CN114480578A - Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method - Google Patents
Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method Download PDFInfo
- Publication number
- CN114480578A CN114480578A CN202210335789.0A CN202210335789A CN114480578A CN 114480578 A CN114480578 A CN 114480578A CN 202210335789 A CN202210335789 A CN 202210335789A CN 114480578 A CN114480578 A CN 114480578A
- Authority
- CN
- China
- Prior art keywords
- dna
- artificial sequence
- primer
- primer set
- primers
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method, and relates to the technical field of genome sequencing. The primer set comprises: at least two subsets of primers, the primer set comprising 101 pairs of primers as shown in SEQ ID NO. 1-202. The primer set and the high-throughput sequencing method greatly simplify the operation steps, meet the requirement of obtaining higher sequencing depth under the condition of less data quantity and reduce the sequencing cost. High throughput sequencing requirements can be met even for low quality FFPE samples.
Description
Technical Field
The invention relates to the technical field of genome sequencing, in particular to a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method.
Background
Mitochondria are important organelles providing energy metabolism in cells, and are in central positions in energy conversion and metabolism of organisms. Mutation of mitochondrial DNA (deoxyribonucleic acid) in human somatic cells causes oxidative phosphorylation and energy supply abnormality, which in turn causes over 150 human diseases, such as cardiovascular diseases, deafness, neurodegenerative diseases and aging.
Mutations of mitochondrial DNA include insertions/deletions of large fragments, insertions/deletions of small fragments, point mutations, and the like. Mutations may occur in coding regions as well as in non-coding regions. Few or complicated techniques are currently required to rapidly capture mitochondria and perform high-throughput sequencing.
The high-throughput sequencing method provided by the prior patent CN106399553B divides 73 pairs of primers into 4 subsets to be amplified respectively, and the method needs specific exonuclease to digest single-stranded DNA, primer dimer and ligase connection to construct a sequencing library, so that the operation is complex, the average data amount of 300Mbp is needed to achieve higher sequencing depth and sequence coverage, and the sequencing cost is high.
In view of this, the invention is particularly proposed.
Disclosure of Invention
The invention aims to provide a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method, which simplify operation steps, can obtain higher sequencing depth under the condition of less data volume and reduce sequencing cost. High throughput sequencing requirements can be met even for low quality FFPE samples.
The invention is realized by the following steps:
the invention provides a primer set for mitochondrial whole genome sequencing, which comprises the following components: at least two subsets of primers, the primer set comprising 101 pairs of primers as shown in SEQ ID NO. 1-202.
The inventors designed and synthesized primers for multiplex amplification, which were designed according to the following principles:
(1) the Tm value range of the primer annealing temperature is 58-64 ℃;
(2) the length of the amplification product is distributed within 140-260 bp;
(3) no dimer is formed between the primers;
(4) covering the full length of the mitochondrial sequence.
By designing the 101 pairs of primers, the full-length coverage of human mitochondria can be realized, and the coverage rate reaches more than 99.8 percent. The method can obtain higher sequencing depth and reduce sequencing cost under the condition of extremely small data quantity.
The amplification primer can reduce the usage amount of the template, can stably detect samples as low as 10ng, and even FFPE samples with low quality. In addition, the primer set provided by the invention has the advantages that the length of the generated amplification product is small (the amplification product is only about 300 bp), the primer set can be compatible with the sequencing read length of more than PE150 of a mainstream Illumina sequencing platform, and the sequencing is convenient.
The arrangement of at least two primer subsets can ensure that the fragments of the amplified product are not uneven, and the amplification efficiency is reduced due to overlarge fragment length difference. Meanwhile, the phenomenon that the distance between the primers is too close, which causes too large difference of the lengths of amplification products, and further causes non-specific amplification is avoided. The primer subsets may be provided in plurality as needed, as long as there is no overlap between primer pairs in the same primer subset. For example, 2-10 subsets are provided.
In a preferred embodiment of the present invention, the primer set comprises 2, 3 or 4 primer subsets.
In a preferred embodiment of the present invention, the primer set comprises a first primer subset shown as SEQ ID NO.1-102 and a second primer subset shown as SEQ ID NO. 103-202.
The inventor finds that when the number of the primer subsets is two, the amplification times can be reduced by 1 or 2 times respectively compared with the amplification times of 3 or 4 subsets, and the like, and the high full-length coverage of the human mitochondria can be met.
In other embodiments, when the primer set is 4 primer subsets, optionally splitting two primer subsets from the first primer subset and splitting two primer subsets from the second primer subset, so as to perform PCR amplification with the 4 primer subsets, and mixing the amplification products after the amplification is completed, the effect can also be expected.
In addition, the primer set may be a subset of 3, 6, etc. primers, and is not limited to the above-mentioned cases.
In a preferred embodiment of the present invention, the amplification products of any two primer pairs in the same primer subset do not overlap; this is done to prevent overlapping sequences within the same subset from causing the amplification product to be too long in the overlapping portion, which affects the amplification efficiency of the overall amplification reaction.
In an alternative embodiment, any one amplification product generated with a subset of primers will have an overlapping region with one or more amplification products of the other subset.
For example, when there are two subsets of primers, there is an overlap between any one amplification product and 1 or 2 amplification products of the other subset.
The invention also provides a PCR amplification system which comprises the primer set.
The PCR amplification system may be an amplification reagent comprising a primer set.
In a preferred embodiment of the present invention, the PCR amplification system further comprises a buffer system, and the primer set is located in the buffer system. The buffer system comprises: buffer solution, amplification enzyme, dNTP, freeze-drying protective agent and the like.
In an alternative embodiment, each subset of primers corresponds to a buffer system.
The invention also provides a kit which comprises the primer set.
In an alternative embodiment, the kit further comprises reagents for amplification, including buffers, amplification enzymes, magnesium chloride, and the like.
In a preferred embodiment of the present invention, the primer set in the kit comprises a first primer subset shown in SEQ ID NO.1-102 and a second primer subset shown in SEQ ID NO. 103-202.
The concentration of the primers shown by SEQ ID NO.1-100 in the first primer subset is C1, the concentration of the primers shown by SEQ ID NO.101-102 is C2, the concentration of the primers shown by SEQ ID NO.103-104 in the second primer subset is C3, the concentration of the primers shown by SEQ ID NO.105-200 is C4, and the concentration of the primers shown by SEQ ID NO.201-202 is C5.
For example, the molar concentrations of C1, C2, C3, C4 and C5 are 10uM, 20uM, 10uM and 20uM, respectively.
The above molar ratio is the molar ratio mixing ratio optimized in the present invention, and the amplification efficiency of each primer subset can be further improved at the above mixing ratio.
The primer set, the PCR amplification system or the kit can be applied to high-throughput sequencing of the whole genome of the human mitochondria.
The invention also provides a high-throughput sequencing method for the human mitochondrial whole genome, which comprises the following steps:
the primer set is utilized to carry out PCR amplification on a genomic DNA sample to be detected, so as to obtain a mixture of amplification products of different primer subsets, and sequencing analysis is carried out.
Compared with the CN106399553A patent, the sequencing method provided by the invention does not need enzyme digestion and library connection and can obtain a high-throughput sequencing library through one-time PCR amplification. The operation is simpler and more convenient, the library construction can be completed in 4 hours at most, in addition, the consumption of sample DNA and reagents is less, and the cost is lower.
In an alternative embodiment, the amplification products of different primer subsets are mixed in equimolar amounts and subjected to a second round of amplification followed by a second round of sequencing analysis, wherein the second round of amplification is followed by the addition of the adapter and index sequences.
Samples to be tested include, but are not limited to: blood, FFPE sample, hair and saliva.
The FFPE samples refer to: formalin-fixed paraffin-embedded specimens are common biomaterials in the medical field.
The invention has the following beneficial effects:
the invention provides a primer set for mitochondrial whole genome sequencing and a high-throughput sequencing method. The full-length coverage of human mitochondria can be realized by 101 pairs of primers, and the coverage rate is more than 99.8 percent. The method can obtain higher sequencing depth and reduce sequencing cost under the condition of extremely small data quantity. The amplification primer can reduce the usage amount of the template, and can meet the requirement of high-throughput sequencing even for low-quality FFPE samples. In addition, the primer set provided by the invention has the advantages that the length of the generated amplification product is small (the amplification product is only about 300 bp), the primer set can be compatible with the sequencing read length of more than PE150 of a mainstream Illumina sequencing platform, and the sequencing is convenient.
Drawings
In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings needed to be used in the embodiments will be briefly described below, it should be understood that the following drawings only illustrate some embodiments of the present invention and therefore should not be considered as limiting the scope, and for those skilled in the art, other related drawings can be obtained according to the drawings without inventive efforts.
FIG. 1 is a general flow chart of a method for high throughput sequencing according to the present invention;
FIG. 2 is a schematic diagram of PCR multiplex amplification primer set design;
FIG. 3 is an electrophoretogram of the first round of PCR in example 1;
FIG. 4 is an electrophoretogram of a second round of PCR in example 1;
FIG. 5 is an electrophoretogram of the first round of PCR in example 2;
FIG. 6 is an electrophoretogram of the second round of PCR in example 2.
Detailed Description
In order to make the objects, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below. The examples, in which specific conditions are not specified, were conducted under conventional conditions or conditions recommended by the manufacturer. The reagents or instruments used are not indicated by the manufacturer, and are all conventional products available commercially.
The design schematic diagram of the PCR multiplex amplification primer set is shown in FIG. 2, wherein 101 pairs of primers are uniformly distributed on the full length of 16000bp human mitochondrial genome. The 101 pairs of primers are divided into two groups of primer pools A and B according to the odd and even primer numbers. Thereby avoiding too close primer spacing, resulting in too large a difference in amplification product length, and further non-specific amplification.
Group A corresponds to the first primer subset (odd set, 1,3,5,7 … … 101 shown in FIG. 2) and group B corresponds to the second primer subset (even set, 2,4,6,8 … … 100 shown in FIG. 2).
The design principle of the multiple amplification primers is as follows:
(1) the Tm value range of the primer annealing temperature is 58-64 ℃;
(2) the length of the amplification product is distributed within 140-260 bp;
(3) no dimer is formed between the primers;
(4) covering the full length of the mitochondrial sequence.
The concentration of the primers shown by SEQ ID NO.1-100 in the first primer subset is C1, the concentration of the primers shown by SEQ ID NO.101-102 (corresponding to the numeral 101 shown in FIG. 2) is C2, the concentration of the primers shown by SEQ ID NO.103-104 (corresponding to the numeral 2 shown in FIG. 2) in the second primer subset is C3, the concentration of the primers shown by SEQ ID NO.105-200 is C4, and the concentration of the primers shown by SEQ ID NO.201-202 (corresponding to the numeral 100 shown in FIG. 2) is C5. In this example, the molar concentrations of C1, C2, C3, C4, and C5 were 10uM, 20uM, 10uM, and 20uM, respectively.
The features and properties of the present invention are described in further detail below with reference to examples.
Example 1
This example provides a high throughput mitochondrial whole gene sequencing method for human blood samples. The overall flow chart is shown with reference to fig. 1.
(1) 2 parts of human blood are randomly selected, and an Ezup column type blood genome DNA extraction kit (B518253) is adopted to extract DNA.
(2) The primer sets (total 101 pairs) are designed and synthesized, and are mixed into two primer pools A and B according to the molar concentrations of C1, C2, C3, C4 and C5 of 10uM, 20uM, 10uM and 20uM respectively. The primer synthesis purification mode is an HPLC mode.
(3) Performing a first round of multiplex PCR amplification:
PCR reaction system (same for A and B):
PCR reaction procedure (same A, B):
first round amplification products (length range around 300 bp) were recovered using AMPure XP magnetic beads for purification and mixed in equimolar amounts.
The electrophoretogram of the first round of amplification products is shown in FIG. 3, from left to right are samples mito-1, mito-2 and Marker, respectively. The target band is about 300 bp.
(4) And performing second round amplification by using the DNA mixed in the previous step as a template.
The second round of amplification primers are as follows
P7：CAAGCAGAAGACGGCATACGAGATXXXXXXXXGTGACTGGAGTTCCTTGGCACCCGAG。
P5：AATGATACGGCGACCACCGAGATCTACACXXXXXXXXACACTCTTTCCCTACACGACGCTCTTCCGATC。
Where italicized X represents the index sequence, used to distinguish between different sample data. Reference may be made to the index sequence used by the Illumina platform. The index sequence may be 8 bases at random.
The second round of amplification system was as follows:
the PCR reaction procedure was as follows:
and (4) purifying and recovering the second round amplification product by using AMPure XP magnetic beads, wherein the length is about 400 bp. The results of the second round of electrophoretic detection of the amplified products are shown in FIG. 4, and from left to right are samples mito-1, mito-2 and Marker, respectively. The target band is about 400 bp.
And (3) after the recovered product is qualified by concentration and length detection, sequencing by using an Illumina MiSeq instrument, and sequencing by using a PE300 mode.
The sequencing data and the results of the alignment analysis are shown in the following table:
| sample name | Reads_num | Mapped_target_num | Mapped_target_ratio | average_depth | coverage |
| mito-1 | 326824 | 318972 | 97.6 | 2678.23 | 100％ |
| mito-2 | 118440 | 116448 | 98.32 | 984.39 | 100％ |
The sequencing data of the embodiment 1 show that the high-throughput sequencing method for the mitochondrial whole gene provided by the invention can obtain higher sequencing depth under the condition of less data volume and reduce the sequencing cost.
Example 2
In this example, 2 human FFPE samples (from a gift) were randomly selected and DNA was extracted using an Ezup column paraffin section genomic DNA extraction kit (B518269).
(1) Using the above 101 pairs of primers synthesized in example 1, 10uM, 20uM, 10uM and 20uM were mixed into two primer pools A and B at molar concentrations of C1, C2, C3, C4 and C5, respectively.
(2) Performing a first round of multiplex PCR amplification:
the reaction system of the first round of multiplex PCR amplification is as follows (the primer pools of A and B are the same):
the PCR reaction procedure was as follows (the primer pools for A and B were identical):
the first round of amplification products (length range around 300 bp) were recovered by AMPure XP magnetic bead purification. The electrophoretogram of the first round of amplification products is shown in FIG. 5, from left to right are samples FFPE1, FFPE2 and Marker, respectively. The target band is about 300 bp.
The products were mixed in equimolar amounts.
(3) The second round of amplification is performed by using the DNA mixed in the previous step as a template, and the second round of amplification primers are as follows according to example 1:
the PCR reaction procedure was as follows:
and (4) purifying and recovering the second round amplification product by using AMPure XP magnetic beads, wherein the length is about 400 bp. The electrophoretogram of the second round of amplification products is shown in FIG. 6, from left to right, for samples FFPE1, FFPE2, and Marker, respectively. The target band is about 400 bp.
And after the recovered product is qualified through concentration and length detection, sequencing by using an Illumina MiSeq instrument in a sequencing mode PE 150.
The sequencing data and the results of the alignment analysis are shown in the following table:
the sequencing data of the embodiment 2 show that the mitochondrial whole gene high-throughput sequencing method provided by the invention can reduce the usage amount of the template, can stably detect the low-quality FFPE sample, and has a good application prospect. Due to the fact that amplification products are small, the method can be compatible with the sequencing reading length of more than PE150 of a mainstream Illumina sequencing platform, and sequencing is convenient.
The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention, and various modifications and changes may be made by those skilled in the art. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Sequence listing
<110> Biotechnology engineering (Shanghai) Ltd
<120> primer set for mitochondrial whole genome sequencing and high-throughput sequencing method
<141> 2022-03-24
<160> 202
<170> SIPOSequenceListing 1.0
<210> 3
<211> 48
<212> DNA
<213> Artificial sequence
<400> 3
cctacacgac gctcttccga tctcacaggt ctatcaccct attaacca 48
<210> 2
<211> 54
<212> DNA
<213> Artificial sequence
<400> 2
gttccttggc acccgagaat tccatgcaga cattcaattg ttattattat gtcc 54
<210> 3
<211> 45
<212> DNA
<213> Artificial sequence
<400> 3
cctacacgac gctcttccga tcttgccaaa ccccaaaaac aaaga 45
<210> 4
<211> 48
<212> DNA
<213> Artificial sequence
<400> 4
gttccttggc acccgagaat tccaaggtaa gctacataaa ctgtgggg 48
<210> 5
<211> 45
<212> DNA
<213> Artificial sequence
<400> 5
cctacacgac gctcttccga tctattacac atgcaagcat ccccg 45
<210> 6
<211> 46
<212> DNA
<213> Artificial sequence
<400> 6
gttccttggc acccgagaat tccatacgcc ggcttctatt gacttg 46
<210> 7
<211> 49
<212> DNA
<213> Artificial sequence
<400> 7
cctacacgac gctcttccga tctgtggctt taacatatct gaacacaca 49
<210> 8
<211> 46
<212> DNA
<213> Artificial sequence
<400> 8
gttccttggc acccgagaat tccaggtttg ctgaagatgg cggtat 46
<210> 9
<211> 45
<212> DNA
<213> Artificial sequence
<400> 9
cctacacgac gctcttccga tctccccaga aaactacgat agccc 45
<210> 10
<211> 46
<212> DNA
<213> Artificial sequence
<400> 10
gttccttggc acccgagaat tccataagct acactctggt tcgtcc 46
<210> 11
<211> 46
<212> DNA
<213> Artificial sequence
<400> 11
cctacacgac gctcttccga tctaccttag ccaaaccatt taccca 46
<210> 12
<211> 46
<212> DNA
<213> Artificial sequence
<400> 12
gttccttggc acccgagaat tccatttgct acatagacgg gtgtgc 46
<210> 13
<211> 47
<212> DNA
<213> Artificial sequence
<400> 13
cctacacgac gctcttccga tctactttaa atttgcccac agaaccc 47
<210> 14
<211> 51
<212> DNA
<213> Artificial sequence
<400> 14
gttccttggc acccgagaat tccatcttct atagggtgat agattggtcc a 51
<210> 15
<211> 50
<212> DNA
<213> Artificial sequence
<400> 15
cctacacgac gctcttccga tctctgacaa ttaacagccc aatatctaca 50
<210> 16
<211> 52
<212> DNA
<213> Artificial sequence
<400> 16
gttccttggc acccgagaat tccatttaag gaacaagtga ttatgctacc tt 52
<210> 17
<211> 45
<212> DNA
<213> Artificial sequence
<400> 17
cctacacgac gctcttccga tctggcataa cacagcaaga cgaga 45
<210> 18
<211> 46
<212> DNA
<213> Artificial sequence
<400> 18
gttccttggc acccgagaat tccagattgc gctgttatcc ctaggg 46
<210> 19
<211> 48
<212> DNA
<213> Artificial sequence
<400> 19
cctacacgac gctcttccga tctacgatta aagtcctacg tgatctga 48
<210> 20
<211> 50
<212> DNA
<213> Artificial sequence
<400> 20
gttccttggc acccgagaat tccaaggaat tgaacctctg actgtaaagt 50
<210> 21
<211> 45
<212> DNA
<213> Artificial sequence
<400> 21
cctacacgac gctcttccga tctgccaacc tcctactcct cattg 45
<210> 22
<211> 46
<212> DNA
<213> Artificial sequence
<400> 22
gttccttggc acccgagaat tccagggggt tcatagtaga agagcg 46
<210> 23
<211> 46
<212> DNA
<213> Artificial sequence
<400> 23
cctacacgac gctcttccga tctctcaatc ctctgatcag ggtgag 46
<210> 24
<211> 46
<212> DNA
<213> Artificial sequence
<400> 24
gttccttggc acccgagaat tccagttcgg ttggtctctg ctagtg 46
<210> 25
<211> 45
<212> DNA
<213> Artificial sequence
<400> 25
cctacacgac gctcttccga tcttcgccct attcttcata gccga 45
<210> 26
<211> 51
<212> DNA
<213> Artificial sequence
<400> 26
gttccttggc acccgagaat tccatcatat aagtaatgct agggtgagtg g 51
<210> 27
<211> 47
<212> DNA
<213> Artificial sequence
<400> 27
cctacacgac gctcttccga tctaggagct taaaccccct tatttct 47
<210> 28
<211> 46
<212> DNA
<213> Artificial sequence
<400> 28
gttccttggc acccgagaat tccaaaaaat cagtgcgagc ttagcg 46
<210> 29
<211> 45
<212> DNA
<213> Artificial sequence
<400> 29
cctacacgac gctcttccga tctgccatca agtatttcct cacgc 45
<210> 30
<211> 46
<212> DNA
<213> Artificial sequence
<400> 30
gttccttggc acccgagaat tccatggggg ctagtttttg tcatgt 46
<210> 31
<211> 45
<212> DNA
<213> Artificial sequence
<400> 31
cctacacgac gctcttccga tctttaaacc aaacccagct acgca 45
<210> 32
<211> 46
<212> DNA
<213> Artificial sequence
<400> 32
gttccttggc acccgagaat tccaggagag gagggtggat ggaatt 46
<210> 33
<211> 45
<212> DNA
<213> Artificial sequence
<400> 33
cctacacgac gctcttccga tcttagccac catcaccctc cttaa 45
<210> 34
<211> 46
<212> DNA
<213> Artificial sequence
<400> 34
gttccttggc acccgagaat tccaacttac tgagggcttt gaaggc 46
<210> 35
<211> 45
<212> DNA
<213> Artificial sequence
<400> 35
cctacacgac gctcttccga tctagccctt actagaccaa tggga 45
<210> 36
<211> 46
<212> DNA
<213> Artificial sequence
<400> 36
gttccttggc acccgagaat tccaggggtg aggtaaaatg gctgag 46
<210> 37
<211> 45
<212> DNA
<213> Artificial sequence
<400> 37
cctacacgac gctcttccga tctgcacagc tctaagcctc cttat 45
<210> 38
<211> 46
<212> DNA
<213> Artificial sequence
<400> 38
gttccttggc acccgagaat tccaaggagt aggagagagg gaggta 46
<210> 39
<211> 45
<212> DNA
<213> Artificial sequence
<400> 39
cctacacgac gctcttccga tctacagtct accctccctt agcag 45
<210> 40
<211> 46
<212> DNA
<213> Artificial sequence
<400> 40
gttccttggc acccgagaat tccaatagtg atgccagcag ctagga 46
<210> 41
<211> 46
<212> DNA
<213> Artificial sequence
<400> 41
cctacacgac gctcttccga tcttgatttt tcggtcaccc tgaagt 46
<210> 42
<211> 44
<212> DNA
<213> Artificial sequence
<400> 42
gttccttggc acccgagaat tccacggtgg ggatagcgat gatt 44
<210> 43
<211> 47
<212> DNA
<213> Artificial sequence
<400> 43
cctacacgac gctcttccga tcttctgagc cctaggattc atctttc 47
<210> 44
<211> 51
<212> DNA
<213> Artificial sequence
<400> 44
gttccttggc acccgagaat tccaagattt acgccgatga atatgatagt g 51
<210> 45
<211> 45
<212> DNA
<213> Artificial sequence
<400> 45
cctacacgac gctcttccga tctccacaac actttctcgg cctat 45
<210> 46
<211> 46
<212> DNA
<213> Artificial sequence
<400> 46
gttccttggc acccgagaat tccatacggg ttcttcgaat gtgtgg 46
<210> 47
<211> 44
<212> DNA
<213> Artificial sequence
<400> 47
cctacacgac gctcttccga tctctggttt caagccaacc ccat 44
<210> 48
<211> 48
<212> DNA
<213> Artificial sequence
<400> 48
gttccttggc acccgagaat tccatgtgag tgttaggaaa agggcata 48
<210> 49
<211> 45
<212> DNA
<213> Artificial sequence
<400> 49
cctacacgac gctcttccga tctccgccat catcctagtc ctcat 45
<210> 50
<211> 46
<212> DNA
<213> Artificial sequence
<400> 50
gttccttggc acccgagaat tccaatacga atgggggctt caatcg 46
<210> 51
<211> 44
<212> DNA
<213> Artificial sequence
<400> 51
cctacacgac gctcttccga tctaccactt tcaccgctac acga 44
<210> 52
<211> 47
<212> DNA
<213> Artificial sequence
<400> 52
gttccttggc acccgagaat tccaagttgg ggcatttcac tgtaaag 47
<210> 53
<211> 45
<212> DNA
<213> Artificial sequence
<400> 53
cctacacgac gctcttccga tctaaactac cacctacctc cctca 45
<210> 54
<211> 54
<212> DNA
<213> Artificial sequence
<400> 54
gttccttggc acccgagaat tccatgtatg gttatcattt gttttgaggt tagt 54
<210> 55
<211> 46
<212> DNA
<213> Artificial sequence
<400> 55
cctacacgac gctcttccga tctactcatt tacaccaacc acccaa 46
<210> 56
<211> 44
<212> DNA
<213> Artificial sequence
<400> 56
gttccttggc acccgagaat tccaatgagt aggtggcctg cagt 44
<210> 57
<211> 45
<212> DNA
<213> Artificial sequence
<400> 57
cctacacgac gctcttccga tctaatcgct gtcgccttaa tccaa 45
<210> 58
<211> 46
<212> DNA
<213> Artificial sequence
<400> 58
gttccttggc acccgagaat tccatcgcgc catcattggt atatgg 46
<210> 59
<211> 45
<212> DNA
<213> Artificial sequence
<400> 59
cctacacgac gctcttccga tctcaaaaag gccttcgata cggga 45
<210> 60
<211> 51
<212> DNA
<213> Artificial sequence
<400> 60
gttccttggc acccgagaat tccattggtt tcggttgttt tctattagac t 51
<210> 61
<211> 45
<212> DNA
<213> Artificial sequence
<400> 61
cctacacgac gctcttccga tctccctcct acaagcctca gagta 45
<210> 62
<211> 51
<212> DNA
<213> Artificial sequence
<400> 62
gttccttggc acccgagaat tccatggaga catacagaaa tagtcaaacc a 51
<210> 63
<211> 45
<212> DNA
<213> Artificial sequence
<400> 63
cctacacgac gctcttccga tcttcaacac cctcctagcc ttact 45
<210> 64
<211> 50
<212> DNA
<213> Artificial sequence
<400> 64
gttccttggc acccgagaat tccaagggat gacataacta ttagtggcag 50
<210> 65
<211> 45
<212> DNA
<213> Artificial sequence
<400> 65
cctacacgac gctcttccga tcttcatcct agccctaagt ctggc 45
<210> 66
<211> 53
<212> DNA
<213> Artificial sequence
<400> 66
gttccttggc acccgagaat tccatgaaca gcgatagtat tattccttct agg 53
<210> 67
<211> 45
<212> DNA
<213> Artificial sequence
<400> 67
cctacacgac gctcttccga tctcataacc ctcaacaccc actcc 45
<210> 68
<211> 46
<212> DNA
<213> Artificial sequence
<400> 68
gttccttggc acccgagaat tccatgtggg tggttgtgtt gattca 46
<210> 69
<211> 45
<212> DNA
<213> Artificial sequence
<400> 69
cctacacgac gctcttccga tctcttttcc tccgaccccc taaca 45
<210> 70
<211> 46
<212> DNA
<213> Artificial sequence
<400> 70
gttccttggc acccgagaat tccaatcggg tgatgatagc caaggt 46
<210> 71
<211> 45
<212> DNA
<213> Artificial sequence
<400> 71
cctacacgac gctcttccga tcttcacaac accctaggct cacta 45
<210> 72
<211> 47
<212> DNA
<213> Artificial sequence
<400> 72
gttccttggc acccgagaat tccattgaga atgagtgtga ggcgtat 47
<210> 73
<211> 48
<212> DNA
<213> Artificial sequence
<400> 73
cctacacgac gctcttccga tctacctaaa atcgctcatt gcatactc 48
<210> 74
<211> 46
<212> DNA
<213> Artificial sequence
<400> 74
gttccttggc acccgagaat tccatagcga ggcttgctag aagtca 46
<210> 75
<211> 47
<212> DNA
<213> Artificial sequence
<400> 75
cctacacgac gctcttccga tcttcactct cctacttaca ggactca 47
<210> 76
<211> 48
<212> DNA
<213> Artificial sequence
<400> 76
gttccttggc acccgagaat tccagcctct gttgtcagat tcacaatc 48
<210> 77
<211> 49
<212> DNA
<213> Artificial sequence
<400> 77
cctacacgac gctcttccga tctgataaca gctatccatt ggtcttagg 49
<210> 78
<211> 51
<212> DNA
<213> Artificial sequence
<400> 78
gttccttggc acccgagaat tccaagataa taacttcttg gtctaggcac a 51
<210> 79
<211> 46
<212> DNA
<213> Artificial sequence
<400> 79
cctacacgac gctcttccga tctagcattg ttcgttacat ggtcca 46
<210> 80
<211> 49
<212> DNA
<213> Artificial sequence
<400> 80
gttccttggc acccgagaat tccaggttgt ataggattgc ttgaatggc 49
<210> 81
<211> 44
<212> DNA
<213> Artificial sequence
<400> 81
cctacacgac gctcttccga tctaatccaa gcctcacccc acta 44
<210> 82
<211> 46
<212> DNA
<213> Artificial sequence
<400> 82
gttccttggc acccgagaat tccagctgcg aacagagtgg tgatag 46
<210> 83
<211> 45
<212> DNA
<213> Artificial sequence
<400> 83
cctacacgac gctcttccga tctaaccaac cacacctagc attcc 45
<210> 84
<211> 49
<212> DNA
<213> Artificial sequence
<400> 84
gttccttggc acccgagaat tccatgtgta tgatatgttt gcggtttcg 49
<210> 85
<211> 45
<212> DNA
<213> Artificial sequence
<400> 85
cctacacgac gctcttccga tcttaacagg tcaacctcgc ttccc 45
<210> 86
<211> 54
<212> DNA
<213> Artificial sequence
<400> 86
gttccttggc acccgagaat tccaggggat tttattttaa gtttgttggt tagg 54
<210> 87
<211> 45
<212> DNA
<213> Artificial sequence
<400> 87
cctacacgac gctcttccga tctacaccgc acaatcccct atcta 45
<210> 88
<211> 53
<212> DNA
<213> Artificial sequence
<400> 88
gttccttggc acccgagaat tccatgtata tattgtaatt gagattgctc ggg 53
<210> 89
<211> 45
<212> DNA
<213> Artificial sequence
<400> 89
cctacacgac gctcttccga tcttaggatc ctcccgaatc aaccc 45
<210> 90
<211> 51
<212> DNA
<213> Artificial sequence
<400> 90
gttccttggc acccgagaat tccaaattta tttaggggga atgatggttg t 51
<210> 91
<211> 49
<212> DNA
<213> Artificial sequence
<400> 91
cctacacgac gctcttccga tctcaccgct aacaatcaat actaaaccc 49
<210> 92
<211> 46
<212> DNA
<213> Artificial sequence
<400> 92
gttccttggc acccgagaat tccaggaggt cgatgaatga gtggtt 46
<210> 93
<211> 44
<212> DNA
<213> Artificial sequence
<400> 93
cctacacgac gctcttccga tctactactc accagacgcc tcaa 44
<210> 94
<211> 46
<212> DNA
<213> Artificial sequence
<400> 94
gttccttggc acccgagaat tccactcacg ggaggacata gcctat 46
<210> 95
<211> 45
<212> DNA
<213> Artificial sequence
<400> 95
cctacacgac gctcttccga tctggctact cagtagacag tccca 45
<210> 96
<211> 47
<212> DNA
<213> Artificial sequence
<400> 96
gttccttggc acccgagaat tccaaggagg tctggtgaga atagtgt 47
<210> 97
<211> 45
<212> DNA
<213> Artificial sequence
<400> 97
cctacacgac gctcttccga tcttctccga tccgtcccta acaaa 45
<210> 98
<211> 49
<212> DNA
<213> Artificial sequence
<400> 98
gttccttggc acccgagaat tccattgttg tgaagtatag tacggatgc 49
<210> 99
<211> 48
<212> DNA
<213> Artificial sequence
<400> 99
cctacacgac gctcttccga tcttcttgta aaccggagat gaaaacct 48
<210> 100
<211> 50
<212> DNA
<213> Artificial sequence
<400> 100
gttccttggc acccgagaat tccatgggtt tttatgtact acaggtggtc 50
<210> 101
<211> 45
<212> DNA
<213> Artificial sequence
<400> 101
cctacacgac gctcttccga tctacatcaa ctgcaactcc aaagc 45
<210> 102
<211> 46
<212> DNA
<213> Artificial sequence
<400> 102
gttccttggc acccgagaat tccacacttt agctaccccc aagtgt 46
<210> 103
<211> 49
<212> DNA
<213> Artificial sequence
<400> 103
cctacacgac gctcttccga tctacgttca atattacagg cgaacatac 49
<210> 104
<211> 46
<212> DNA
<213> Artificial sequence
<400> 104
gttccttggc acccgagaat tccaaaaagt gcataccgcc aaaaga 46
<210> 105
<211> 43
<212> DNA
<213> Artificial sequence
<400> 105
cctacacgac gctcttccga tctcacacac acaccgctgc taa 43
<210> 106
<211> 46
<212> DNA
<213> Artificial sequence
<400> 106
gttccttggc acccgagaat tccacgtgct tgatgcttgt tccttt 46
<210> 107
<211> 44
<212> DNA
<213> Artificial sequence
<400> 107
cctacacgac gctcttccga tctcccaggg ttggtcaatt tcgt 44
<210> 108
<211> 47
<212> DNA
<213> Artificial sequence
<400> 108
gttccttggc acccgagaat tccaggttta gggctaagca tagtggg 47
<210> 109
<211> 47
<212> DNA
<213> Artificial sequence
<400> 109
cctacacgac gctcttccga tcttgttctg taatcgataa accccga 47
<210> 110
<211> 49
<212> DNA
<213> Artificial sequence
<400> 110
gttccttggc acccgagaat tccaagcact ctactcttag tttactgct 49
<210> 111
<211> 49
<212> DNA
<213> Artificial sequence
<400> 111
cctacacgac gctcttccga tctcgcattt atatagagga gacaagtcg 49
<210> 112
<211> 47
<212> DNA
<213> Artificial sequence
<400> 112
gttccttggc acccgagaat tccagcggta ctatatctat tgcgcca 47
<210> 113
<211> 45
<212> DNA
<213> Artificial sequence
<400> 113
cctacacgac gctcttccga tctcaaagct aagacccccg aaacc 45
<210> 114
<211> 47
<212> DNA
<213> Artificial sequence
<400> 114
gttccttggc acccgagaat tccatcctag tgtccaaaga gctgttc 47
<210> 115
<211> 46
<212> DNA
<213> Artificial sequence
<400> 115
cctacacgac gctcttccga tctagctcaa cacccactac ctaaaa 46
<210> 116
<211> 46
<212> DNA
<213> Artificial sequence
<400> 116
gttccttggc acccgagaat tccaaccttt ccttatgagc atgcct 46
<210> 117
<211> 46
<212> DNA
<213> Artificial sequence
<400> 117
cctacacgac gctcttccga tctcatcacc agtattagag gcaccg 46
<210> 118
<211> 48
<212> DNA
<213> Artificial sequence
<400> 118
gttccttggc acccgagaat tccagtgggt ttgttaggta ctgtttgc 48
<210> 119
<211> 50
<212> DNA
<213> Artificial sequence
<400> 119
cctacacgac gctcttccga tctcagtcaa agcgaactac tatactcaat 50
<210> 120
<211> 51
<212> DNA
<213> Artificial sequence
<400> 120
gttccttggc acccgagaat tccaacaggg aggaatttga aagtagatag a 51
<210> 121
<211> 49
<212> DNA
<213> Artificial sequence
<400> 121
cctacacgac gctcttccga tctcccccgt aaatgatatc atctcaact 49
<210> 122
<211> 46
<212> DNA
<213> Artificial sequence
<400> 122
gttccttggc acccgagaat tccaggggcc tttgcgtagt tgtata 46
<210> 123
<211> 45
<212> DNA
<213> Artificial sequence
<400> 123
cctacacgac gctcttccga tctgccacat ctaccatcac cctct 45
<210> 124
<211> 50
<212> DNA
<213> Artificial sequence
<400> 124
gttccttggc acccgagaat tccagctagg gtgacttcat atgagattgt 50
<210> 125
<211> 45
<212> DNA
<213> Artificial sequence
<400> 125
cctacacgac gctcttccga tctacacctc tgattactcc tgcca 45
<210> 126
<211> 46
<212> DNA
<213> Artificial sequence
<400> 126
gttccttggc acccgagaat tccattcagg ggagagtgcg tcatat 46
<210> 127
<211> 43
<212> DNA
<213> Artificial sequence
<400> 127
cctacacgac gctcttccga tctcgattcc gctacgacca act 43
<210> 128
<211> 46
<212> DNA
<213> Artificial sequence
<400> 128
gttccttggc acccgagaat tccataggtg gcacggagaa ttttgg 46
<210> 129
<211> 45
<212> DNA
<213> Artificial sequence
<400> 129
cctacacgac gctcttccga tcttaattaa tcccctggcc caacc 45
<210> 130
<211> 49
<212> DNA
<213> Artificial sequence
<400> 130
gttccttggc acccgagaat tccatccgga gagtatattg ttgaagagg 49
<210> 131
<211> 45
<212> DNA
<213> Artificial sequence
<400> 131
cctacacgac gctcttccga tcttgagtcc cagaggttac ccaag 45
<210> 132
<211> 50
<212> DNA
<213> Artificial sequence
<400> 132
gttccttggc acccgagaat tccaacggta gaactgctat tattcatcct 50
<210> 133
<211> 45
<212> DNA
<213> Artificial sequence
<400> 133
cctacacgac gctcttccga tctagcacca cgaccctact actat 45
<210> 134
<211> 46
<212> DNA
<213> Artificial sequence
<400> 134
gttccttggc acccgagaat tccatgggga gtagtgtgat tgaggt 46
<210> 135
<211> 46
<212> DNA
<213> Artificial sequence
<400> 135
cctacacgac gctcttccga tctgctactc ctacctatct cccctt 46
<210> 136
<211> 46
<212> DNA
<213> Artificial sequence
<400> 136
gttccttggc acccgagaat tccaaagcca gttgattagg gtgctt 46
<210> 137
<211> 45
<212> DNA
<213> Artificial sequence
<400> 137
cctacacgac gctcttccga tctctcggag ctggtaaaaa gaggc 45
<210> 138
<211> 47
<212> DNA
<213> Artificial sequence
<400> 138
gttccttggc acccgagaat tccaacgttg tagatgtggt cgttacc 47
<210> 139
<211> 45
<212> DNA
<213> Artificial sequence
<400> 139
cctacacgac gctcttccga tcttggcaac tgactagttc cccta 45
<210> 140
<211> 46
<212> DNA
<213> Artificial sequence
<400> 140
gttccttggc acccgagaat tccatggccc ctaagataga ggagac 46
<210> 141
<211> 45
<212> DNA
<213> Artificial sequence
<400> 141
cctacacgac gctcttccga tctcaatacc aaacgcccct cttcg 45
<210> 142
<211> 50
<212> DNA
<213> Artificial sequence
<400> 142
gttccttggc acccgagaat tccaccggag tagtaagtta caatatggga 50
<210> 143
<211> 44
<212> DNA
<213> Artificial sequence
<400> 143
cctacacgac gctcttccga tctagggttt atcgtgtgag caca 44
<210> 144
<211> 49
<212> DNA
<213> Artificial sequence
<400> 144
gttccttggc acccgagaat tccagtacga tgtctagtga tgagtttgc 49
<210> 145
<211> 48
<212> DNA
<213> Artificial sequence
<400> 145
cctacacgac gctcttccga tcttcaatag gagctgtatt tgccatca 48
<210> 146
<211> 48
<212> DNA
<213> Artificial sequence
<400> 146
gttccttggc acccgagaat tccatgctgt tagagaaatg aatgagcc 48
<210> 147
<211> 48
<212> DNA
<213> Artificial sequence
<400> 147
cctacacgac gctcttccga tctagtagaa gaaccctcca taaacctg 48
<210> 148
<211> 46
<212> DNA
<213> Artificial sequence
<400> 148
gttccttggc acccgagaat tccacgctgc atgtgccatt aagata 46
<210> 149
<211> 45
<212> DNA
<213> Artificial sequence
<400> 149
cctacacgac gctcttccga tctcctttca tgatcacgcc ctcat 45
<210> 150
<211> 46
<212> DNA
<213> Artificial sequence
<400> 150
gttccttggc acccgagaat tccatggtgg ccaattgatt tgatgg 46
<210> 151
<211> 45
<212> DNA
<213> Artificial sequence
<400> 151
cctacacgac gctcttccga tcttattcct agaaccaggc gacct 45
<210> 152
<211> 46
<212> DNA
<213> Artificial sequence
<400> 152
gttccttggc acccgagaat tccaggcatg aaactgtggt ttgctc 46
<210> 153
<211> 45
<212> DNA
<213> Artificial sequence
<400> 153
cctacacgac gctcttccga tctcctctag agcccactgt aaagc 45
<210> 154
<211> 47
<212> DNA
<213> Artificial sequence
<400> 154
gttccttggc acccgagaat tccacgttca ttttggttct cagggtt 47
<210> 155
<211> 48
<212> DNA
<213> Artificial sequence
<400> 155
cctacacgac gctcttccga tctcccacct ccaaatatct catcaaca 48
<210> 156
<211> 46
<212> DNA
<213> Artificial sequence
<400> 156
gttccttggc acccgagaat tccacctata atcactgtgc ccgctc 46
<210> 157
<211> 46
<212> DNA
<213> Artificial sequence
<400> 157
cctacacgac gctcttccga tctaccatca gcctactcat tcaacc 46
<210> 158
<211> 47
<212> DNA
<213> Artificial sequence
<400> 158
gttccttggc acccgagaat tccatcatta tgtgttgtcg tgcaggt 47
<210> 159
<211> 45
<212> DNA
<213> Artificial sequence
<400> 159
cctacacgac gctcttccga tctctctcag ccctcctaat gacct 45
<210> 160
<211> 46
<212> DNA
<213> Artificial sequence
<400> 160
gttccttggc acccgagaat tccaaaggct cagaaaaatc ctgcga 46
<210> 161
<211> 48
<212> DNA
<213> Artificial sequence
<400> 161
cctacacgac gctcttccga tcttcctaaa cacatccgta ttactcgc 48
<210> 162
<211> 48
<212> DNA
<213> Artificial sequence
<400> 162
gttccttggc acccgagaat tccagttgag ccaataatga cgtgaagt 48
<210> 163
<211> 45
<212> DNA
<213> Artificial sequence
<400> 163
cctacacgac gctcttccga tctccaaaca tcactttggc ttcga 45
<210> 164
<211> 49
<212> DNA
<213> Artificial sequence
<400> 164
gttccttggc acccgagaat tccacgttga gttgtggtag tcaaaatgt 49
<210> 165
<211> 43
<212> DNA
<213> Artificial sequence
<400> 165
cctacacgac gctcttccga tctgtgcggc ttcgacccta tat 43
<210> 166
<211> 54
<212> DNA
<213> Artificial sequence
<400> 166
gttccttggc acccgagaat tccacgtttt gtttaaacta tataccaatt cggt 54
<210> 167
<211> 54
<212> DNA
<213> Artificial sequence
<400> 167
cctacacgac gctcttccga tctaccatct cacttctagg aatactagta tatc 54
<210> 168
<211> 50
<212> DNA
<213> Artificial sequence
<400> 168
gttccttggc acccgagaat tccattggag taggtttagg ttatgtacgt 50
<210> 169
<211> 51
<212> DNA
<213> Artificial sequence
<400> 169
cctacacgac gctcttccga tcttcgtccc aacaattata ttactaccac t 51
<210> 170
<211> 45
<212> DNA
<213> Artificial sequence
<400> 170
gttccttggc acccgagaat tccactggat aagtggcgtt ggctt 45
<210> 171
<211> 47
<212> DNA
<213> Artificial sequence
<400> 171
cctacacgac gctcttccga tctcattcac agccacagaa ctaatca 47
<210> 172
<211> 46
<212> DNA
<213> Artificial sequence
<400> 172
gttccttggc acccgagaat tccaagttgt tggctcagga gtttga 46
<210> 173
<211> 45
<212> DNA
<213> Artificial sequence
<400> 173
cctacacgac gctcttccga tctggtcaat agtacttgcc gcagt 45
<210> 174
<211> 46
<212> DNA
<213> Artificial sequence
<400> 174
gttccttggc acccgagaat tccacagggg gtttggatga gaatgg 46
<210> 175
<211> 45
<212> DNA
<213> Artificial sequence
<400> 175
cctacacgac gctcttccga tctcgcactc acagtcgcat cataa 45
<210> 176
<211> 46
<212> DNA
<213> Artificial sequence
<400> 176
gttccttggc acccgagaat tccaagcccc attgtgttgt ggtaaa 46
<210> 177
<211> 45
<212> DNA
<213> Artificial sequence
<400> 177
cctacacgac gctcttccga tctcgacatc attaccgggt tttcc 45
<210> 178
<211> 53
<212> DNA
<213> Artificial sequence
<400> 178
gttccttggc acccgagaat tccatggtta tagtagtgtg catggttatt act 53
<210> 179
<211> 45
<212> DNA
<213> Artificial sequence
<400> 179
cctacacgac gctcttccga tctatccatt gtcgcatcca ccttt 45
<210> 180
<211> 52
<212> DNA
<213> Artificial sequence
<400> 180
gttccttggc acccgagaat tccaatttga agaactgatt aatgtttggg tc 52
<210> 181
<211> 51
<212> DNA
<213> Artificial sequence
<400> 181
cctacacgac gctcttccga tctaattata tccttcttgc tcatcagttg a 51
<210> 182
<211> 46
<212> DNA
<213> Artificial sequence
<400> 182
gttccttggc acccgagaat tccagagtca ggggtggaga cctaat 46
<210> 183
<211> 45
<212> DNA
<213> Artificial sequence
<400> 183
cctacacgac gctcttccga tctccacccc ctagcagaaa atagc 45
<210> 184
<211> 46
<212> DNA
<213> Artificial sequence
<400> 184
gttccttggc acccgagaat tccagatgga cccggagcac ataaat 46
<210> 185
<211> 45
<212> DNA
<213> Artificial sequence
<400> 185
cctacacgac gctcttccga tctgcagcct agcattagca ggaat 45
<210> 186
<211> 46
<212> DNA
<213> Artificial sequence
<400> 186
gttccttggc acccgagaat tccaccaggc gtttaatggg gtttag 46
<210> 187
<211> 46
<212> DNA
<213> Artificial sequence
<400> 187
cctacacgac gctcttccga tcttccccct ctacctaaaa ctcaca 46
<210> 188
<211> 53
<212> DNA
<213> Artificial sequence
<400> 188
gttccttggc acccgagaat tccattttag gtaatagctt ttctagtcag gtt 53
<210> 189
<211> 47
<212> DNA
<213> Artificial sequence
<400> 189
cctacacgac gctcttccga tcttcctctc tttcttcttc ccactca 47
<210> 190
<211> 46
<212> DNA
<213> Artificial sequence
<400> 190
gttccttggc acccgagaat tccaagagta tgatggggtg gtggtt 46
<210> 191
<211> 45
<212> DNA
<213> Artificial sequence
<400> 191
cctacacgac gctcttccga tctaacactc accaagacct caacc 45
<210> 192
<211> 47
<212> DNA
<213> Artificial sequence
<400> 192
gttccttggc acccgagaat tccagggttt agtaatgggg tttgtgg 47
<210> 193
<211> 45
<212> DNA
<213> Artificial sequence
<400> 193
cctacacgac gctcttccga tctacaagaa caccaatgac cccaa 45
<210> 194
<211> 49
<212> DNA
<213> Artificial sequence
<400> 194
gttccttggc acccgagaat tccagcggat gattcagcca taatttacg 49
<210> 195
<211> 46
<212> DNA
<213> Artificial sequence
<400> 195
cctacacgac gctcttccga tcttcagaaa cctgaaacat cggcat 46
<210> 196
<211> 46
<212> DNA
<213> Artificial sequence
<400> 196
gttccttggc acccgagaat tccaggctgc aataatgaag ggcaag 46
<210> 197
<211> 45
<212> DNA
<213> Artificial sequence
<400> 197
cctacacgac gctcttccga tcttacacaa tcaaagacgc cctcg 45
<210> 198
<211> 47
<212> DNA
<213> Artificial sequence
<400> 198
gttccttggc acccgagaat tccatggagg atggggatta ttgctag 47
<210> 199
<211> 45
<212> DNA
<213> Artificial sequence
<400> 199
cctacacgac gctcttccga tctaacctga atcggaggac aacca 45
<210> 200
<211> 46
<212> DNA
<213> Artificial sequence
<400> 200
gttccttggc acccgagaat tccactttgg gtgctaatgg tggagt 46
<210> 201
<211> 48
<212> DNA
<213> Artificial sequence
<400> 201
cctacacgac gctcttccga tctcaacaac cgctatgtat ttcgtaca 48
<210> 202
<211> 52
<212> DNA
<213> Artificial sequence
<400> 202
gttccttggc acccgagaat tccaacggta aatggcttta tgtactatgt ac 52
Claims (10)
1. A primer set for mitochondrial whole genome sequencing, comprising: at least two subsets of primers, said set of primers comprising 101 pairs of primers as set forth in SEQ ID NO. 1-202.
2. The primer set of claim 1, wherein the primer set comprises 2, 3 or 4 primer subsets.
3. The primer set as claimed in claim 2, wherein the primer set comprises a first primer subset shown as SEQ ID NO.1-102 and a second primer subset shown as SEQ ID NO. 103-202.
4. The primer set of claim 2, wherein amplification products of any two primer pairs within the same primer subset do not overlap;
preferably, any one amplification product generated with a certain subset of primers will have an overlapping region with one or more amplification products of the other subset.
5. A PCR amplification system comprising the primer set according to any one of claims 1 to 4.
6. The PCR amplification system of claim 5, further comprising a buffer system, wherein the primer set is located in the buffer system;
preferably, each subset of primers corresponds to one of said buffer systems.
7. A kit comprising the primer set according to any one of claims 1 to 4.
8. The kit as claimed in claim 7, wherein the primer set in the kit comprises a first primer subset shown as SEQ ID NO.1-102 and a second primer subset shown as SEQ ID NO.103-202,
the concentration of the primers shown by SEQ ID NO.1-100 in the first primer subset is C1, the concentration of the primers shown by SEQ ID NO.101-102 is C2, the concentration of the primers shown by SEQ ID NO.103-104 in the second primer subset is C3, the concentration of the primers shown by SEQ ID NO.105-200 is C4, and the concentration of the primers shown by SEQ ID NO.201-202 is C5.
9. Use of the primer set according to any one of claims 1 to 4, the PCR amplification system according to any one of claims 5 to 6 or the kit according to any one of claims 7 to 8 for high throughput sequencing of the human mitochondrial whole genome.
10. A method for high throughput sequencing of a human mitochondrial whole genome, the method comprising the steps of:
performing PCR amplification on a genomic DNA sample to be tested by using the primer set of any one of claims 1 to 4, thereby obtaining a mixture of amplification products of different primer subsets, and performing sequencing analysis, wherein the method is a non-disease diagnosis method and a non-disease therapeutic method;
preferably, the amplification products of different primer subsets are mixed in equimolar amount, and subjected to a second round of amplification, and then subjected to machine sequencing analysis after adding the adaptor and index sequences.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210335789.0A CN114480578B (en) | 2022-03-31 | 2022-03-31 | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202210335789.0A CN114480578B (en) | 2022-03-31 | 2022-03-31 | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN114480578A true CN114480578A (en) | 2022-05-13 |
| CN114480578B CN114480578B (en) | 2023-08-18 |
Family
ID=81488310
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202210335789.0A Active CN114480578B (en) | 2022-03-31 | 2022-03-31 | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN114480578B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117070511A (en) * | 2023-08-16 | 2023-11-17 | 广州卿泽生物科技有限公司 | Primer group for amplifying mitochondrial whole genome and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012162647A1 (en) * | 2011-05-26 | 2012-11-29 | University Of Cincinnati | Compositions and methods for screening for creatine transporter deficiency |
| CN103173441A (en) * | 2013-02-05 | 2013-06-26 | 深圳华大基因研究院 | Amplification method, primer, sequencing method and mutation detection method of mitochondria whole genome DNA (Deoxyribonucleic Acid) |
| CN106399553A (en) * | 2016-11-09 | 2017-02-15 | 上海添音生物科技有限公司 | Human mitochondria whole genome high-throughput sequencing method based on multiple PCR |
| AU2021105278A4 (en) * | 2021-08-11 | 2021-10-07 | Hainan University | Whole Genome High-Efficiency Gene Region Enriching and Sequencing Method |
| CN114015749A (en) * | 2021-10-18 | 2022-02-08 | 浙江博圣生物技术股份有限公司 | Construction method of mitochondrial genome sequencing library based on high-throughput sequencing and amplification primer |
-
2022
- 2022-03-31 CN CN202210335789.0A patent/CN114480578B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2012162647A1 (en) * | 2011-05-26 | 2012-11-29 | University Of Cincinnati | Compositions and methods for screening for creatine transporter deficiency |
| CN103173441A (en) * | 2013-02-05 | 2013-06-26 | 深圳华大基因研究院 | Amplification method, primer, sequencing method and mutation detection method of mitochondria whole genome DNA (Deoxyribonucleic Acid) |
| CN106399553A (en) * | 2016-11-09 | 2017-02-15 | 上海添音生物科技有限公司 | Human mitochondria whole genome high-throughput sequencing method based on multiple PCR |
| AU2021105278A4 (en) * | 2021-08-11 | 2021-10-07 | Hainan University | Whole Genome High-Efficiency Gene Region Enriching and Sequencing Method |
| CN114015749A (en) * | 2021-10-18 | 2022-02-08 | 浙江博圣生物技术股份有限公司 | Construction method of mitochondrial genome sequencing library based on high-throughput sequencing and amplification primer |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN117070511A (en) * | 2023-08-16 | 2023-11-17 | 广州卿泽生物科技有限公司 | Primer group for amplifying mitochondrial whole genome and application thereof |
| CN117070511B (en) * | 2023-08-16 | 2024-02-02 | 广州卿泽生物科技有限公司 | Primer group for amplifying human mitochondrial whole genome and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN114480578B (en) | 2023-08-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP3066114B1 (en) | Plurality of transposase adapters for dna manipulations | |
| EP0849364B1 (en) | Method for the direct, exponential amplification and sequencing of DNA molecules and its application | |
| EP1546345B1 (en) | Genome partitioning | |
| CN107012225B (en) | STR locus detection kit and detection method based on high-throughput sequencing | |
| CN110079592B (en) | High throughput sequencing-targeted capture of target regions for detection of genetic mutations and known, unknown gene fusion types | |
| CN109593757B (en) | Probe and method for enriching target region by using same and applicable to high-throughput sequencing | |
| WO2018157775A1 (en) | Method for marking 5-formyl cytosine and use thereof in single base resolution sequencing | |
| Ray et al. | Enhancer-like properties of an RNA element that modulates Tombusvirus RNA accumulation | |
| CN114480578B (en) | Primer set for mitochondrial whole genome sequencing and high-throughput sequencing method | |
| CN112941635A (en) | Second-generation sequencing library building kit and method for improving library conversion rate | |
| CN115820595A (en) | Optimized polymerase for amplifying target nucleic acid, composite system and application | |
| JPS63500006A (en) | Nucleic acid base sequencing method using exonuclease inhibition | |
| CN109957557B (en) | DNA polymerase and method for producing same | |
| CN108330138B (en) | A kind of external synthetic method and its kit of sgRNA | |
| CN110331446A (en) | DNA methylation marker kit for screening and method | |
| CN110241212B (en) | Primer set for sequencing and detecting BRCA1 and BRCA2 gene amplicons and application thereof | |
| CN109825552A (en) | A kind of primer and method for being enriched with to target area | |
| EP3759243B1 (en) | Methods and compositions for enriching nucleic acids | |
| CN113969307A (en) | DNA methylation sequencing library, preparation method and DNA methylation detection method | |
| CN113174380A (en) | Mutant Taq DNA polymerase and preparation method and application thereof | |
| CN113215228A (en) | Fragile X syndrome FMR1 gene detection primer, kit and application thereof | |
| CN111534513A (en) | Reverse transcription primer pool and kit for removing ribosomal RNA and method for removing ribosomal RNA | |
| CN117050967B (en) | Method for improving GC (gas chromatography) balance of second-generation sequencing library | |
| CN112322749B (en) | Kit for simultaneously detecting STR gene locus and SNP locus and use method thereof | |
| WO2023116373A1 (en) | Method for generating population of labeled nucleic acid molecules and kit for the method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |