B CN 114480578B
- Authority
- CN
- China
- Prior art keywords
- dna
- artificial sequence
- primer
- primer set
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method, and relates to the technical field of genome sequencing. The primer set includes: at least two primer sets, the primer sets comprising 101 pairs of primers as shown in SEQ ID NOS.1-202. The primer set and the high-throughput sequencing method greatly simplify the operation steps, can obtain higher sequencing depth under the condition of meeting the requirement of less data volume, and reduce the sequencing cost. High throughput sequencing requirements can be met even for low quality FFPE samples.
Description
Technical Field
The invention relates to the technical field of genome sequencing, in particular to a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method.
Background
Mitochondria are important organelles in cells that provide energy metabolism, and are central in biological energy conversion and metabolism. Mutations in mitochondrial DNA (deoxyribonucleic acid) in human somatic cells cause oxidative phosphorylation and abnormal energy supply, leading to the development of over 150 human diseases, such as cardiovascular disease, deafness, neurodegenerative disease, aging, and the like.
Mutations of mitochondrial DNA include insertion/deletion of large fragments, insertion/deletion of small fragments, point mutations, and the like. Mutations may occur in coding regions or in non-coding regions. There are few or more techniques that require rapid capture of mitochondria and high throughput sequencing.
The high-throughput sequencing method provided by the prior patent CN106399553B is characterized in that 73 pairs of primers are divided into 4 subsets for respective amplification, the method needs specific exonuclease to digest single-stranded DNA, primer dimers are connected through ligase to construct a sequencing library, the operation is complex, and the data volume of 300Mbp on average is needed to reach higher sequencing depth and sequence coverage, so that the sequencing cost is high.
In view of this, the present invention has been made.
Disclosure of Invention
The invention aims to provide a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method, which are used for simplifying operation steps, achieving higher sequencing depth under the condition of less data volume and reducing sequencing cost. High throughput sequencing requirements can be met even for low quality FFPE samples.
The invention is realized in the following way:
the invention provides a primer set for mitochondrial whole genome sequencing, which comprises the following components: at least two primer sets, the primer sets comprising 101 pairs of primers as shown in SEQ ID NOS.1-202.
The inventors designed and synthesized multiplex amplification primers with the following design principles:
(1) The Tm value of the primer annealing temperature ranges from 58 ℃ to 64 ℃;
(2) The length distribution of the amplified products is 140-260 bp;
(3) No dimer is formed between the primers;
(4) Covering the full length of the mitochondrial sequence.
By designing the 101 pairs of primers, the full-length coverage of human mitochondria can be realized, and the coverage rate reaches more than 99.8%. Meaning that with very little data volume, a higher sequencing depth can be obtained, reducing sequencing costs.
The amplification primer can reduce the use amount of a template, can stably detect samples as low as 10ng, and even FFPE samples with low quality. In addition, the primer set provided by the invention has smaller length of the generated amplification product (the amplification product is only about 300 bp), can be compatible with the sequencing read length of more than 150 PE of a mainstream Illumina sequencing platform, and is convenient for sequencing.
The arrangement of at least two primer subsets can ensure that fragments of amplified products are not uneven, and the amplification efficiency is reduced due to excessive fragment length difference. At the same time, too close intervals of the primers are avoided, so that the length difference of amplified products is too large, and non-specific amplification is further formed. The primer subset may be provided in plural as needed as long as it is satisfied that there is no overlap between each primer pair in the same primer subset. For example 2-10 subsets are provided.
In preferred embodiments of the invention, the primer set comprises 2, 3 or 4 primer subsets.
In a preferred embodiment of the present invention, the primer set comprises a first primer set as shown in SEQ ID NOS.1-102 and a second primer set as shown in SEQ ID NOS.103-202.
The inventor finds that when the number of primer subsets is two, the number of amplification times can be reduced, and compared with the number of amplification times of modes such as 3 or 4 subsets, the number of amplification times of the two subsets is reduced by 1 or 2 times respectively, and the higher full-length coverage of human mitochondria can be met.
In other embodiments, when the primer set is 4 primer subsets, two primer subsets may be selectively separated from the first primer subset, and two primer subsets may be separated from the second primer subset, so that PCR amplification is performed with the 4 primer subsets, and the amplification products may be mixed after the amplification is completed, which is also expected.
In addition, the primer set may be 3, 6, etc. primer subsets, and is not limited to the above-listed cases.
In a preferred embodiment of the present invention, the amplification products of any two primer pairs within the same primer subset do not overlap with each other; this is arranged to prevent overlapping sequences within the same subset from causing excessive length of the amplified product in the overlapping portion, affecting the amplification efficiency of the overall amplification reaction.
In an alternative embodiment, any one amplification product generated with a subset of primers has an overlap region with one or more amplification products of the other subset.
For example, when there are two primer subsets, there is an overlap of any one amplification product with 1 or 2 amplification products of the other subset.
The invention also provides a PCR amplification system, which comprises the primer set.
The PCR amplification system may be an amplification reagent comprising a primer set.
In a preferred embodiment of the present invention, the PCR amplification system further comprises a buffer system, wherein the primer set is located in the buffer system. The buffer system comprises: buffer solution, amplifying enzyme, dNTP, freeze-drying protective agent and the like.
In an alternative embodiment, each primer subset corresponds to a buffer system.
The invention also provides a kit comprising the primer set.
In an alternative embodiment, the kit further comprises reagents for amplification, including buffers, amplification enzymes, magnesium chloride, and the like.
In a preferred embodiment of the present invention, the primer set in the above-described kit comprises a first primer set as shown in SEQ ID NOS.1-102 and a second primer set as shown in SEQ ID NOS.103-202.
The first primer subset has a concentration of C1 for the primers shown in SEQ ID No.1-100, a concentration of C2 for the primers shown in SEQ ID No.101-102, a concentration of C3 for the primers shown in SEQ ID No.103-104, a concentration of C4 for the primers shown in SEQ ID No.105-200, and a concentration of C5 for the primers shown in SEQ ID No. 201-202.
For example, the molar concentrations of C1, C2, C3, C4, C5 are 10uM, 20uM, 10uM and 20uM, respectively.
The above molar ratio is the optimized molar ratio mixing ratio of the present invention, and the amplification efficiency of each primer subset can be further improved in the above mixing ratio.
The application of the primer set, the PCR amplification system or the kit in high-throughput sequencing of the whole human mitochondrial genome.
The invention also provides a method for high-throughput sequencing of the whole genome of the human mitochondria, which comprises the following steps:
the primer set is utilized to carry out PCR amplification on a genome DNA sample to be detected, thus obtaining a mixture of amplified products of different primer subsets, sequencing analysis is carried out, and the method is a non-disease diagnosis method and a non-disease therapeutic method.
Compared with the CN106399553A patent, the sequencing method provided by the invention does not need enzyme digestion, connection and library establishment, and can obtain a high-throughput sequencing library through one-time PCR amplification. The method has the advantages of simple operation, library construction completion within 4 hours at maximum, less sample DNA and reagent consumption and lower cost.
In an alternative embodiment, the amplified products of the different primer subsets are mixed in equimolar amounts and subjected to a second round of amplification plus adaptor, index sequences prior to on-machine sequencing analysis.
Examples to be tested include, but are not limited to: blood, FFPE samples, hair and saliva.
FFPE samples refer to: formalin-fixed, paraffin-embedded samples are common biological materials in the medical field.
The invention has the following beneficial effects:
the invention provides a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method. The full length of human mitochondria can be covered by 101 pairs of primers, and the coverage rate reaches more than 99.8%. Meaning that with very little data volume, a higher sequencing depth can be obtained, reducing sequencing costs. The amplification primer can reduce the use amount of the template, and can meet the requirement of high-throughput sequencing even for FFPE samples with low quality. In addition, the primer set provided by the invention has smaller length of the generated amplification product (the amplification product is only about 300 bp), can be compatible with the sequencing read length of more than 150 PE of a mainstream Illumina sequencing platform, and is convenient for sequencing.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings that are needed in the embodiments will be briefly described below, it being understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and other related drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.
FIG. 1 is an overall flow chart of a method of high throughput sequencing provided by the present invention;
FIG. 2 is a schematic diagram of PCR multiplex amplification primer set design;
FIG. 3 is an electrophoresis chart of the first round of PCR in example 1;
FIG. 4 is an electrophoresis chart of the second round of PCR in example 1;
FIG. 5 is an electrophoresis chart of the first round of PCR in example 2;
FIG. 6 is an electrophoresis chart of the second round PCR in example 2.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention more clear, the technical solutions of the embodiments of the present invention will be clearly and completely described below. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
The design schematic of PCR multiplex amplification primer set is shown in FIG. 2, 101 pairs of primers are uniformly distributed on the whole length of 16000bp human mitochondrial genome. The 101 pairs of primers are divided into two groups of primer pools A and B according to the odd and even rules of the number of the primers. Thus avoiding too close spacing of primers, resulting in too large a difference in amplification product length, and further non-specific amplification.
Group A corresponds to the first primer subset (odd set, 1,3,5,7, … …,101, FIG. 2) and group B corresponds to the second primer subset (even set, 2,4,6,8, … …, FIG. 2).
The design principle of the multiplex amplification primer is as follows:
(1) The Tm value of the primer annealing temperature ranges from 58 ℃ to 64 ℃;
(2) The length distribution of the amplified products is 140-260 bp;
(3) No dimer is formed between the primers;
(4) Covering the full length of the mitochondrial sequence.
The first primer subset has a concentration of C1 for the primers shown in SEQ ID NOS.1-100, a concentration of C2 for the primers shown in SEQ ID NOS.101-102 (corresponding to numeral 101 shown in FIG. 2), a concentration of C3 for the primers shown in SEQ ID NOS.103-104 (corresponding to numeral 2 shown in FIG. 2), a concentration of C4 for the primers shown in SEQ ID NOS.105-200, and a concentration of C5 for the primers shown in SEQ ID NOS.201-202 (corresponding to numeral 100 shown in FIG. 2). In this example, the molar concentrations of C1, C2, C3, C4, C5 were 10uM, 20uM, 10uM, and 20uM, respectively.
The features and capabilities of the present invention are described in further detail below in connection with the examples.
Example 1
The present example provides a mitochondrial whole gene high throughput sequencing method for human blood samples. The overall flow chart is shown with reference to fig. 1.
(1) Human blood 2 parts were randomly selected and DNA was extracted using the Ezup column blood genomic DNA extraction kit (B518253).
(2) The primer sets (101 pairs in total) were designed and synthesized, and the two primer pools A and B were mixed according to the molar concentrations of C1, C2, C3, C4 and C5 of 10uM, 20uM, 10uM and 20uM, respectively. The primer synthesis and purification mode is an HPLC mode.
(3) A first round of multiplex PCR amplification was performed:
PCR reaction system (A, B are the same):
PCR reaction procedure (a, B are the same):
the amplification products of the first round (length range about 300 bp) were recovered by AMPure XP bead purification and mixed in equimolar amounts.
The electrophoretogram of the first round of amplification products is shown in FIG. 3, from left to right, for samples mito-1, mito-2 and Marker, respectively. The target band is about 300bp.
(4) And (3) performing a second round of amplification by taking the DNA mixed in the previous step as a template.
The second round amplification primers were as follows
P7：CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG。
P5：AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC。
Wherein italics X indicates index sequence for distinguishing between different sample data. Reference may be made to index sequences used by the Illumina platform. The index sequence may be 8 bases at random.
The second round amplification system was as follows:
the PCR reaction procedure was as follows:
the amplification products of the second round were recovered by using AMPure XP beads and were about 400bp in length. The second round of electrophoresis detection results of the amplified products are shown in FIG. 4, wherein samples mito-1, mito-2 and Marker are respectively from left to right. The target band is about 400bp.
And (3) after the recovered product is qualified in concentration and length detection, sequencing by using an Illumina Miseq instrument, and sequencing by using a mode PE300.
Sequencing data and comparison analysis results are shown in the following table:
| sample name | Reads_num | Mapped_target_num | Mapped_target_ratio | average_depth | coverage |
| mito-1 | 326824 | 318972 | 97.6 | 2678.23 | 100％ |
| mito-2 | 118440 | 116448 | 98.32 | 984.39 | 100％ |
The sequencing data of the embodiment 1 show that the high-throughput sequencing method for the mitochondrial whole gene provided by the invention can obtain higher sequencing depth under the condition of less data volume, and the sequencing cost is reduced.
Example 2
In this example, 2 human FFPE samples (from donor) were randomly selected and DNA was extracted using the Ezup column paraffin section genomic DNA extraction kit (B518269).
(1) Using the 101 pairs of primers synthesized in example 1, two primer pools A and B were prepared by mixing 10uM, 20uM, 10uM and 20uM according to the molar concentrations of C1, C2, C3, C4 and C5, respectively.
(2) A first round of multiplex PCR amplification was performed:
the reaction system for the first round of multiplex PCR amplification is as follows (A, B primer pools are identical):
the PCR reaction procedure was as follows (A, B primer pool was identical):
the amplification products of the first round (length range about 300 bp) were recovered by using AMPure XP magnetic bead purification. The electrophoretogram of the first round amplification product is shown in FIG. 5, and samples FFPE1, FFPE2 and Marker are respectively from left to right. The target band is about 300bp.
The products were mixed in equimolar amounts.
(3) The second round of amplification was performed using the DNA mixed in the above step as a template, and the second round of amplification primers were as follows with reference to example 1:
the PCR reaction procedure was as follows:
the amplification products of the second round were recovered by using AMPure XP beads and were about 400bp in length. The electrophoretogram of the second round of amplification products is shown in FIG. 6, from left to right, for samples FFPE1, FFPE2 and Marker, respectively. The target band is about 400bp.
And after the recovered product is qualified in concentration and length detection, sequencing by using an Illumina Miseq instrument, and sequencing by using a mode PE150.
Sequencing data and comparison analysis results are shown in the following table:
the sequencing data of the embodiment 2 show that the high-throughput sequencing method for the mitochondrial whole gene provided by the invention can reduce the template usage amount, can stably detect low-quality FFPE samples, and has good application prospects. Because the amplified products are smaller, the method can be compatible with more than 150 PE sequencing read lengths of mainstream Illumina sequencing platforms, and is convenient for sequencing.
The above description is only of the preferred embodiments of the present invention and is not intended to limit the present invention, but various modifications and variations can be made to the present invention by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> biological engineering (Shanghai) Co., ltd
<120> a primer set for mitochondrial whole genome sequencing and high throughput sequencing method
<141> 2022-03-24
<160> 202
<170> SIPOSequenceListing 1.0
<210> 3
<211> 48
<212> DNA
<213> artificial sequence
<400> 3
cctacacgac gctcttccga tctcacaggt ctatcaccct attaacca 48
<210> 2
<211> 54
<212> DNA
<213> artificial sequence
<400> 2
gttccttggc acccgagaat tccatgcaga cattcaattg ttattattat gtcc 54
<210> 3
<211> 45
<212> DNA
<213> artificial sequence
<400> 3
cctacacgac gctcttccga tcttgccaaa ccccaaaaac aaaga 45
<210> 4
<211> 48
<212> DNA
<213> artificial sequence
<400> 4
gttccttggc acccgagaat tccaaggtaa gctacataaa ctgtgggg 48
<210> 5
<211> 45
<212> DNA
<213> artificial sequence
<400> 5
cctacacgac gctcttccga tctattacac atgcaagcat ccccg 45
<210> 6
<211> 46
<212> DNA
<213> artificial sequence
<400> 6
gttccttggc acccgagaat tccatacgcc ggcttctatt gacttg 46
<210> 7
<211> 49
<212> DNA
<213> artificial sequence
<400> 7
cctacacgac gctcttccga tctgtggctt taacatatct gaacacaca 49
<210> 8
<211> 46
<212> DNA
<213> artificial sequence
<400> 8
gttccttggc acccgagaat tccaggtttg ctgaagatgg cggtat 46
<210> 9
<211> 45
<212> DNA
<213> artificial sequence
<400> 9
cctacacgac gctcttccga tctccccaga aaactacgat agccc 45
<210> 10
<211> 46
<212> DNA
<213> artificial sequence
<400> 10
gttccttggc acccgagaat tccataagct acactctggt tcgtcc 46
<210> 11
<211> 46
<212> DNA
<213> artificial sequence
<400> 11
cctacacgac gctcttccga tctaccttag ccaaaccatt taccca 46
<210> 12
<211> 46
<212> DNA
<213> artificial sequence
<400> 12
gttccttggc acccgagaat tccatttgct acatagacgg gtgtgc 46
<210> 13
<211> 47
<212> DNA
<213> artificial sequence
<400> 13
cctacacgac gctcttccga tctactttaa atttgcccac agaaccc 47
<210> 14
<211> 51
<212> DNA
<213> artificial sequence
<400> 14
gttccttggc acccgagaat tccatcttct atagggtgat agattggtcc a 51
<210> 15
<211> 50
<212> DNA
<213> artificial sequence
<400> 15
cctacacgac gctcttccga tctctgacaa ttaacagccc aatatctaca 50
<210> 16
<211> 52
<212> DNA
<213> artificial sequence
<400> 16
gttccttggc acccgagaat tccatttaag gaacaagtga ttatgctacc tt 52
<210> 17
<211> 45
<212> DNA
<213> artificial sequence
<400> 17
cctacacgac gctcttccga tctggcataa cacagcaaga cgaga 45
<210> 18
<211> 46
<212> DNA
<213> artificial sequence
<400> 18
gttccttggc acccgagaat tccagattgc gctgttatcc ctaggg 46
<210> 19
<211> 48
<212> DNA
<213> artificial sequence
<400> 19
cctacacgac gctcttccga tctacgatta aagtcctacg tgatctga 48
<210> 20
<211> 50
<212> DNA
<213> artificial sequence
<400> 20
gttccttggc acccgagaat tccaaggaat tgaacctctg actgtaaagt 50
<210> 21
<211> 45
<212> DNA
<213> artificial sequence
<400> 21
cctacacgac gctcttccga tctgccaacc tcctactcct cattg 45
<210> 22
<211> 46
<212> DNA
<213> artificial sequence
<400> 22
gttccttggc acccgagaat tccagggggt tcatagtaga agagcg 46
<210> 23
<211> 46
<212> DNA
<213> artificial sequence
<400> 23
cctacacgac gctcttccga tctctcaatc ctctgatcag ggtgag 46
<210> 24
<211> 46
<212> DNA
<213> artificial sequence
<400> 24
gttccttggc acccgagaat tccagttcgg ttggtctctg ctagtg 46
<210> 25
<211> 45
<212> DNA
<213> artificial sequence
<400> 25
cctacacgac gctcttccga tcttcgccct attcttcata gccga 45
<210> 26
<211> 51
<212> DNA
<213> artificial sequence
<400> 26
gttccttggc acccgagaat tccatcatat aagtaatgct agggtgagtg g 51
<210> 27
<211> 47
<212> DNA
<213> artificial sequence
<400> 27
cctacacgac gctcttccga tctaggagct taaaccccct tatttct 47
<210> 28
<211> 46
<212> DNA
<213> artificial sequence
<400> 28
gttccttggc acccgagaat tccaaaaaat cagtgcgagc ttagcg 46
<210> 29
<211> 45
<212> DNA
<213> artificial sequence
<400> 29
cctacacgac gctcttccga tctgccatca agtatttcct cacgc 45
<210> 30
<211> 46
<212> DNA
<213> artificial sequence
<400> 30
gttccttggc acccgagaat tccatggggg ctagtttttg tcatgt 46
<210> 31
<211> 45
<212> DNA
<213> artificial sequence
<400> 31
cctacacgac gctcttccga tctttaaacc aaacccagct acgca 45
<210> 32
<211> 46
<212> DNA
<213> artificial sequence
<400> 32
gttccttggc acccgagaat tccaggagag gagggtggat ggaatt 46
<210> 33
<211> 45
<212> DNA
<213> artificial sequence
<400> 33
cctacacgac gctcttccga tcttagccac catcaccctc cttaa 45
<210> 34
<211> 46
<212> DNA
<213> artificial sequence
<400> 34
gttccttggc acccgagaat tccaacttac tgagggcttt gaaggc 46
<210> 35
<211> 45
<212> DNA
<213> artificial sequence
<400> 35
cctacacgac gctcttccga tctagccctt actagaccaa tggga 45
<210> 36
<211> 46
<212> DNA
<213> artificial sequence
<400> 36
gttccttggc acccgagaat tccaggggtg aggtaaaatg gctgag 46
<210> 37
<211> 45
<212> DNA
<213> artificial sequence
<400> 37
cctacacgac gctcttccga tctgcacagc tctaagcctc cttat 45
<210> 38
<211> 46
<212> DNA
<213> artificial sequence
<400> 38
gttccttggc acccgagaat tccaaggagt aggagagagg gaggta 46
<210> 39
<211> 45
<212> DNA
<213> artificial sequence
<400> 39
cctacacgac gctcttccga tctacagtct accctccctt agcag 45
<210> 40
<211> 46
<212> DNA
<213> artificial sequence
<400> 40
gttccttggc acccgagaat tccaatagtg atgccagcag ctagga 46
<210> 41
<211> 46
<212> DNA
<213> artificial sequence
<400> 41
cctacacgac gctcttccga tcttgatttt tcggtcaccc tgaagt 46
<210> 42
<211> 44
<212> DNA
<213> artificial sequence
<400> 42
gttccttggc acccgagaat tccacggtgg ggatagcgat gatt 44
<210> 43
<211> 47
<212> DNA
<213> artificial sequence
<400> 43
cctacacgac gctcttccga tcttctgagc cctaggattc atctttc 47
<210> 44
<211> 51
<212> DNA
<213> artificial sequence
<400> 44
gttccttggc acccgagaat tccaagattt acgccgatga atatgatagt g 51
<210> 45
<211> 45
<212> DNA
<213> artificial sequence
<400> 45
cctacacgac gctcttccga tctccacaac actttctcgg cctat 45
<210> 46
<211> 46
<212> DNA
<213> artificial sequence
<400> 46
gttccttggc acccgagaat tccatacggg ttcttcgaat gtgtgg 46
<210> 47
<211> 44
<212> DNA
<213> artificial sequence
<400> 47
cctacacgac gctcttccga tctctggttt caagccaacc ccat 44
<210> 48
<211> 48
<212> DNA
<213> artificial sequence
<400> 48
gttccttggc acccgagaat tccatgtgag tgttaggaaa agggcata 48
<210> 49
<211> 45
<212> DNA
<213> artificial sequence
<400> 49
cctacacgac gctcttccga tctccgccat catcctagtc ctcat 45
<210> 50
<211> 46
<212> DNA
<213> artificial sequence
<400> 50
gttccttggc acccgagaat tccaatacga atgggggctt caatcg 46
<210> 51
<211> 44
<212> DNA
<213> artificial sequence
<400> 51
cctacacgac gctcttccga tctaccactt tcaccgctac acga 44
<210> 52
<211> 47
<212> DNA
<213> artificial sequence
<400> 52
gttccttggc acccgagaat tccaagttgg ggcatttcac tgtaaag 47
<210> 53
<211> 45
<212> DNA
<213> artificial sequence
<400> 53
cctacacgac gctcttccga tctaaactac cacctacctc cctca 45
<210> 54
<211> 54
<212> DNA
<213> artificial sequence
<400> 54
gttccttggc acccgagaat tccatgtatg gttatcattt gttttgaggt tagt 54
<210> 55
<211> 46
<212> DNA
<213> artificial sequence
<400> 55
cctacacgac gctcttccga tctactcatt tacaccaacc acccaa 46
<210> 56
<211> 44
<212> DNA
<213> artificial sequence
<400> 56
gttccttggc acccgagaat tccaatgagt aggtggcctg cagt 44
<210> 57
<211> 45
<212> DNA
<213> artificial sequence
<400> 57
cctacacgac gctcttccga tctaatcgct gtcgccttaa tccaa 45
<210> 58
<211> 46
<212> DNA
<213> artificial sequence
<400> 58
gttccttggc acccgagaat tccatcgcgc catcattggt atatgg 46
<210> 59
<211> 45
<212> DNA
<213> artificial sequence
<400> 59
cctacacgac gctcttccga tctcaaaaag gccttcgata cggga 45
<210> 60
<211> 51
<212> DNA
<213> artificial sequence
<400> 60
gttccttggc acccgagaat tccattggtt tcggttgttt tctattagac t 51
<210> 61
<211> 45
<212> DNA
<213> artificial sequence
<400> 61
cctacacgac gctcttccga tctccctcct acaagcctca gagta 45
<210> 62
<211> 51
<212> DNA
<213> artificial sequence
<400> 62
gttccttggc acccgagaat tccatggaga catacagaaa tagtcaaacc a 51
<210> 63
<211> 45
<212> DNA
<213> artificial sequence
<400> 63
cctacacgac gctcttccga tcttcaacac cctcctagcc ttact 45
<210> 64
<211> 50
<212> DNA
<213> artificial sequence
<400> 64
gttccttggc acccgagaat tccaagggat gacataacta ttagtggcag 50
<210> 65
<211> 45
<212> DNA
<213> artificial sequence
<400> 65
cctacacgac gctcttccga tcttcatcct agccctaagt ctggc 45
<210> 66
<211> 53
<212> DNA
<213> artificial sequence
<400> 66
gttccttggc acccgagaat tccatgaaca gcgatagtat tattccttct agg 53
<210> 67
<211> 45
<212> DNA
<213> artificial sequence
<400> 67
cctacacgac gctcttccga tctcataacc ctcaacaccc actcc 45
<210> 68
<211> 46
<212> DNA
<213> artificial sequence
<400> 68
gttccttggc acccgagaat tccatgtggg tggttgtgtt gattca 46
<210> 69
<211> 45
<212> DNA
<213> artificial sequence
<400> 69
cctacacgac gctcttccga tctcttttcc tccgaccccc taaca 45
<210> 70
<211> 46
<212> DNA
<213> artificial sequence
<400> 70
gttccttggc acccgagaat tccaatcggg tgatgatagc caaggt 46
<210> 71
<211> 45
<212> DNA
<213> artificial sequence
<400> 71
cctacacgac gctcttccga tcttcacaac accctaggct cacta 45
<210> 72
<211> 47
<212> DNA
<213> artificial sequence
<400> 72
gttccttggc acccgagaat tccattgaga atgagtgtga ggcgtat 47
<210> 73
<211> 48
<212> DNA
<213> artificial sequence
<400> 73
cctacacgac gctcttccga tctacctaaa atcgctcatt gcatactc 48
<210> 74
<211> 46
<212> DNA
<213> artificial sequence
<400> 74
gttccttggc acccgagaat tccatagcga ggcttgctag aagtca 46
<210> 75
<211> 47
<212> DNA
<213> artificial sequence
<400> 75
cctacacgac gctcttccga tcttcactct cctacttaca ggactca 47
<210> 76
<211> 48
<212> DNA
<213> artificial sequence
<400> 76
gttccttggc acccgagaat tccagcctct gttgtcagat tcacaatc 48
<210> 77
<211> 49
<212> DNA
<213> artificial sequence
<400> 77
cctacacgac gctcttccga tctgataaca gctatccatt ggtcttagg 49
<210> 78
<211> 51
<212> DNA
<213> artificial sequence
<400> 78
gttccttggc acccgagaat tccaagataa taacttcttg gtctaggcac a 51
<210> 79
<211> 46
<212> DNA
<213> artificial sequence
<400> 79
cctacacgac gctcttccga tctagcattg ttcgttacat ggtcca 46
<210> 80
<211> 49
<212> DNA
<213> artificial sequence
<400> 80
gttccttggc acccgagaat tccaggttgt ataggattgc ttgaatggc 49
<210> 81
<211> 44
<212> DNA
<213> artificial sequence
<400> 81
cctacacgac gctcttccga tctaatccaa gcctcacccc acta 44
<210> 82
<211> 46
<212> DNA
<213> artificial sequence
<400> 82
gttccttggc acccgagaat tccagctgcg aacagagtgg tgatag 46
<210> 83
<211> 45
<212> DNA
<213> artificial sequence
<400> 83
cctacacgac gctcttccga tctaaccaac cacacctagc attcc 45
<210> 84
<211> 49
<212> DNA
<213> artificial sequence
<400> 84
gttccttggc acccgagaat tccatgtgta tgatatgttt gcggtttcg 49
<210> 85
<211> 45
<212> DNA
<213> artificial sequence
<400> 85
cctacacgac gctcttccga tcttaacagg tcaacctcgc ttccc 45
<210> 86
<211> 54
<212> DNA
<213> artificial sequence
<400> 86
gttccttggc acccgagaat tccaggggat tttattttaa gtttgttggt tagg 54
<210> 87
<211> 45
<212> DNA
<213> artificial sequence
<400> 87
cctacacgac gctcttccga tctacaccgc acaatcccct atcta 45
<210> 88
<211> 53
<212> DNA
<213> artificial sequence
<400> 88
gttccttggc acccgagaat tccatgtata tattgtaatt gagattgctc ggg 53
<210> 89
<211> 45
<212> DNA
<213> artificial sequence
<400> 89
cctacacgac gctcttccga tcttaggatc ctcccgaatc aaccc 45
<210> 90
<211> 51
<212> DNA
<213> artificial sequence
<400> 90
gttccttggc acccgagaat tccaaattta tttaggggga atgatggttg t 51
<210> 91
<211> 49
<212> DNA
<213> artificial sequence
<400> 91
cctacacgac gctcttccga tctcaccgct aacaatcaat actaaaccc 49
<210> 92
<211> 46
<212> DNA
<213> artificial sequence
<400> 92
gttccttggc acccgagaat tccaggaggt cgatgaatga gtggtt 46
<210> 93
<211> 44
<212> DNA
<213> artificial sequence
<400> 93
cctacacgac gctcttccga tctactactc accagacgcc tcaa 44
<210> 94
<211> 46
<212> DNA
<213> artificial sequence
<400> 94
gttccttggc acccgagaat tccactcacg ggaggacata gcctat 46
<210> 95
<211> 45
<212> DNA
<213> artificial sequence
<400> 95
cctacacgac gctcttccga tctggctact cagtagacag tccca 45
<210> 96
<211> 47
<212> DNA
<213> artificial sequence
<400> 96
gttccttggc acccgagaat tccaaggagg tctggtgaga atagtgt 47
<210> 97
<211> 45
<212> DNA
<213> artificial sequence
<400> 97
cctacacgac gctcttccga tcttctccga tccgtcccta acaaa 45
<210> 98
<211> 49
<212> DNA
<213> artificial sequence
<400> 98
gttccttggc acccgagaat tccattgttg tgaagtatag tacggatgc 49
<210> 99
<211> 48
<212> DNA
<213> artificial sequence
<400> 99
cctacacgac gctcttccga tcttcttgta aaccggagat gaaaacct 48
<210> 100
<211> 50
<212> DNA
<213> artificial sequence
<400> 100
gttccttggc acccgagaat tccatgggtt tttatgtact acaggtggtc 50
<210> 101
<211> 45
<212> DNA
<213> artificial sequence
<400> 101
cctacacgac gctcttccga tctacatcaa ctgcaactcc aaagc 45
<210> 102
<211> 46
<212> DNA
<213> artificial sequence
<400> 102
gttccttggc acccgagaat tccacacttt agctaccccc aagtgt 46
<210> 103
<211> 49
<212> DNA
<213> artificial sequence
<400> 103
cctacacgac gctcttccga tctacgttca atattacagg cgaacatac 49
<210> 104
<211> 46
<212> DNA
<213> artificial sequence
<400> 104
gttccttggc acccgagaat tccaaaaagt gcataccgcc aaaaga 46
<210> 105
<211> 43
<212> DNA
<213> artificial sequence
<400> 105
cctacacgac gctcttccga tctcacacac acaccgctgc taa 43
<210> 106
<211> 46
<212> DNA
<213> artificial sequence
<400> 106
gttccttggc acccgagaat tccacgtgct tgatgcttgt tccttt 46
<210> 107
<211> 44
<212> DNA
<213> artificial sequence
<400> 107
cctacacgac gctcttccga tctcccaggg ttggtcaatt tcgt 44
<210> 108
<211> 47
<212> DNA
<213> artificial sequence
<400> 108
gttccttggc acccgagaat tccaggttta gggctaagca tagtggg 47
<210> 109
<211> 47
<212> DNA
<213> artificial sequence
<400> 109
cctacacgac gctcttccga tcttgttctg taatcgataa accccga 47
<210> 110
<211> 49
<212> DNA
<213> artificial sequence
<400> 110
gttccttggc acccgagaat tccaagcact ctactcttag tttactgct 49
<210> 111
<211> 49
<212> DNA
<213> artificial sequence
<400> 111
cctacacgac gctcttccga tctcgcattt atatagagga gacaagtcg 49
<210> 112
<211> 47
<212> DNA
<213> artificial sequence
<400> 112
gttccttggc acccgagaat tccagcggta ctatatctat tgcgcca 47
<210> 113
<211> 45
<212> DNA
<213> artificial sequence
<400> 113
cctacacgac gctcttccga tctcaaagct aagacccccg aaacc 45
<210> 114
<211> 47
<212> DNA
<213> artificial sequence
<400> 114
gttccttggc acccgagaat tccatcctag tgtccaaaga gctgttc 47
<210> 115
<211> 46
<212> DNA
<213> artificial sequence
<400> 115
cctacacgac gctcttccga tctagctcaa cacccactac ctaaaa 46
<210> 116
<211> 46
<212> DNA
<213> artificial sequence
<400> 116
gttccttggc acccgagaat tccaaccttt ccttatgagc atgcct 46
<210> 117
<211> 46
<212> DNA
<213> artificial sequence
<400> 117
cctacacgac gctcttccga tctcatcacc agtattagag gcaccg 46
<210> 118
<211> 48
<212> DNA
<213> artificial sequence
<400> 118
gttccttggc acccgagaat tccagtgggt ttgttaggta ctgtttgc 48
<210> 119
<211> 50
<212> DNA
<213> artificial sequence
<400> 119
cctacacgac gctcttccga tctcagtcaa agcgaactac tatactcaat 50
<210> 120
<211> 51
<212> DNA
<213> artificial sequence
<400> 120
gttccttggc acccgagaat tccaacaggg aggaatttga aagtagatag a 51
<210> 121
<211> 49
<212> DNA
<213> artificial sequence
<400> 121
cctacacgac gctcttccga tctcccccgt aaatgatatc atctcaact 49
<210> 122
<211> 46
<212> DNA
<213> artificial sequence
<400> 122
gttccttggc acccgagaat tccaggggcc tttgcgtagt tgtata 46
<210> 123
<211> 45
<212> DNA
<213> artificial sequence
<400> 123
cctacacgac gctcttccga tctgccacat ctaccatcac cctct 45
<210> 124
<211> 50
<212> DNA
<213> artificial sequence
<400> 124
gttccttggc acccgagaat tccagctagg gtgacttcat atgagattgt 50
<210> 125
<211> 45
<212> DNA
<213> artificial sequence
<400> 125
cctacacgac gctcttccga tctacacctc tgattactcc tgcca 45
<210> 126
<211> 46
<212> DNA
<213> artificial sequence
<400> 126
gttccttggc acccgagaat tccattcagg ggagagtgcg tcatat 46
<210> 127
<211> 43
<212> DNA
<213> artificial sequence
<400> 127
cctacacgac gctcttccga tctcgattcc gctacgacca act 43
<210> 128
<211> 46
<212> DNA
<213> artificial sequence
<400> 128
gttccttggc acccgagaat tccataggtg gcacggagaa ttttgg 46
<210> 129
<211> 45
<212> DNA
<213> artificial sequence
<400> 129
cctacacgac gctcttccga tcttaattaa tcccctggcc caacc 45
<210> 130
<211> 49
<212> DNA
<213> artificial sequence
<400> 130
gttccttggc acccgagaat tccatccgga gagtatattg ttgaagagg 49
<210> 131
<211> 45
<212> DNA
<213> artificial sequence
<400> 131
cctacacgac gctcttccga tcttgagtcc cagaggttac ccaag 45
<210> 132
<211> 50
<212> DNA
<213> artificial sequence
<400> 132
gttccttggc acccgagaat tccaacggta gaactgctat tattcatcct 50
<210> 133
<211> 45
<212> DNA
<213> artificial sequence
<400> 133
cctacacgac gctcttccga tctagcacca cgaccctact actat 45
<210> 134
<211> 46
<212> DNA
<213> artificial sequence
<400> 134
gttccttggc acccgagaat tccatgggga gtagtgtgat tgaggt 46
<210> 135
<211> 46
<212> DNA
<213> artificial sequence
<400> 135
cctacacgac gctcttccga tctgctactc ctacctatct cccctt 46
<210> 136
<211> 46
<212> DNA
<213> artificial sequence
<400> 136
gttccttggc acccgagaat tccaaagcca gttgattagg gtgctt 46
<210> 137
<211> 45
<212> DNA
<213> artificial sequence
<400> 137
cctacacgac gctcttccga tctctcggag ctggtaaaaa gaggc 45
<210> 138
<211> 47
<212> DNA
<213> artificial sequence
<400> 138
gttccttggc acccgagaat tccaacgttg tagatgtggt cgttacc 47
<210> 139
<211> 45
<212> DNA
<213> artificial sequence
<400> 139
cctacacgac gctcttccga tcttggcaac tgactagttc cccta 45
<210> 140
<211> 46
<212> DNA
<213> artificial sequence
<400> 140
gttccttggc acccgagaat tccatggccc ctaagataga ggagac 46
<210> 141
<211> 45
<212> DNA
<213> artificial sequence
<400> 141
cctacacgac gctcttccga tctcaatacc aaacgcccct cttcg 45
<210> 142
<211> 50
<212> DNA
<213> artificial sequence
<400> 142
gttccttggc acccgagaat tccaccggag tagtaagtta caatatggga 50
<210> 143
<211> 44
<212> DNA
<213> artificial sequence
<400> 143
cctacacgac gctcttccga tctagggttt atcgtgtgag caca 44
<210> 144
<211> 49
<212> DNA
<213> artificial sequence
<400> 144
gttccttggc acccgagaat tccagtacga tgtctagtga tgagtttgc 49
<210> 145
<211> 48
<212> DNA
<213> artificial sequence
<400> 145
cctacacgac gctcttccga tcttcaatag gagctgtatt tgccatca 48
<210> 146
<211> 48
<212> DNA
<213> artificial sequence
<400> 146
gttccttggc acccgagaat tccatgctgt tagagaaatg aatgagcc 48
<210> 147
<211> 48
<212> DNA
<213> artificial sequence
<400> 147
cctacacgac gctcttccga tctagtagaa gaaccctcca taaacctg 48
<210> 148
<211> 46
<212> DNA
<213> artificial sequence
<400> 148
gttccttggc acccgagaat tccacgctgc atgtgccatt aagata 46
<210> 149
<211> 45
<212> DNA
<213> artificial sequence
<400> 149
cctacacgac gctcttccga tctcctttca tgatcacgcc ctcat 45
<210> 150
<211> 46
<212> DNA
<213> artificial sequence
<400> 150
gttccttggc acccgagaat tccatggtgg ccaattgatt tgatgg 46
<210> 151
<211> 45
<212> DNA
<213> artificial sequence
<400> 151
cctacacgac gctcttccga tcttattcct agaaccaggc gacct 45
<210> 152
<211> 46
<212> DNA
<213> artificial sequence
<400> 152
gttccttggc acccgagaat tccaggcatg aaactgtggt ttgctc 46
<210> 153
<211> 45
<212> DNA
<213> artificial sequence
<400> 153
cctacacgac gctcttccga tctcctctag agcccactgt aaagc 45
<210> 154
<211> 47
<212> DNA
<213> artificial sequence
<400> 154
gttccttggc acccgagaat tccacgttca ttttggttct cagggtt 47
<210> 155
<211> 48
<212> DNA
<213> artificial sequence
<400> 155
cctacacgac gctcttccga tctcccacct ccaaatatct catcaaca 48
<210> 156
<211> 46
<212> DNA
<213> artificial sequence
<400> 156
gttccttggc acccgagaat tccacctata atcactgtgc ccgctc 46
<210> 157
<211> 46
<212> DNA
<213> artificial sequence
<400> 157
cctacacgac gctcttccga tctaccatca gcctactcat tcaacc 46
<210> 158
<211> 47
<212> DNA
<213> artificial sequence
<400> 158
gttccttggc acccgagaat tccatcatta tgtgttgtcg tgcaggt 47
<210> 159
<211> 45
<212> DNA
<213> artificial sequence
<400> 159
cctacacgac gctcttccga tctctctcag ccctcctaat gacct 45
<210> 160
<211> 46
<212> DNA
<213> artificial sequence
<400> 160
gttccttggc acccgagaat tccaaaggct cagaaaaatc ctgcga 46
<210> 161
<211> 48
<212> DNA
<213> artificial sequence
<400> 161
cctacacgac gctcttccga tcttcctaaa cacatccgta ttactcgc 48
<210> 162
<211> 48
<212> DNA
<213> artificial sequence
<400> 162
gttccttggc acccgagaat tccagttgag ccaataatga cgtgaagt 48
<210> 163
<211> 45
<212> DNA
<213> artificial sequence
<400> 163
cctacacgac gctcttccga tctccaaaca tcactttggc ttcga 45
<210> 164
<211> 49
<212> DNA
<213> artificial sequence
<400> 164
gttccttggc acccgagaat tccacgttga gttgtggtag tcaaaatgt 49
<210> 165
<211> 43
<212> DNA
<213> artificial sequence
<400> 165
cctacacgac gctcttccga tctgtgcggc ttcgacccta tat 43
<210> 166
<211> 54
<212> DNA
<213> artificial sequence
<400> 166
gttccttggc acccgagaat tccacgtttt gtttaaacta tataccaatt cggt 54
<210> 167
<211> 54
<212> DNA
<213> artificial sequence
<400> 167
cctacacgac gctcttccga tctaccatct cacttctagg aatactagta tatc 54
<210> 168
<211> 50
<212> DNA
<213> artificial sequence
<400> 168
gttccttggc acccgagaat tccattggag taggtttagg ttatgtacgt 50
<210> 169
<211> 51
<212> DNA
<213> artificial sequence
<400> 169
cctacacgac gctcttccga tcttcgtccc aacaattata ttactaccac t 51
<210> 170
<211> 45
<212> DNA
<213> artificial sequence
<400> 170
gttccttggc acccgagaat tccactggat aagtggcgtt ggctt 45
<210> 171
<211> 47
<212> DNA
<213> artificial sequence
<400> 171
cctacacgac gctcttccga tctcattcac agccacagaa ctaatca 47
<210> 172
<211> 46
<212> DNA
<213> artificial sequence
<400> 172
gttccttggc acccgagaat tccaagttgt tggctcagga gtttga 46
<210> 173
<211> 45
<212> DNA
<213> artificial sequence
<400> 173
cctacacgac gctcttccga tctggtcaat agtacttgcc gcagt 45
<210> 174
<211> 46
<212> DNA
<213> artificial sequence
<400> 174
gttccttggc acccgagaat tccacagggg gtttggatga gaatgg 46
<210> 175
<211> 45
<212> DNA
<213> artificial sequence
<400> 175
cctacacgac gctcttccga tctcgcactc acagtcgcat cataa 45
<210> 176
<211> 46
<212> DNA
<213> artificial sequence
<400> 176
gttccttggc acccgagaat tccaagcccc attgtgttgt ggtaaa 46
<210> 177
<211> 45
<212> DNA
<213> artificial sequence
<400> 177
cctacacgac gctcttccga tctcgacatc attaccgggt tttcc 45
<210> 178
<211> 53
<212> DNA
<213> artificial sequence
<400> 178
gttccttggc acccgagaat tccatggtta tagtagtgtg catggttatt act 53
<210> 179
<211> 45
<212> DNA
<213> artificial sequence
<400> 179
cctacacgac gctcttccga tctatccatt gtcgcatcca ccttt 45
<210> 180
<211> 52
<212> DNA
<213> artificial sequence
<400> 180
gttccttggc acccgagaat tccaatttga agaactgatt aatgtttggg tc 52
<210> 181
<211> 51
<212> DNA
<213> artificial sequence
<400> 181
cctacacgac gctcttccga tctaattata tccttcttgc tcatcagttg a 51
<210> 182
<211> 46
<212> DNA
<213> artificial sequence
<400> 182
gttccttggc acccgagaat tccagagtca ggggtggaga cctaat 46
<210> 183
<211> 45
<212> DNA
<213> artificial sequence
<400> 183
cctacacgac gctcttccga tctccacccc ctagcagaaa atagc 45
<210> 184
<211> 46
<212> DNA
<213> artificial sequence
<400> 184
gttccttggc acccgagaat tccagatgga cccggagcac ataaat 46
<210> 185
<211> 45
<212> DNA
<213> artificial sequence
<400> 185
cctacacgac gctcttccga tctgcagcct agcattagca ggaat 45
<210> 186
<211> 46
<212> DNA
<213> artificial sequence
<400> 186
gttccttggc acccgagaat tccaccaggc gtttaatggg gtttag 46
<210> 187
<211> 46
<212> DNA
<213> artificial sequence
<400> 187
cctacacgac gctcttccga tcttccccct ctacctaaaa ctcaca 46
<210> 188
<211> 53
<212> DNA
<213> artificial sequence
<400> 188
gttccttggc acccgagaat tccattttag gtaatagctt ttctagtcag gtt 53
<210> 189
<211> 47
<212> DNA
<213> artificial sequence
<400> 189
cctacacgac gctcttccga tcttcctctc tttcttcttc ccactca 47
<210> 190
<211> 46
<212> DNA
<213> artificial sequence
<400> 190
gttccttggc acccgagaat tccaagagta tgatggggtg gtggtt 46
<210> 191
<211> 45
<212> DNA
<213> artificial sequence
<400> 191
cctacacgac gctcttccga tctaacactc accaagacct caacc 45
<210> 192
<211> 47
<212> DNA
<213> artificial sequence
<400> 192
gttccttggc acccgagaat tccagggttt agtaatgggg tttgtgg 47
<210> 193
<211> 45
<212> DNA
<213> artificial sequence
<400> 193
cctacacgac gctcttccga tctacaagaa caccaatgac cccaa 45
<210> 194
<211> 49
<212> DNA
<213> artificial sequence
<400> 194
gttccttggc acccgagaat tccagcggat gattcagcca taatttacg 49
<210> 195
<211> 46
<212> DNA
<213> artificial sequence
<400> 195
cctacacgac gctcttccga tcttcagaaa cctgaaacat cggcat 46
<210> 196
<211> 46
<212> DNA
<213> artificial sequence
<400> 196
gttccttggc acccgagaat tccaggctgc aataatgaag ggcaag 46
<210> 197
<211> 45
<212> DNA
<213> artificial sequence
<400> 197
cctacacgac gctcttccga tcttacacaa tcaaagacgc cctcg 45
<210> 198
<211> 47
<212> DNA
<213> artificial sequence
<400> 198
gttccttggc acccgagaat tccatggagg atggggatta ttgctag 47
<210> 199
<211> 45
<212> DNA
<213> artificial sequence
<400> 199
cctacacgac gctcttccga tctaacctga atcggaggac aacca 45
<210> 200
<211> 46
<212> DNA
<213> artificial sequence
<400> 200
gttccttggc acccgagaat tccactttgg gtgctaatgg tggagt 46
<210> 201
<211> 48
<212> DNA
<213> artificial sequence
<400> 201
cctacacgac gctcttccga tctcaacaac cgctatgtat ttcgtaca 48
<210> 202
<211> 52
<212> DNA
<213> artificial sequence
<400> 202
gttccttggc acccgagaat tccaacggta aatggcttta tgtactatgt ac 52
Claims (10)
1. A primer set for mitochondrial whole genome sequencing, comprising a first primer subset as shown in SEQ ID nos. 1-102 and a second primer subset as shown in SEQ ID nos. 103-202, the first primer subset comprising a plurality of subsets, the second primer subset comprising a plurality of subsets, and the amplified products of any two primer pairs within the same primer subset being non-overlapping with each other.
2. The primer set of claim 1, wherein the first primer subset comprises 1, 2, 3, or 4 subsets; the second subset of primers comprises 1, 2, 3 or 4 subsets.
3. The primer set of claim 2, wherein any one amplification product generated with a primer set has an overlap region with one or more amplification products of other primer sets.
4. A PCR amplification system comprising the primer set of any one of claims 1-3.
5. The PCR amplification system of claim 4, further comprising a buffer system, wherein the primer set is located in the buffer system.
6. A kit comprising the primer set of any one of claims 1-3.
7. The kit of claim 6, wherein the primer set in the kit comprises a first primer set as shown in SEQ ID NOS.1-102 and a second primer set as shown in SEQ ID NOS.103-202,
the primer set shown in SEQ ID NOS.1-100 in the first primer subset had a concentration of 10uM,SEQ ID NO.101-102 and the primer set shown in SEQ ID NOS.103-104 in the second primer subset had a concentration of 20. Mu.M, and the primer set shown in SEQ ID NOS.103-104 had a concentration of 20uM,SEQ ID NO.105-200 and the primer set shown in 10uM,SEQ ID NO.201-202 had a concentration of 20. Mu.M.
8. Use of a primer set according to any one of claims 1-3, a PCR amplification system according to any one of claims 4-5 or a kit according to any one of claims 6-7 in high throughput sequencing of the human mitochondrial whole genome.
9. A method of high throughput sequencing of the whole genome of a human mitochondrial, the method comprising the steps of:
performing PCR amplification on a genomic DNA sample to be tested using the primer set of any one of claims 1-3, thereby obtaining a mixture of amplified products of different primer subsets, performing sequencing analysis, and the method is a non-disease diagnostic and non-disease therapeutic method; the primer set shown in SEQ ID NOS.1-100 in the first primer subset had a concentration of 10uM,SEQ ID NO.101-102 and the primer set shown in SEQ ID NOS.103-104 in the second primer subset had a concentration of 20. Mu.M, and the primer set shown in SEQ ID NOS.103-104 had a concentration of 20uM,SEQ ID NO.105-200 and the primer set shown in 10uM,SEQ ID NO.201-202 had a concentration of 20. Mu.M.
10. The method of high throughput sequencing of human mitochondrial whole genome according to claim 9, wherein the amplified products of different primer subsets are mixed in equimolar amounts and subjected to a second round of amplification plus linker, index sequence prior to on-machine sequencing analysis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210335789.0A CN114480578B (en) | 2022-03-31 | 2022-03-31 | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210335789.0A CN114480578B (en) | 2022-03-31 | 2022-03-31 | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114480578A CN114480578A (en) | 2022-05-13 |
| CN114480578B true CN114480578B (en) | 2023-08-18 |
Family
ID=81488310
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210335789.0A Active CN114480578B (en) | 2022-03-31 | 2022-03-31 | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114480578B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117070511B (en) * | 2023-08-16 | 2024-02-02 | 广州卿泽生物科技有限公司 | Primer group for amplifying human mitochondrial whole genome and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012162647A1 (en) * | 2011-05-26 | 2012-11-29 | University Of Cincinnati | Compositions and methods for screening for creatine transporter deficiency |
| CN103173441A (en) * | 2013-02-05 | 2013-06-26 | 深圳华大基因研究院 | Amplification method, primer, sequencing method and mutation detection method of mitochondria whole genome DNA (Deoxyribonucleic Acid) |
| CN106399553A (en) * | 2016-11-09 | 2017-02-15 | 上海添音生物科技有限公司 | Human mitochondria whole genome high-throughput sequencing method based on multiple PCR |
| AU2021105278A4 (en) * | 2021-08-11 | 2021-10-07 | Hainan University | Whole Genome High-Efficiency Gene Region Enriching and Sequencing Method |
| CN114015749A (en) * | 2021-10-18 | 2022-02-08 | 浙江博圣生物技术股份有限公司 | Construction method of mitochondrial genome sequencing library based on high-throughput sequencing and amplification primer |
-
2022
- 2022-03-31 CN CN202210335789.0A patent/CN114480578B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012162647A1 (en) * | 2011-05-26 | 2012-11-29 | University Of Cincinnati | Compositions and methods for screening for creatine transporter deficiency |
| CN103173441A (en) * | 2013-02-05 | 2013-06-26 | 深圳华大基因研究院 | Amplification method, primer, sequencing method and mutation detection method of mitochondria whole genome DNA (Deoxyribonucleic Acid) |
| CN106399553A (en) * | 2016-11-09 | 2017-02-15 | 上海添音生物科技有限公司 | Human mitochondria whole genome high-throughput sequencing method based on multiple PCR |
| AU2021105278A4 (en) * | 2021-08-11 | 2021-10-07 | Hainan University | Whole Genome High-Efficiency Gene Region Enriching and Sequencing Method |
| CN114015749A (en) * | 2021-10-18 | 2022-02-08 | 浙江博圣生物技术股份有限公司 | Construction method of mitochondrial genome sequencing library based on high-throughput sequencing and amplification primer |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114480578A (en) | 2022-05-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110734908B (en) | Construction method of high-throughput sequencing library and kit for library construction | |
| EP0849364B1 (en) | Method for the direct, exponential amplification and sequencing of DNA molecules and its application | |
| CN108517363B (en) | Individual recognition system based on second-generation sequencing, kit and application thereof | |
| EP0854196B1 (en) | Method for the uncoupled, direct, exponential amplification and sequencing of DNA molecules with the addition of a second thermostable DNA polymerase and its application | |
| CN110079592B (en) | High throughput sequencing-targeted capture of target regions for detection of genetic mutations and known, unknown gene fusion types | |
| CN107012225B (en) | STR locus detection kit and detection method based on high-throughput sequencing | |
| CN109593757B (en) | Probe and method for enriching target region by using same and applicable to high-throughput sequencing | |
| JPH07500735A (en) | Messenger RNA identification, isolation and cloning | |
| WO2018157775A1 (en) | Method for marking 5-formyl cytosine and use thereof in single base resolution sequencing | |
| WO2020232635A1 (en) | Method and system for constructing sequencing library on the basis of methylated dna target region, and use thereof | |
| Goold et al. | The development of sequence-tagged sites for human chromosome 4 | |
| CN112941635A (en) | Second-generation sequencing library building kit and method for improving library conversion rate | |
| CN114480578B (en) | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method | |
| CN113969307A (en) | DNA methylation sequencing library, preparation method and DNA methylation detection method | |
| JPS63500006A (en) | Nucleic acid base sequencing method using exonuclease inhibition | |
| CN113943763B (en) | Method for reducing nucleic acid and detection method thereof | |
| CN116601310A (en) | Preparation of a chain read sequencing library | |
| US20220267760A1 (en) | Library preparation method and application | |
| CN113913493B (en) | Rapid enrichment method of target gene region | |
| CN117625750A (en) | Whole genome amplification primer compositions, kits and methods | |
| US5719026A (en) | Method for detecting polymorphism of human cytochrome P4501A2 gene | |
| EP3759243B1 (en) | Methods and compositions for enriching nucleic acids | |
| CN114686579B (en) | Compositions, kits, methods and systems for nucleic acid sample amplification | |
| CN114686562B (en) | Compositions, kits, methods and systems for nucleic acid sample amplification | |
| CN114686580B (en) | Compositions, kits, methods and systems for nucleic acid sample amplification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |