CN112301054A

CN112301054A - Method for expressing viral proteins in eukaryotic cells by using K1E phage RNA polymerase and dual plasmid system of promoter

Info

Publication number: CN112301054A
Application number: CN202011145191.2A
Authority: CN
Inventors: 冯涛声; 刘定祥; 李淑敏; 丘祖纯
Original assignee: South China Agricultural University
Current assignee: South China Agricultural University
Priority date: 2020-10-23
Filing date: 2020-10-23
Publication date: 2021-02-02

Abstract

The invention discloses a method for expressing protein in eukaryotic cytoplasm by using a double plasmid system of K1E phage RNA polymerase and a promoter. The invention constructs NP868R cap enzyme segment to a carrier containing K1E RNA polymerase expression sequence to obtain a recombinant carrier A; constructing a cDNA sequence of a target protein to a vector containing a K1E promoter to obtain a recombinant vector B; and transfecting the recombinant vector A and the recombinant vector B into a host eukaryotic cell for expression to obtain the target protein. The method provided by the invention can express the protein which is difficult to express by the traditional protein exogenous expression method, and is beneficial to developing specific antiviral drugs and effective vaccines for preventing virus infection.

Description

Method for expressing viral proteins in eukaryotic cells by using K1E phage RNA polymerase and dual plasmid system of promoter

Technical Field

The invention relates to the field of molecular biology, in particular to a method for expressing protein in eukaryotic cytoplasm by using a double plasmid system of K1E phage RNA polymerase and a promoter.

Background

Most eukaryotic expression systems, which utilize the nuclear transcription and post-transcriptional machinery of the host cell, have been widely used in the life science field, while plasmid-based expression systems still have significant drawbacks. First, the transfer of plasmid DNA from cytoplasm to nucleus is a rate-limiting process in non-dividing cells, where this barrier limiting the efficiency of plasmid-based eukaryotic expression systems is overcome due to the transient disintegration of the nuclear membrane during mitosis, and thus this factor limiting the transfer of foreign DNA to the nucleus in quiescent cells is a major drawback for non-viral gene therapy and DNA vaccine vaccination efficacy; second, plasmid-based expression systems rely on host nuclear RNA polymerase II, a moderate processive enzyme with elongation rates of 25 and 6 nucleotides/sec in vitro and in cells, respectively; thirdly, the standard plasmid-based eukaryotic expression system utilizes the transcription mechanism of the host cell to compete with the host cell genome for transgene expression; fourth, some genes have potential intron sequences that can be spliced into the nucleus, resulting in the failure of gene expression. These challenges above all limit the efficiency of eukaryotic expression systems.

Disclosure of Invention

The primary objective of the present invention is to overcome the drawbacks and deficiencies of the prior art and to provide a method for expressing proteins in eukaryotic cytoplasm using a dual plasmid system of K1E phage RNA polymerase and promoter.

It is another object of the present invention to provide the use of the above method.

The purpose of the invention is realized by the following technical scheme:

a method for expressing proteins in eukaryotic cytoplasm by using a double plasmid system of K1E phage RNA polymerase and promoter, comprising the following steps:

(1) constructing a cap enzyme fragment NP868R to a vector containing a K1E RNA polymerase expression sequence to obtain a recombinant vector A;

(2) constructing a cDNA sequence of a target protein to a vector containing a K1E promoter to obtain a recombinant vector B;

(3) transfecting the recombinant vector A obtained in the step (1) and the recombinant vector B obtained in the step (2) into a host eukaryotic cell for expression to obtain the target protein.

The method for expressing protein in eukaryotic cytoplasm by using the double plasmid system of the K1E phage RNA polymerase and the promoter further comprises the following steps:

(4) and (3) detection:

A) collecting transfected cells, and freezing and thawing to obtain a detection sample; evaluating the expression efficiency of the double plasmid system using the K1E phage RNA polymerase and the promoter through the detection of the target protein;

B) when the protein of interest is a fluorescent protein, one can choose to preliminarily evaluate the expression efficiency of the two-plasmid system using the K1E phage RNA polymerase and the promoter by observation of the fluorescence intensity.

The sequence of the NP868R cap enzyme fragment in the step (1) is shown as SEQ ID NO. 1.

The construction described in step (1) is preferably carried out by constructing the NP868R cap enzyme fragment into a vector containing the K1E RNA polymerase expression sequence by homologous recombination.

The steps of homologous recombination are preferably as follows: amplifying an NP868R cap enzyme fragment with a sequence shown in SEQ ID NO.1 by using primers NP868R-F and NP868R-R to obtain a fragment A; cutting the vector into linear fragments by EcoRI and BamHI double enzyme digestion to obtain a fragment B; carrying out homologous recombination connection on the fragment A and the fragment B through a homologous recombinase to obtain a recombinant vector A;

NP868R-F：5’-GACTCACTATAGGGCGAATTGCCACCATGGCTTCTTTAG-3’；

NP868R-R：5’-AGAACCTCCACCTCCGGATCCATTTTTGCGCAGACAAATAAACCC-3’。

the vector containing the K1E RNA polymerase expression sequence described in step (1) is preferably the vector pXIP-myc-K1 ERNAP.

The vector pXIP-myc-K1ERNAP is prepared by the following steps: the myc-K1ERNAP-IRES-puroR with the sequence shown in SEQ ID NO.2 was cloned into the vector pXJ40 through EcoRI and NotI cleavage sites to obtain the vector pXIP-myc-K1 ERNAP.

The target protein in the step (2) is a viral protein, or a viral protein and a fluorescent protein.

The virus is preferably avian Infectious Bronchitis Virus (IBV) and coronavirus.

The virus protein is preferably at least one of a virus structural protein and a virus non-structural protein.

The virus non-structural protein is preferably at least one of nsp3, nsp4, nsp12 and nsp 13.

The virus structural protein is preferably IBVS structural protein.

The fluorescent protein is green fluorescent protein.

The construction described in step (2) is preferably carried out by constructing the cDNA sequence of the protein of interest into a vector containing the K1E promoter by homologous recombination.

The sequence of the K1E promoter in the step (2) is as follows: TTACTGGACACTATAGAAG are provided.

The vector containing the K1E promoter in the step (2) also comprises a luciferase HiBiT tag sequence; the vector pK1E-HiBiT is preferred.

The pK1E-HiBiT is prepared by the following steps: k1 Epro-3' -UTR-gHDV Rz with the sequence shown as SEQ ID NO.3 is constructed into a vector pEGFP-C1 through an enzyme cutting site Asel and MluI to obtain a vector pK 1E-HiBiT.

The steps of homologous recombination are preferably as follows:

1) taking chicken infectious bronchitis virus cDNA as a template, and amplifying by using the following primers to obtain nsp3, nsp4, nsp12, nsp13 and IBVS cDNA sequences;

nsp3-F：5’-ATCTGGAGGAGGTGGATCCGGTAAGACTGTCACCTTTG-3’；

nsp3-R：5’-GAAAAAGGCAGGTTAACTCGAGTTAGCTAACTGAGCTCGC-3’；

nsp4-F：5’-ATCTGGAGGAGGTGGATCCGGTATTGTTAGCGGCACCTTT-3’；

nsp4-R：5’-GCTCAGTTAGCTAACTCGAGCTATTGTAATCTACTAACACCAATAGAGTAACG-3’；

nsp12-F：5’-GAGGAGGTGGATCCTTTAAACGGGTACGGGGTAGCAGTGA-3’；

nsp12-R：5’-AGAGCTCCTACGACTTTACCTCGAGTTAGCTAACTGAGCTCGCTTT-3’；

nsp13-F：5’-GCGGATCTGGAGGAGGTGGATCCTGTGGCGTTTGTGTAGT-3’；

nsp13-R：5’-GTGAAACAAGTCTGCAATAACTCGAGTTAGCTAACTGAGCTCGC-3’；

IBVS-F：5’-CAGACACCGAATTCCACCATGTTGGTAACACCTCTTTTAC-3’；

IBVS-R：5’-AGACCCAAAAAGTCTGTTTGAACCGAGCAGAAGCTGATCTC-3’；

2) the msfGFP fragment with the sequence shown as SEQ ID NO.4 is taken as a template, and a sequence C is obtained by amplification of primers SFV-GFP-F and SFV-GFP-R;

SFV-GFP-F：5’-GGTCCGAAGAGTGGGATCCCGTGAGTAAAGGTGAAGAACTC-3’；

SFV-GFP-R：5’-CAATTAATTACCCGGGATCCTTACTTGTACAGCTCATCC-3’。

3) cutting a vector pK1E-HiBiT into linear fragments through BamHI and XhoI, and respectively carrying out homologous recombination connection with the amplified nsp3, nsp4, nsp12, nsp13 cDNA sequences and sequence C; vector pK1E-HiBiT was cut into linear fragments by EcoRI and XhoI and ligated by homologous recombination with the IBVS cDNA sequence.

The host eukaryotic cell in the step (3) is an animal cell, preferably a human lung cancer cell H1299, an African green monkey kidney cell (Vero) and a human kidney epithelial cell line 293T.

The recombinant vector a and the recombinant vector B in step (3) are preferably expressed in a molar ratio of 1: 3, and (3) transfection.

The transfection described in step (3) is transient transfection.

The detection of the target protein in the step (4) comprises a protein immunoblotting method.

The method for expressing protein in eukaryotic cytoplasm by using the double plasmid system of the K1E bacteriophage RNA polymerase and the promoter is applied to protein expression, in particular to the application of protein which is difficult to express by the traditional protein exogenous expression method.

Compared with the prior art, the invention has the following advantages and effects:

in the invention, a K1E eukaryotic cytoplasmic expression viral protein system is constructed. This system relies on two components: 1) an artificial chimeric enzyme, comprising a 5' -capping enzyme NP868R and phage K1E RNA polymerase; 2) there are specific transcriptional transducible enzymes and DNA templates that provide artificial poly A. Once the K1E enzyme is expressed in the cytoplasm, cap-like and polyadenylated mRNA is produced independently of the transcription machinery of the host cell. The existing CMV eukaryotic expression system expresses the nsp3 and nsp4 of the IBV, which can not detect protein at all, but the K1E eukaryotic cytoplasmic expression system of the invention can ensure that the nsp3 and nsp4 proteins of the IBV have good transient expression efficiency in human lung cancer cells H1299, African green monkey kidney cells (Vero) and human kidney epithelial cell line 293T, so that the system is beneficial to developing specific antiviral drugs and effective vaccines for preventing viral infection, and is a good scientific and technological research means.

Drawings

FIG. 1 is a map of a plasmid of interest constructed by homologous recombination; wherein A is a map of plasmid pXIP-K1ERNAP-NP868R, B is a map of pK1Epro-HiBiT, and the target protein is represented by (G)₄S)₂Position between linker and 3' UTR.

FIG. 2 is a graph showing the results of detecting plasmid expression by the HiBiT reporter system. In the figure, luciferase luminescence assays were performed after expressing fluorescent proteins GFP and non-structural proteins Nsp3, Nsp12, Nsp13 on H1299 and 293T cells.

FIG. 3 is a graph showing the results of Western blotting for the expression of a target protein.

Detailed Description

The present invention will be described in further detail with reference to examples and drawings, but the present invention is not limited thereto.

EXAMPLE 1 construction of plasmid pXIP-K1ERNAP-NP868R

Using NP868R gene fragment (sequence shown in SEQ ID NO. 1) synthesized by the company as a template, designing pXIP-myc-K1ERNAP (based on vector pXJ40 disclosed in "Cloning, Expression, and Transcriptional Properties of the Human Enhancer Factor TEF-1, cell.1991: P551-568"; digesting pXJ40 with EcoRI and NotI, middle part of the sequence myc-K1ERNAP-IRES-purOR shown in SEQ ID NO.2, synthesized by King Zhi Biotech Limited, finally ligating pXJ40 obtained by digestion with EcoRI and NotI to the synthesized sequence to obtain primer NP868R-F, downstream NP 86829-R, used for amplifying NP 86825, amplifying NP868, ligating the homologous fragment with the synthesized fragment, and ligating the homologous fragment into a BamHI homologous fragment by linear digestion, and ligating the homologous fragment with BamHI, the ligation reaction system is shown in Table 1, and the reaction conditions are shown in Table 2; transforming the ligation products into escherichia coli DH5 alpha competent cells by a calcium chloride chemical transformation method, taking a proper amount of transformation products to perform coating culture in an ampicillin LB solid culture medium containing 100 mu g/ml, and finally selecting a plurality of single colonies to verify whether the cloning is successful or not by a PCR method, wherein primers used in the PCR are an upstream primer RBGI-F and a downstream primer NP 868R-R; selecting several monoclonals from the target plasmid, extracting plasmids, and performing enzyme digestion by EcoRI and XhoI to obtain two fragments with the sizes of 6189bp and 4598bp as target plasmids; further verifying whether the plasmid is successful, finally selecting a positive plasmid and sending the positive plasmid to a company for sequencing verification, determining that the positive plasmid pXIP-K1ERNAP-NP868R is obtained (the K1E RNA polymerase and the NP868R sequence are connected by two G4S amino acids), and the constructed positive plasmid map is shown in FIG. 1A.

NP 868R-F: 5'-GACTCACTATAGGGCGAATTGCCACCATGGCTTCTTTAG-3' (containing a Kozak sequence and an initiation codon ATG);

NP 868R-R: 5'-AGAACCTCCACCTCCGGATCCATTTTTGCGCAGACAAATAAACCC-3' (containing the stop codon TAA);

RBGI-F：5’-GCAACGTGCTGGTTATTGTG-3’。

TABLE 1 homologous recombination reaction System

TABLE 2 reaction conditions for homologous recombination

Example 2 construction of S protein and non-structural proteins into cloning vector pK1E-HiBiT

An adapted strain IBV-p65 was obtained by successively passaging and infecting 65 generations (p65) from a cell sample infected with IBV having cell adaptability on cells in the laboratory (i.e., Infectious Bronchitis Virus (IBV) of chickens, purchased from American Type Culture Collection, ATCC, and adapted to passage 3 generations on 10-day-old chick embryos and then transferred to Vero, purchased from American Type Culture Collection, ATCC). The experimental sample is obtained by infecting Vero cells with adapted strain IBV-p65, when all cells have cell fusion pathological effect, cracking the cells by Trizol, collecting the sample), extracting virus RNA, and performing reverse transcription to obtain cDNA, wherein the reverse transcription system is shown in Table 3, and the reaction conditions are shown in Table 4; designing primers of homologous arms identical to a vector pK 1Epro-3 '-UTR-gHDV Rz shown in SEQ ID NO.3, which has the same vector pK1E-HiBiT (the vector is pEGFP-C1, and CMV-EGFP-polyA is replaced by Asel and MluI to replace the K1 Epro-3' -UTR-gHDV Rz sequence of the vector shown in SEQ ID NO.3, which is synthesized by the company, carrying out double digestion of pEGFP-C1 by Asel and MluI, and then connecting the sequence synthesized by the company with the pEGFP-C1 after digestion to obtain a vector pK1E-HiBiT), amplifying gene fragments of several non-structural proteins, namely nsp3, nsp4, nsp12 and nsp13, and gene fragments of a structural protein IBVS by PCR with cDNA as a template, wherein the primers for amplifying the several fragments are shown in Table 5, the reaction system is shown in Table 6, and the reaction conditions are shown in Table 7; vector pK1E-HiBiT is cut into linear fragments by a BamHI and XhoI (used for constructing the non-structural protein in the invention) or EcoRI and XhoI (used for constructing the IBVS structural protein in the invention) enzyme cutting method, and the two fragments are subjected to homologous recombination and connection by homologous recombinase (the reaction system and conditions are the same as those in example 1); transforming the ligation product into Escherichia coli DH5 alpha competent cells by a calcium chloride chemical transformation method, taking a proper amount of transformation product to carry out coating culture in a kanamycin LB solid culture medium containing 50 mu g/ml, finally selecting a plurality of monoclones from the transformation product to extract plasmids, carrying out enzyme digestion on the plasmids pK1Epro-IBV-nsp3, pK1Epro-IBV-nsp4, pK1Epro-IBV-nsp12 and pK1Epro-IBV-nsp13 by BamHI and XhoI to respectively obtain 4758bp +3665bp, 1551bp +3665bp, 2788bp +3665bp and 1806bp +3665bp fragments as target plasmids, carrying out enzyme digestion on the pK1Epro-IBV-S by HindIII to obtain 4878bp +3665bp fragments as target plasmids, further verifying whether the plasmids are successful, and finally sending the positive plasmids in the plasmids to an EcoRI company for sequencing verification. The map for constructing the target protein is shown in FIG. 1B.

TABLE 3 reverse transcription reaction System

TABLE 4 reverse transcription reaction conditions

TABLE 5 primer sequences

Primer name	Primer sequence (5 '-3')
		nsp3-F	ATCTGGAGGAGGTGGATCCGGTAAGACTGTCACCTTTG
nsp3-R	GAAAAAGGCAGGTTAACTCGAGTTAGCTAACTGAGCTCGC
		nsp4-F	ATCTGGAGGAGGTGGATCCGGTATTGTTAGCGGCACCTTT
nsp4-R	GCTCAGTTAGCTAACTCGAGCTATTGTAATCTACTAACACCAATAGAGTAACG
		nsp12-F	GAGGAGGTGGATCCTTTAAACGGGTACGGGGTAGCAGTGA
nsp12-R	AGAGCTCCTACGACTTTACCTCGAGTTAGCTAACTGAGCTCGCTTT
		nsp13-F	GCGGATCTGGAGGAGGTGGATCCTGTGGCGTTTGTGTAGT
nsp13-R	GTGAAACAAGTCTGCAATAACTCGAGTTAGCTAACTGAGCTCGC
		IBVS-F	CAGACACCGAATTCCACCATGTTGGTAACACCTCTTTTAC
IBVS-R	AGACCCAAAAAGTCTGTTTGAACCGAGCAGAAGCTGATCTC

TABLE 6 PCR reaction System

TABLE 7 reaction conditions

Example 3 construction of msfGFP fragment into cloning vector pK1E-HiBiT

The msfGFP fragment (shown as SEQ ID NO. 4) synthesized by Senseki was used as a template to amplify the msfGFP fragment, the upstream primer SFV-GFP-F, the downstream primer SFV-GFP-R and the vector pK1E-HiBiT were cut into linear fragments by BamHI and XhoI cleavage sites, the two fragments were ligated by homologous recombination to obtain pK1E-HiBiT-msfGFP, and the plasmid construction was performed in the same manner as in example 2.

SFV-GFP-F：5’-GGTCCGAAGAGTGGGATCCCGTGAGTAAAGGTGAAGAACTC-3’；

SFV-GFP-R：5’-CAATTAATTACCCGGGATCCTTACTTGTACAGCTCATCC-3’。

Example 4 plasmid expression by transfection experiments

The plasmid pXIP-K1ERNAP-NP868R was mixed with pK1Epro-IBV-S, pK1Epro-IBV-nsp3, pK1Epro-IBV-nsp4, pK1Epro-IBV-nsp12, pK1Epro-IBV-nsp13, pK1Epro-IBV-msfGFP plasmid at a molar ratio of 1: 3, adding a Transfection Reagent (Transfection EL Transfection Reagent, FT201-2, all formula gold) according to the company instructions, mixing with the above plasmid, standing for 20 minutes, then adding the plasmid Transfection Reagent mixture dropwise to three cell lines of human lung cancer cells H1299(American Type Culture Collection, ATCC), African green monkey kidney cells (Vero, American Type Culture Collection, ATCC) and human kidney epithelial cells 293T (American Type Culture Collection, ATCC) laid one day before, and collecting a cell protein sample and a cell freeze-thawed sample three times after Transfection for 24 hours.

Example 5 detection of protein expression by HiBiT reporter System and Western immunoblotting and HiBiT blotting

The expression conditions of the protein plasmids are obtained through a HiBiT report system, and the specific steps are as follows: the cell freeze-thaw samples of example 4 were removed, vortexed thoroughly, and processed according to promega corporation

According to the specification of the HiBiT Lytic Detection System kit, 60 mu l of each sample is taken, mixed liquid mixed with LgBiT protein, HiBiT Lytic Substrate and HiBiT buffer solution is added in equal amount, the mixture is fully blown and uniformly mixed, the mixture is subpackaged into 96-well plates, the luminescence condition is detected through an enzyme labeling instrument, and the expression condition of the plasmid is preliminarily judged, wherein the expression condition is shown in figure 2.

By HiBiT protein immunoblottingThe protein expression is tested by a tracing method (Western Blot), and the specific steps are as follows: the protein samples collected in example 4 were removed and boiled in a metal bath at 95 ℃ for 10 minutes, the same amount of each protein was subjected to a protein electrophoresis test in SDS-PAGE gel, the proteins were transferred to NC membranes by a membrane transfer test, the NC membranes were subjected to a blocking test with 5% skim milk, and finally the protein samples were subjected to a promega corporation test

The HiBiT Blotting System kit incubates the target protein, as shown in FIG. 3.

The results of FIG. 2 and the results of FIG. 3 indicate that a method of expressing viral proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter is feasible and effective.

The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention should be construed as equivalents thereof, and all such changes, modifications, substitutions, combinations, and simplifications are intended to be included in the scope of the present invention.

Sequence listing

<120> method for expressing protein in eukaryotic cytoplasm using double plasmid system of K1E phage RNA polymerase and promoter

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2604

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> NP868R sequence

<400> 1

atggcttctt tagataattt agtggcacga tatcagaggt gctttaatga ccagtctctt 60

aaaaatagta ctattgaact tgaaatacgt tttcaacaga taaatttttt attattcaaa 120

accgtatatg aggcacttgt ggcacaagag atccctagca ccatctccca cagcatccgc 180

tgcatcaaaa aagttcacca tgaaaaccac tgccgggaaa aaattttgcc gtcggaaaat 240

ctttacttca aaaaacagcc tctcatgttt tttaagtttt cagagcctgc atctctgggc 300

tgtaaggtct cgctggccat cgagcagccc attcgtaaat ttatcttgga ctcctccatt 360

ctcgttcggc tcaaaaatcg tacgaccttt cgggtatctg aactttggaa aatagagctt 420

accattgtaa agcagctgat gggaagcgag gtctctgcaa aacttgccgc tttcaaaacg 480

cttctgtttg acaccccaga gcaacaaacg acaaaaaata tgatgacgtt aataaaccca 540

gatgacgaat atctttacga aatagaaata gagtatacag gaaagcccga atccctaacg 600

gcggcagatg ttataaaaat taaaaacacg gtgttgacac ttatttctcc aaaccattta 660

atgctaacag cctaccacca ggccattgaa ttcattgcct cccatatact gtcctcagaa 720

atccttcttg ctcgtattaa gagcgggaag tgggggctta aacgcctcct cccccaggtg 780

aaatccatga ccaaagcgga ttacatgaaa ttttatccgc ccgttggcta ctatgtaacg 840

gacaaagcag atggaattag aggcatcgcc gtcattcagg acacgcaaat ttatgtggtt 900

gcagaccagt tatacagcct aggtaccacc ggcattgaac cccttaaacc aaccattttg 960

gacggtgaat ttatgcctga aaaaaaagaa ttttatgggt ttgacgtcat catgtatgag 1020

ggcaatctat tgacgcaaca ggggtttgaa acaagaattg agtctttaag caagggcatt 1080

aaagtcttac aagcgtttaa cataaaagca gaaatgaagc cctttatttc gctaacaagt 1140

gcagatccca acgtgctcct caaaaacttt gaaagcattt ttaagaaaaa aactcgccca 1200

tattctattg atggcatcat tttagtagaa cctggcaatt cttatctaaa tacaaacacc 1260

tttaagtgga agcccacctg ggataacaca ttagactttt tggtgcgaaa atgtccggag 1320

agtttaaacg taccagagta cgcgcccaaa aaagggtttt ccctgcatct actatttgta 1380

ggcatctccg gagagctttt taaaaaatta gcgctaaatt ggtgtccagg atatacgaaa 1440

ctattccccg ttacacagcg caaccaaaac tactttccag tacagttcca gccatcggat 1500

tttccattgg catttcttta ttaccaccca gatacctcgt cattttctaa tatagatgga 1560

aaggtccttg aaatgcgttg tcttaagaga gaaatcaatc acgtcagctg ggaaattgta 1620

aaaatccggg aggataggca gcaggatctt aaaaccggcg ggtattttgg caatgatttc 1680

aaaacagccg aactcacatg gcttaactat atggatccct tttcctttga ggagctggca 1740

aagggccctt ctggaatgta cttcgccggt gccaaaaccg gcatataccg cgctcaaaca 1800

gcacttattt cctttattaa acaagaaatc atccaaaaaa taagtcacca atcctgggtt 1860

atcgatcttg gaataggaaa agggcaggac ctaggacgtt acctggacgc agggataagg 1920

catcttgttg ggatcgataa ggatcaaacc gcgcttgcgg agcttgttta tcgaaaattt 1980

tcgcatgcta cgacccgaca gcacaagcac gctaccaaca tttacgtgtt gcatcaagac 2040

ctcgcagagc ctgcgaaaga aatcagcgaa aaggtacacc aaatttacgg gtttcccaag 2100

gagggagctt cttccattgt tagcaacctg tttattcact atcttatgaa aaacacgcag 2160

caggtggaaa acctggccgt tctgtgccat aagcttcttc agccgggggg aatggtgtgg 2220

tttaccacca tgttgggaga acaggtctta gaattacttc atgaaaatag aatagagctc 2280

aatgaagtat gggaggctcg tgaaaacgaa gtggtcaaat ttgctattaa acgtctcttt 2340

aaagaggata tattacagga aactgggcaa gaaattggag tcctgttacc cttcagcaat 2400

ggcgacttct acaatgaata tcttgtgaac acagcgtttt taattaaaat atttaaacat 2460

cacggctttt ccctagttca aaagcagtcc tttaaggact ggattccaga atttcaaaac 2520

tttagtaaaa gtttgtataa aattcttaca gaagccgata aaacttggac aagccttttt 2580

gggtttattt gtctgcgcaa aaat 2604

<210> 2

<211> 3946

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> myc-K1ERNAP-IRES-puroR

<400> 2

atggagcaga agctgatctc agaggaggac ctgggatccg gaggtggagg ttctggcgga 60

ggagggtcta tgcaagatct gcacgccatc cagctccagc tggaggaaga gatgttcaat 120

ggcggcatta gaagattcga ggccgatcag cagaggcaga ttgccagcgg caacgagagc 180

gacaccgctt ggaatagaag gctgctgtcc gaactgattg cccccatggc tgagggcatt 240

caagcctaca aggaggagta tgaaggcaag agaggaagag ctcctagggc tctggccttc 300

attaactgtg tcggcaacga agtggctgcc tacatcacca tgaagatcgt catggacatg 360

ctgaacacag acgtcacact gcaagccatt gctatgaacg tcgccgatag aattgaggac 420

caagtgaggt tcagcaagct ggagggccat gccgctaaat atttcgagaa ggtcaagaag 480

tctctgaagg cctccaaaac caagagctat aggcacgccc ataacgtggc cgtcgtggct 540

gagaagagcg tcgctgatag ggacgctgac ttctctagat gggaggcttg gcccaaagac 600

accctcctcc agatcggcat gacactgctg gagattctgg agaactccgt gttcttcaac 660

ggccagcccg tgtttctgag aacactgaga acaaacggcg gcaagcatgg agtgtattat 720

ctgcagacca gcgagcacgt cggcgaatgg atcaccgcct ttaaggaaca cgtggctcag 780

ctgtcccccg cttatgctcc ttgcgtcatc cctcctaggc cttgggtcag ccccttcaac 840

ggaggctttc ataccgagaa ggtggccagc agaatcagac tggtgaaggg caacagagaa 900

catgtgagga agctgaccaa gaaacaaatg cccgccgtct acaaagctgt caatgctctg 960

caagccacca agtggcaagt gaacaaggaa gtcctccaag tggtcgaaga cgtgattaga 1020

ctcgacctcg gctatggcgt cccttccttt aagcctctga tcgatagaga gaacaagccc 1080

gccaaccccg tgcctctgga gttccagcat ctgagaggaa gagagctgaa ggagatgctg 1140

acccccgagc aatggcaagc cttcatcaac tggaagggcg agtgcaccaa gctgtacacc 1200

gccgagacca aaaggggcag caagtccgct gccaccgtga gaatggtggg acaagctaga 1260

aagtacagcc aattcgacgc catctacttt gtctacgctc tggactccag atctagagtg 1320

tatgctcaaa gcagcacact gagccctcag agcaatgatc tgggcaaagc tctgctgagg 1380

tttaccgagg gccagagact ggactccgct gaggctctga agtggtttct ggtgaacggc 1440

gccaacaatt ggggatggga caagaagaca ttcgacgtga gaaccgccaa cgtgctcgac 1500

agcgagttcc aagacatgtg tagagatatc gccgccgacc ctctgacctt tacccagtgg 1560

gtgaacgccg acagccccta tggctttctc gcttggtgct ttgagtacgc cagatatctg 1620

gacgccctcg acgagggaac ccaagaccag ttcatgacac atctgcccgt gcaccaagac 1680

ggcagctgca gcggaatcca gcactacagc gccatgctgt ccgatgctgt cggcgctaag 1740

gccgtgaatc tgaagccctc cgattcccct caagacatct atggcgccgt ggctcaagtg 1800

gtgatccaga agaactacgc ctacatgaat gctgaagacg ccgagacatt cacaagcggc 1860

tccgtgacac tcaccggcgc tgagctgaga agcatggcta gcgcttggga catgatcggc 1920

atcacaagag gactgaccaa gaagcccgtg atgacactgc cctacggaag cacaaggctg 1980

acatgcagag aaagcgtgat cgactacatc gtggatctgg aggaaaagga ggcccagagg 2040

gctattgccg agggcagaac agctaatccc gtgcacccct tcgacaacga taggaaagac 2100

agcctcaccc ctagcgccgc ttacaactac atgacagccc tcatctggcc ctccatcagc 2160

gaagtggtga aggctcccat cgtggctatg aagatgatta gacagctcgc cagattcgct 2220

gctaaaagaa acgagggact ggagtatcct ctgcccaccg gctttattct gcagcagaag 2280

atcatggcca ccgacatgct gagagtctcc acatgtctga tgggcgagat caagatgagc 2340

ctccagatcg agaccgacgt ggtggatgaa accgctatga tgggagccgc cgcccccaat 2400

tttgtccacg gccatgatgc ctcccatctg attctcacag tctgcgatct ggtcgacaag 2460

ggcatcacca gcgtggctgt gatccatgat tcctttggca cccatgccgg cagaacagcc 2520

gatctgaggg actctctgag agaggaaatg gtcaaaatgt accagaatca caacgctctg 2580

cagaatctgc tggatgtgca cgaggaaagg tggctggtcg ataccggcat ccaagtgccc 2640

gagcaaggcg agttcgatct gaacgagatt ctggtgagcg actactgctt cgcttgaacg 2700

cgttagctaa ctgactcgag gcgaccgccc cgggctgcag gagctcggta taagatccgc 2760

ccctctccct cccccccccc taacgttact ggccgaagcc gcttggaata aggccggtgt 2820

gcgtttgtct atatgttatt ttccaccata ttgccgtctt ttggcaatgt gagggcccgg 2880

aaacctggcc ctgtcttctt gacgagcatt cctaggggtc tttcccctct cgccaaagga 2940

atgcaaggtc tgttgaatgt cgtgaaggaa gcagttcctc tggaagcttc ttgaagacaa 3000

acaacgtctg tagcgaccct ttgcaggcag cggaaccccc cacctggcga caggtgcctc 3060

tgcggccaaa agccacgtgt ataagataca cctgcaaagg cggcacaacc ccagtgccac 3120

gttgtgagtt ggatagttgt ggaaagagtc aaatggctct cctcaagcgt attcaacaag 3180

gggctgaagg atgcccagaa ggtaccccat tgtatgggat ctgatctggg gcctcggtac 3240

acatgcttta catgtgttta gtcgaggtta aaaaaacgtc taggcccccc gaaccacggg 3300

gacgtggttt tcctttgaaa aacacgatga taatatggcc acaaccatga ccgagtacaa 3360

gcccacggtg cgcctcgcca cccgcgacga cgtccccagg gccgtacgca ccctcgccgc 3420

cgcgttcgcc gactaccccg ccacgcgcca caccgtcgat ccggaccgcc acatcgagcg 3480

ggtcaccgag ctgcaagaac tcttcctcac gcgcgtcggg ctcgacatcg gcaaggtgtg 3540

ggtcgcggac gacggcgccg cggtggcggt ctggaccacg ccggagagcg tcgaagcggg 3600

ggcggtgttc gccgagatcg gcccgcgcat ggccgagttg agcggttccc ggctggccgc 3660

gcagcaacag atggaaggcc tcctggcgcc gcaccggccc aaggagcccg cgtggttcct 3720

ggccaccgtc ggagtctcgc ccgaccacca gggcaagggt ctgggcagcg ccgtcgtgct 3780

ccccggagtg gaggcggccg agcgcgccgg ggtgcccgcc ttcctggaaa cctccgcgcc 3840

ccgcaacctc cccttctacg agcggctcgg cttcaccgtc accgccgacg tcgaggtgcc 3900

cgaaggaccg cgcacctggt gcatgacccg caagcccggt gcctga 3946

<210> 3

<211> 534

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> K1Epro-3’-UTR-gHDV Rz

<400> 3

taatcagtat ttactggaca ctatagaagg ggtcgacaca tttgcttctg acacaactgt 60

gttcactagc aacctcaaac agacaccgaa ttcgccacca tggtgagcgg ctggcggctg 120

ttcaagaaga ttagcggcgg gggcggatct ggaggaggtg gatccggaag cttggctgca 180

gcggccgctg gctcgagtta gctaactgag ctcgctttct tgctgtccaa tttctattaa 240

aggttccttt gttccctaag tccaactact aaactggggg atattatgaa gggccttgag 300

catctggatt ctgcctaccg gtagattaat agatctcaaa ggctcttttc agagccacca 360

aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa aaaaaaaaaa ggccggcatg gtcccagcct 420

cctcgctggc gccggctggg caacattccg aggggaccgt cccctcggta atggcgaatg 480

ggacccatag cataacccct tggggcctct aaacgggtct tgaggggttt tttg 534

<210> 4

<211> 714

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> msfGFP

<400> 4

gtgagtaaag gtgaagaact cttcactgga gtagtgccca ttctggtaga gcttgatgga 60

gatgtaaatg gacataaatt ctccgtcagg ggcgaaggcg aaggggacgc cacgaatggt 120

aagctgactc tgaaattcat ctgtacgacg ggcaaactgc ccgtcccatg gcctacactc 180

gtaacgaccc tcacctacgg cgtgcaatgc ttttctcgat atcccgacca catgaaacag 240

catgactttt tcaagtctgc aatgcctgaa ggttatgttc aagaaaggac catcagcttt 300

aaggatgatg gtacatataa aacccgagcc gaggttaaat ttgaagggga cactctggtt 360

aatcgaattg aactgaaagg tattgatttt aaggaggacg gtaacatact ggggcacaag 420

ttggagtaca actttaacag ccataatgtg tatattaccg ctgataagca gaaaaatggg 480

ataaaggcca actttaagat ccgacataat gtcgaagatg gtagtgttca actggctgat 540

cattaccaac aaaatacgcc catcggagat ggacctgtac tcttgcctga caatcattat 600

ctctccacgc aatcaaagct ttccaaggac ccaaacgaaa agagagatca catggtcctt 660

ctggaatttg tgactgccgc aggcatcact ctcggtatgg atgagctgta caag 714

<210> 5

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> K1E promoter

<400> 5

ttactggaca ctatagaag 19

<210> 6

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> NP868R-F

<400> 6

gactcactat agggcgaatt gccaccatgg cttctttag 39

<210> 7

<211> 45

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> NP868R-R

<400> 7

agaacctcca cctccggatc catttttgcg cagacaaata aaccc 45

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> RBGI-F

<400> 8

gcaacgtgct ggttattgtg 20

<210> 9

<211> 38

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp3-F

<400> 9

atctggagga ggtggatccg gtaagactgt cacctttg 38

<210> 10

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp3-R

<400> 10

gaaaaaggca ggttaactcg agttagctaa ctgagctcgc 40

<210> 11

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp4-F

<400> 11

atctggagga ggtggatccg gtattgttag cggcaccttt 40

<210> 12

<211> 53

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp4-R

<400> 12

gctcagttag ctaactcgag ctattgtaat ctactaacac caatagagta acg 53

<210> 13

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp12-F

<400> 13

gaggaggtgg atcctttaaa cgggtacggg gtagcagtga 40

<210> 14

<211> 46

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp12-R

<400> 14

agagctccta cgactttacc tcgagttagc taactgagct cgcttt 46

<210> 15

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp13-F

<400> 15

gcggatctgg aggaggtgga tcctgtggcg tttgtgtagt 40

<210> 16

<211> 44

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> nsp13-R

<400> 16

gtgaaacaag tctgcaataa ctcgagttag ctaactgagc tcgc 44

<210> 17

<211> 40

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> IBVS-F

<400> 17

cagacaccga attccaccat gttggtaaca cctcttttac 40

<210> 18

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> IBVS-R

<400> 18

agacccaaaa agtctgtttg aaccgagcag aagctgatct c 41

<210> 19

<211> 41

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> SFV-GFP-F

<400> 19

ggtccgaaga gtgggatccc gtgagtaaag gtgaagaact c 41

<210> 20

<211> 39

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<223> SFV-GFP-R

<400> 20

caattaatta cccgggatcc ttacttgtac agctcatcc 39

Claims

1. A method for expressing proteins in eukaryotic cytoplasm by using a double plasmid system of K1E phage RNA polymerase and promoter, which is characterized by comprising the following steps:

2. The method for expressing proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter according to claim 1, further comprising the steps of:

(4) and (3) detection:

3. The method for expressing proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter according to claim 1 or 2, wherein:

the sequence of the NP868R cap enzyme fragment in the step (1) is shown as SEQ ID NO. 1;

constructing the NP868R cap enzyme fragment into a vector containing a K1E RNA polymerase expression sequence by homologous recombination in the construction mode in the step (1);

the vector containing the K1E RNA polymerase expression sequence in the step (1) is pXIP-myc-K1 ERNAP;

4. The method of claim 3 for expressing proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter, wherein:

the steps of homologous recombination are specifically as follows: amplifying an NP868R cap enzyme fragment with a sequence shown in SEQ ID NO.1 by using primers NP868R-F and NP868R-R to obtain a fragment A; cutting the vector into linear fragments by EcoRI and BamHI double enzyme digestion to obtain a fragment B; carrying out homologous recombination connection on the fragment A and the fragment B through a homologous recombinase to obtain a recombinant vector A;

NP868R-F：5’-GACTCACTATAGGGCGAATTGCCACCATGGCTTCTTTAG-3’；

NP868R-R：5’-AGAACCTCCACCTCCGGATCCATTTTTGCGCAGACAAATAAACCC-3’。

5. the method for expressing proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter according to claim 1 or 2, wherein:

the target protein in the step (2) is a viral protein, or a viral protein and a fluorescent protein;

constructing the cDNA sequence of the target protein to a vector containing a K1E promoter by homologous recombination in the mode of construction in the step (2);

6. The method of claim 5 for expressing proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter, wherein the expression vector comprises:

the virus is avian infectious bronchitis virus and coronavirus;

the virus protein is at least one of virus structural protein and virus non-structural protein;

the fluorescent protein is green fluorescent protein;

the vector containing the K1E promoter in the step (2) also comprises a luciferase HiBiT tag sequence.

7. The method of claim 6, wherein the expression of the protein in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter is performed by:

the virus non-structural protein is at least one of nsp3, nsp4, nsp12 and nsp 13;

the virus structural protein is IBVS structural protein;

the vector containing the K1E promoter in the step (2) is a vector pK 1E-HiBiT;

the pK1E-HiBiT is prepared by the following steps: constructing K1 Epro-3' -UTR-gHDV Rz with a sequence shown as SEQ ID NO.3 into a vector pEGFP-C1 through enzyme cutting sites Asel and MluI to obtain a vector pK 1E-HiBiT;

the steps of homologous recombination are specifically as follows:

nsp3-F：5’-ATCTGGAGGAGGTGGATCCGGTAAGACTGTCACCTTTG-3’；

nsp3-R：5’-GAAAAAGGCAGGTTAACTCGAGTTAGCTAACTGAGCTCGC-3’；

nsp4-F：5’-ATCTGGAGGAGGTGGATCCGGTATTGTTAGCGGCACCTTT-3’；

nsp4-R：5’-GCTCAGTTAGCTAACTCGAGCTATTGTAATCTACTAACACCAATAGAGTAACG-3’；

nsp12-F：5’-GAGGAGGTGGATCCTTTAAACGGGTACGGGGTAGCAGTGA-3’；

nsp12-R：5’-AGAGCTCCTACGACTTTACCTCGAGTTAGCTAACTGAGCTCGCTTT-3’；

nsp13-F：5’-GCGGATCTGGAGGAGGTGGATCCTGTGGCGTTTGTGTAGT-3’；

nsp13-R：5’-GTGAAACAAGTCTGCAATAACTCGAGTTAGCTAACTGAGCTCGC-3’；

IBVS-F：5’-CAGACACCGAATTCCACCATGTTGGTAACACCTCTTTTAC-3’；

IBVS-R：5’-AGACCCAAAAAGTCTGTTTGAACCGAGCAGAAGCTGATCTC-3’；

SFV-GFP-F：5’-GGTCCGAAGAGTGGGATCCCGTGAGTAAAGGTGAAGAACTC-3’；

SFV-GFP-R：5’-CAATTAATTACCCGGGATCCTTACTTGTACAGCTCATCC-3’；

8. The method for expressing proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter according to claim 1 or 2, wherein:

the host eukaryotic cell in the step (3) is at least one of human lung cancer cell H1299, Vero cell and human kidney epithelial cell line 293T;

the recombinant vector A and the recombinant vector B in the step (3) are mixed according to a molar ratio of 1: 3, and (3) transfection.

9. The method of claim 2 for expressing proteins in eukaryotic cytoplasm using the dual plasmid system of K1E phage RNA polymerase and promoter, wherein the expression vector comprises: the detection of the target protein in the step (4) comprises a protein immunoblotting method.

10. Use of the double plasmid system of any one of claims 1 to 9 using the K1E phage RNA polymerase and promoter for eukaryotic cytoplasmic protein expression.