CN112280877A - CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid - Google Patents
CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid Download PDFInfo
- Publication number
- CN112280877A CN112280877A CN202011237867.0A CN202011237867A CN112280877A CN 112280877 A CN112280877 A CN 112280877A CN 202011237867 A CN202011237867 A CN 202011237867A CN 112280877 A CN112280877 A CN 112280877A
- Authority
- CN
- China
- Prior art keywords
- lys
- asn
- coxiella
- glu
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention discloses a CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid. The invention provides a crRNA, which is shown as a sequence 1 in a sequence table. The invention also provides a nucleic acid molecule composition, which consists of a primer Coxiella-F, a primer Coxiella-R and the indicated crRNA; the primer Coxiella-R is a single-stranded DNA molecule shown in a sequence 7 of a sequence table. The invention also protects the application of any one of the crRNA or the nucleic acid molecule composition in detecting the coxiella burnetii nucleic acid. The invention discloses a CRISPR-Cas13a detection system for detecting coxiella burnetii nucleic acid, which realizes the detection of trace coxiella burnetii nucleic acid samples with higher sensitivity, high specificity, rapidness and accuracy. The invention has great application and popularization value for preventing and controlling coxiella burnetii infection.
Description
Technical Field
The invention belongs to the technical field of biology, and relates to a CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid.
Background
Coxiella burnetii (Coxiella burnetii) is an important zoonotic Q-fever-co-morbidity pathogen. The coxiella burnetii is vertically spread in tick menstrual period and through eggs, and the tick carrying the coxiella burnetii bites wild animals or livestock to cause animal infection; the infected animals expel the coxiella burnetii in large quantities out of the environment, causing the Q fever or outbreak of epidemic in humans. The Q fever natural epidemic focus is widely distributed in China, at least 20 provinces and municipalities report the occurrence of Q fever at present, and the Q fever is popular in Sichuan, Yunnan, inner Mongolia, Xinjiang, Tibet and the like.
Serological detection of coxiella burnetii specific antibodies is the current gold standard for the diagnosis of rickettsia infection. However, serological diagnosis often fails to detect antibodies at the beginning of the onset of Q fever. The separation operation of the rickettsia pathogen is complex and the efficiency is low. In addition, the coxiella burnetii nucleic acid detection technology can be used as an auxiliary diagnosis technology for Q fever early infection. At present, the lowest copy number of the coxiella burnetii nucleic acid detected by the coxiella burnetii nucleic acid detection technology (such as real-time fluorescent quantitative PCR and RPA technology) is 10 copies/test.
In 2017, in 4 months, U.S. researchers established a nucleic acid detection technology with sensitivity reaching an Eimer level (single copy) and specificity reaching a single base, namely a CRISPR-Cas13 a-based nucleic acid detection platform SHERLOCK, and combined with a Recombinant Polymerase Amplification (RPA) technology capable of efficiently amplifying a target fragment by utilizing the non-specific cleavage activity of Leptotrichia wadei Cas13a protein (LwCas13a), the rapid, cheap and high-sensitivity detection of trace nucleic acid is realized.
Disclosure of Invention
The invention aims to provide a CRISPR-Cas13a system for detecting Coxiella burnetii nucleic acid.
The invention provides a crRNA, and a target sequence of the crRNA is shown as a sequence 3 in a sequence table.
The invention also provides a crRNA which is shown as a sequence 1 in a sequence table.
Any of the crRNAs is used for detecting Coxiella burnetii through a CRISPR-Cas13a system.
The invention also provides a nucleic acid molecule composition, which consists of a primer Coxiella-F, a primer Coxiella-R and specific crRNA; the primer Coxiella-F is a single-stranded DNA molecule shown in a sequence 6 of the sequence table; the primer Coxiella-R is a single-stranded DNA molecule shown in a sequence 7 of a sequence table; the specific crRNA is any one of the crRNAs.
The invention also protects the application of any one of the crRNA or the nucleic acid molecule composition in the preparation of a kit; the kit has the function of detecting the coxiella burnetii nucleic acid.
The invention also provides a kit for detecting coxiella burnetii nucleic acid, which comprises any one of the crRNA or the nucleic acid molecule composition.
The kit is used for detecting coxiella burnetii nucleic acid through a CRISPR-Cas13a system.
The kit also includes a Cas13a protein.
The Cas13a protein is an LwCas13a protein.
The Cas13a protein is shown as a sequence 8 in a sequence table.
Still further, the kit also includes other reagents for RPA amplification and other reagents for achieving CRISPR-Cas13a system detection. The other reagents for RPA amplification include buffer and/or ddH2And O. The other reagents for realizing the CRISPR-Cas13a system detection comprise all or part of the following reagents: NTP (e.g., NTP Mix), T7 RNA polymerase, RNase inhibitor, and reporter RNA: (
Substrate v2, reporter RNA is an RNA molecule with a signal reporting function), RNase free water.
The kit may further comprise a carrier carrying the following criteria: and in the same detection time, the fluorescence intensity value of the test group is more than 2 times higher than that of the negative control, and the result is judged to be positive.
The kit may further comprise a carrier carrying the following criteria: and (3) determining that the fluorescence intensity is greater than or equal to 600a.u. at any time in the detection process.
The invention also protects the application of any one of the crRNA or the nucleic acid molecule composition or the kit in detecting the coxiella burnetii nucleic acid.
The invention also provides a method for detecting the coxiella burnetii nucleic acid, which comprises the following steps:
(1) extracting total DNA of a sample as a template solution;
(2) taking a template solution, and carrying out RPA amplification by adopting a primer pair consisting of a primer Coxiella-F and a primer Coxiella-R;
(3) taking the product solution in the step (2), and carrying out visual detection based on a CRISPR-Cas13a system; the crRNA in the CRISPR-Cas13a system is any one of the crRNAs.
The reaction system of the step (2) may be specifically shown in table 1. The step (2) may specifically be:47.5 μ L of the system shown in Table 1 was prepared and the basic reaction unit (with RPA lyophilized powder) was added
nfo RPA amplification kit), and fully and uniformly redissolving the freeze-dried powder. To each reaction tube, 2.5. mu.L of 280mM magnesium acetate solution was added, and the tube was closed and collected immediately and mixed well. Then the reaction tube is placed at 39 ℃ for reaction for 20-40 minutes.
The reaction system of the step (3) may be specifically shown in table 2. The step (3) may specifically be: the PCR tube containing the system shown in Table 2 was placed in a fluorescence quantitative PCR apparatus, the wavelength of channel excitation light was set at 490nm, the wavelength of emission light was set at 520nm, the value was read every 2min at 37 ℃ for 40 times for a total of 80 minutes, and the change in fluorescence intensity in the system was detected.
The invention also provides a method for detecting the coxiella burnetii nucleic acid, which comprises the following steps:
extracting total DNA of a sample to be tested, and carrying out visual detection based on a CRISPR-Cas13a system; the crRNA in the CRISPR-Cas13a system is any one of the crRNAs.
The reaction system for visual detection based on the CRISPR-Cas13a system has T7 RNA polymerase.
Illustratively, the coxiella burnetii is a new bridge strain of coxiella burnetii.
The invention discloses a CRISPR-Cas13a detection system for detecting coxiella burnetii nucleic acid, which can improve the detection sensitivity to 1copy/test, can detect the coxiella burnetii nucleic acid in the shortest 4 minutes, and realizes the detection of trace coxiella burnetii nucleic acid samples with higher sensitivity, high specificity, rapidness and accuracy. The invention has great application and popularization value for preventing and controlling coxiella burnetii infection.
Drawings
FIG. 1 is a time-fluorescence curve of crRNA1 and crRNA2 for detection of Coxiella burnetii nucleic acid.
Fig. 2 is a time-fluorescence curve for CRISPR-Cas13a containing crRNA1 to detect different concentrations of coxiella burnetii nucleic acid.
Fig. 3 shows that CRISPR-Cas13a containing crRNA1 detects fluorescence intensity of coxiella burnetii nucleic acid at different concentrations within 4 min.
Fig. 4 is an evaluation of the specificity of CRISPR-Cas13a for coxiella burnetii (time-fluorescence curve).
Fig. 5 is an assessment of specificity (60min fluorescence intensity) for CRISPR-Cas13a for coxiella burnetii.
Fig. 6 is a mouse spleen nucleic acid sample (time-fluorescence curve) detected Q thermal infection against CRISPR-Cas13a of coxiella burnetii.
Fig. 7 is a sample of Q thermally infected mouse heart nucleic acid detected against CRISPR-Cas13a of coxiella burnetii (time-fluorescence curve).
Fig. 8 is a sample of Q heat-infected mouse lung nucleic acid detected against CRISPR-Cas13a of coxiella burnetii (time-fluorescence curve).
Detailed Description
The present invention is described in further detail below with reference to specific embodiments, which are given for the purpose of illustration only and are not intended to limit the scope of the invention. The examples provided below serve as a guide for further modifications by a person skilled in the art and do not constitute a limitation of the invention in any way.
The experimental procedures in the following examples, unless otherwise indicated, are conventional and are carried out according to the techniques or conditions described in the literature in the field or according to the instructions of the products. Materials, reagents and the like used in the following examples are commercially available unless otherwise specified.
Unless otherwise stated, the quantitative tests in the following examples were performed in triplicate, and the results were averaged.
Example 1 preparation of the respective Components of the kit
Preparation of LwCas13a protein
Expression, purification and activity identification of LwCas13a protein are disclosed in the patent application document with the invention name of 'a crRNA target and CRISPR-Cas13a system for detecting Ebola virus', and the publication number of CN 110628955. The method comprises the following specific steps:
1. inducible expression, purification and identification of LwCas13a protein
The LwCas13a expression plasmid was PC013-Twinstrep-SUMO-huLwCas13a, obtained from the Addgene platform (https:// www.addgene.org/search/catalog/plasmids/. The LwCas13a expression plasmid expresses LwCas13a protein shown in sequence 8 of the sequence table.
The LwCas13a expression plasmid was introduced into E.coli Rosetta (DE3) competent cells, followed by culture in TB liquid medium at 37 ℃ and 200rpm for 14 hours or more. Then transferred into TP liquid culture medium containing Amp resistance at a volume ratio of 1:100, cultured at 37 ℃ and 300rpm to OD600nmThen IPTG was added to the medium at a concentration of 500. mu.M in the system, and the mixture was cultured at 200rpm at 18 ℃ for 16 hours. Centrifuging, collecting thallus, ultrasonicating, collecting protein supernatant, and treating His carried by Cas13a protein6The tag is primarily purified by a Ni column (HisTrap HP column, GE healthcare Life Science), the carried tag part is cut by enzyme by SUMO, the isoelectric point characteristic of Cas13a protein is utilized to carry out secondary purification by a cation exchange column (Unigel-50SP, Nano-Micro Tech), the protein obtained in each step is identified by SDS-PAGE protein electrophoresis in the experimental process, the protein size is analyzed, and meanwhile, His is utilized6The labeled antibody is used for preliminary identification of the protein so as to determine the induced protein as the target protein.
2. LwCas13a protein concentration and activity identification
The protein activity detection kit (Shanghai Biyuntian biotechnology, Inc.) is used for detecting the concentration of LwCas13a protein, and a reporter RNA kit (invittrgen) is used for detecting the fluorescence value of emitted light under 490nm excitation and 520nm wavelength, so as to judge whether the LwCas13a protein in the system is activated. Namely, in the presence of target RNA and crRNA corresponding to the target, whether the LwCas13a protein can be activated and shears the reporter RNA in the system to enable the reporter RNA to emit fluorescence, and meanwhile, a non-specific target is set for specific detection, and human cell total RNA is used as background RNA to detect whether the system is interfered by the background RNA. The detection result shows that the LwCas13a protein with high purity is obtained by purification, no RNase is polluted, a complex formed by the protein and crRNA can be activated by a specific target sequence and shears the report RNA in a system to emit a fluorescent signal, and the protein can be used for subsequent detection experiments. Meanwhile, when the final concentration of the protein is 45nM, a significant change in fluorescence signal can be detected.
Preparation of second, specific crRNA
Separately, crRNA-1 and crRNA-2 were artificially synthesized. The crRNA-1 and the crRNA-2 are single-stranded RNA molecules, the crRNA-1 is shown as a sequence 1 in a sequence table, and the crRNA-2 is shown as a sequence 2 in the sequence table. In sequences 1 and 2, the underlined regions are the anchor sequences that bind to the Cas13a protein, and the bold regions are the guide sequences that specifically bind to the target sequences in the coxiella burnetii genome.
Sequence 1,GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACgacuaggcuuuccacuccgugcguaaac。
A sequence 2,GGGAUUUAGACUACCCCAAAAACGAAGGGGACUAAAACacuggggcauugcugacuaggcuuucca。
The target sequence of crRNA1 is shown in sequence 3 of the sequence table, and is mRNA obtained by transcription of the 170230-170257 DNA sequence located in the Cockholz burnetii genome (RSA493 strain, GenBank: CP040059.1, 12-MAY-2019). The target sequence of crRNA2 is shown in sequence 4 of the sequence table, and is mRNA obtained by transcription of the DNA sequence located at 170216-170243 of Cockholz burnetii genome (RSA493 strain, GenBank: CP040059.1, 12-MAY-2019).
Sequence 3, cugauccgaaaggugaggcacgcauuug.
And (3) sequence 4, ugaccccguaacgacugauccgaaaggu.
Third, preparation of Standard plasmid
The double-stranded DNA molecule shown in sequence 5 of the sequence table was inserted between BamHI and SacI cleavage sites of a pUC57 vector to obtain a standard Plasmid, which was named Plasmid-Coxiella. The double-stranded DNA molecule shown in the sequence 5 of the sequence table belongs to a coxiella burnetii 16sRNA gene sequence. In the sequence 5 of the sequence table, the 57 th to 84 th positions are the target sequence of crRNA2, and the 71 th to 98 th positions are the target sequence of crRNA 1. Dissolve and suspend the Plasmi with TE Bufferd-Coxiella to give 1X 109copies/. mu.L of standard quality pellet stock.
Design and preparation of RPA amplification primer
The RPA amplification primers were as follows:
Coxiella-F (SEQ ID NO: 6):aattctaatacgactcactatagggTATCGGGGGAACCCTCCTGCTTTTTAGCAA；
Coxiella-R (SEQ ID NO: 7): CATACCATGGCTCTAAATGTAAATACATAA are provided.
In Coxiella-F, the T7 sequence is underlined.
Coxiella-F and Coxiella-R were prepared separately.
Example 2 selection of optimal crRNA
The plasmid mother liquor as a standard prepared in example 1 was diluted to a plasmid concentration of 106The Plasmid/mu L is the Plasmid-Coxiella standard quality particle solution.
1. RPA amplification
And (3) carrying out RPA amplification by taking the Plasmid-Coxiella standard quality particle solution as a template solution to obtain an RPA amplification product.
The RPA amplification system is shown in table 1.
A system of 47.5. mu.L shown in Table 1 was prepared and added to the basic reaction unit containing RPA lyophilized powder to allow the lyophilized powder to be fully and uniformly redissolved. To each reaction tube, 2.5. mu.L of 280mM magnesium acetate solution was added, and the tube was closed and collected immediately and mixed well. Then the reaction tube is placed at 39 ℃ for reaction for 20-40 minutes.
2. Detection of coxiella burnetii nucleic acid based on CRISPR-Cas13a system
The reaction system of the test group is shown in Table 2.
The specific crRNA was crRNA-1 or crRNA-2 prepared in example 1.
Replacement of RPA amplification products in Table 2 with ddH2And O, and keeping other reagent components unchanged, namely, the negative control.
The PCR tube containing the system shown in Table 2 was placed in a fluorescence quantitative PCR apparatus, the wavelength of channel excitation light was set at 490nm, the wavelength of emission light was set at 520nm, the value was read every 2min at 37 ℃ for 40 times for a total of 80 minutes, and the change in fluorescence intensity in the system was detected.
The results are shown in FIG. 1. By using 106When plasmid-Copies/. mu.L of Plamid-Coxiella is used as a template, the fluorescence intensity of the detection of crRNA-1 increases with time, and the fluorescence value is higher than that of the crRNA-2 and water control. And the crRNA-2 probably forms an RNA hairpin structure by the continuous bases of 'GGGG' at the positions 42-45 and the continuous bases of 'CCCC' at the positions 14-17 to influence the recognition of a target sequence and the binding of Cas13a protein, and the fluorescence intensity of detection does not increase along with the time, and no obvious detection activity exists. Therefore, crRNA-1 was used as crRNA for detection by Coxiella burnetii.
Example 3 kit composition and method set-up
Composition of kit
The kit comprises the following components: cas13a protein prepared in example 1, crRNA-1 prepared in example 1, the standard plasmid stock solution prepared in example 1, and the RPA amplification primers (Coxiella-F and Coxiella-R) prepared in example 1.
Second, establishment of method
1. RPA amplification
And (3) taking the test DNA solution as a template solution to carry out RPA amplification to obtain an RPA amplification product.
The test DNA solution is a standard quality pellet solution or a sample DNA solution.
The RPA amplification system is shown in table 1.
TABLE 1 RPA amplification System
47.5 μ L of the system shown in Table 1 was prepared and the basic reaction unit (with RPA lyophilized powder) was added
nfo RPA amplification kit), and fully and uniformly redissolving the freeze-dried powder. To each reaction tube, 2.5. mu.L of 280mM magnesium acetate solution was added, and the tube was closed and collected immediately and mixed well. Then the reaction tube is placed at 39 ℃ for reaction for 20-40 minutes.
2. Detection of coxiella burnetii nucleic acid based on CRISPR-Cas13a system
The reaction system of the test group is shown in Table 2. Specific crRNA the crRNA-1 prepared in example 1 was used.
Replacement of RPA amplification products in Table 2 with ddH2And O, and keeping other reagent components unchanged, namely, the negative control.
TABLE 2 CRISPR-Cas13a detection System (25. mu.L)
Reporting RNA as RNase alertTMIn QC System v2
Substrate v2。RNaseAlertTMQC System v2：InvitrogenTMCompany, cat # 4479769.
The PCR tube containing the system shown in Table 2 was placed in a fluorescence quantitative PCR apparatus, the wavelength of channel excitation light was set at 490nm, the wavelength of emission light was set at 520nm, the value was read every 2min at 37 ℃ for 40 times for a total of 80 minutes, and the change in fluorescence intensity in the system was detected.
And (4) judging a result: judging that the fluorescence intensity value of the test group is more than 2 times higher than that of the negative control in the same detection time to be a positive result; the fluorescence intensity is larger than or equal to 600a.u. at any time in the detection process, and then the result is judged to be positive; if both (i) and (ii) are satisfied, the determination is positive.
Example 4 sensitivity detection
The standard plasmid mother liquor prepared in example 1 was subjected to gradient dilution to obtain a standard plasmid solution. The plasmid concentration in the standard plasmid solution was 106copies/μL、105copies/μL、104copies/μL、103copies/μL、102copies/μL、101copies/μL、100copies/μL。
The standard plasmid solution was used as a test DNA solution, and the detection was carried out by the method of example 3 using the kit of example 3.
The results of CRISPR-Cas13a detection at 0 to 80 min are shown in figure 2. Results show that 100-106The fluorescence signal of the amplified product of the copies/μ L standard plasmid starts to rise after the reaction starts, whereas only background fluorescence is present in the negative control and the fluorescence intensity does not rise over time.
The intensity of the fluorescent signal detected by CRISPR-Cas13a at 4 minutes from the start of the detection is shown in fig. 3. 100copies/. mu.L to 106The fluorescence signals corresponding to the copies/mu L template are 199.00 +/-2.646 a.u., 205 +/-11.27 a.u., 201.33 +/-8.021 a.u., 210.67 +/-3.215 a.u., 213.67 +/-3.786 a.u., 228.67 +/-8.5054 a.u., 216.33 +/-8.327 a.u., and the fluorescence signals of the negative control are 91.333 +/-23.692 a.u. The fluorescence intensities were all statistically different compared to the negative control (one way ANOVA test, P)<0.001) and reaches more than 2 times of the fluorescence value of the negative control. The result shows that the CRISPR-Cas13a detection system can detect the coxiella burnetii nucleic acid in the shortest 4 minutes (2 cycles), and the sensitivity reaches single copy (1 copy/test).
Example 5 specific detection
Test substance: the novel bridge strain of Coxiella burnetii, Rickettsia pratensis, Orientia tsutsugamushi Karp strain, Rickettsia moji, Rickettsia rickettsii, Rickettsia sibirica, Rickettsia nigra, Gilliam strain of Orientia tsutsugamushi, Streptococcus suis, Rickettsia cornutsii, Listeria monocytogenes, Shigella sonnei, Vibrio cholerae, Staphylococcus epidermidis, Salmonella typhimurium, Rickettsia crenata, Legionella pneumophila, Staphylococcus aureus, Rickettsia canadensis, Yersinia pestis, Salmonella typhi, Montana rickettsia, phagocytic cell anaplasmosis, Hanselibatong, and Tropicea pentagamsii. The test substance is described in document 1 or document 2. Document 1: real-time fluorescence quantitative PCR can be used for simultaneously and rapidly detecting 4 types of pathogenic rickettsiae, parasites and medical insect bulletins in 2019, 26(2) 110-117. Document 2: real-time fluorescent quantitative PCR detection of Hansenba Tokyo [ J ]. J.China epidemiology, 2007,28(3): 277-281.
Taking a test object, and extracting genome DNA to obtain a test DNA solution. The concentration of DNA in the test DNA solution was 10 ng/. mu.L.
The kit of example 3 was used and the detection was carried out according to the method of example 3.
The results of CRISPR-Cas13a detection at 0 to 15 min are shown in figure 4. The detection results showed that the fluorescence signal of the test group containing the coxiella burnetii nucleic acid began to increase after the reaction started, while that of the negative control (ddH)2O) and the other test nucleic acids do not increase in fluorescence intensity over time, and the fluorescence intensity of the test group containing coxiella burnetii nucleic acids is significantly higher than that of the negative control and the test group containing the other test nucleic acids.
The intensity of the fluorescent signal detected by CRISPR-Cas13a at 60 minutes from the start of the detection is shown in fig. 5. The fluorescence intensity of the test group containing the coxiella burnetii nucleic acid is 200 times of the average fluorescence intensity of the negative control and the test group containing other test substances. The CRISPR-Cas13a system-based method for detecting coxiella burnetii nucleic acid has high specificity, and no cross reaction exists in the detection process.
Example 6 detection of Q Heat-infected animal samples with the method of the invention
The tests were carried out in the ABSL-3 laboratory.
108Copy number of coxiella burnetii november strains infected BALB/c mice (5) by aerosol inhalation route, while uninfected mice were set as control mice (3). The mice were sacrificed 7 days after infection, and heart, lung, spleen samples of the mice were taken, ground with 2mL of PBS buffer, and then genomic DNA was extracted.
The extracted genomic DNA was used as a test DNA solution. The concentration of DNA in the test DNA solution was 10 ng/. mu.L.
The kit of example 3 was used and the detection was carried out according to the method of example 3.
The results are shown in fig. 6, 7 and 8. The CRISPR-Cas13a detection result shows that the fluorescence signal of the organ tissue (heart, lung and spleen) sample of the mouse in the coxiella burnetii infected group begins to rise after the reaction starts, and the fluorescence signal of the organ tissue (heart, lung and spleen) sample of the mouse in the negative control group (ddH)2O) and controlThe fluorescence intensity of the mouse organ tissue (heart, lung and spleen) samples does not increase along with the time, and the fluorescence intensity of the organ tissue samples of mice in the coxiella burnetii infected group is obviously higher than that of the organ tissue samples of negative control mice and control mice. At 80 minutes after the start of the detection, the fluorescence intensity of the organ tissue sample of the mice in the coxiella burnetii infected group is more than 20 times that of the organ tissue of the negative control mice and the organ tissue of the control mice. The method for detecting coxiella burnetii nucleic acid based on the CRISPR-Cas13a system can be used for nucleic acid detection of coxiella burnetii infected animal specimens.
The present invention has been described in detail above. It will be apparent to those skilled in the art that the invention can be practiced in a wide range of equivalent parameters, concentrations, and conditions without departing from the spirit and scope of the invention and without undue experimentation. While the invention has been described with reference to specific embodiments, it will be appreciated that the invention can be further modified. In general, this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. The use of some of the essential features is possible within the scope of the claims attached below.
Sequence listing
<110> military medical research institute of military science institute of people's liberation force of China
<120> CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid
<130> GNCYX202089
<160> 8
<170> SIPOSequenceListing 1.0
<210> 1
<211> 66
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
gggauuuaga cuaccccaaa aacgaagggg acuaaaacga cuaggcuuuc cacuccgugc 60
guaaac 66
<210> 2
<211> 66
<212> RNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
gggauuuaga cuaccccaaa aacgaagggg acuaaaacac uggggcauug cugacuaggc 60
uuucca 66
<210> 3
<211> 28
<212> RNA
<213> Coxiella burnetii
<400> 3
cugauccgaa aggugaggca cgcauuug 28
<210> 4
<211> 28
<212> RNA
<213> Coxiella burnetii
<400> 4
ugaccccgua acgacugauc cgaaaggu 28
<210> 5
<211> 195
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 5
tatcggggga accctcctgc tttttagcaa agggcaatcc cgagggaagt cttaaatgac 60
cccgtaacga ctgatccgaa aggtgaggca cgcatttgtg tgcaatacgc tgacttcttg 120
cccttgggtt tatactcaag aagtaagtga ctatggagaa tttatttatg tatttacatt 180
tagagccatg gtatg 195
<210> 6
<211> 55
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 6
aattctaata cgactcacta tagggtatcg ggggaaccct cctgcttttt agcaa 55
<210> 7
<211> 30
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 7
cataccatgg ctctaaatgt aaatacataa 30
<210> 8
<211> 1152
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 8
Met Lys Val Thr Lys Val Asp Gly Ile Ser His Lys Lys Tyr Ile Glu
1 5 10 15
Glu Gly Lys Leu Val Lys Ser Thr Ser Glu Glu Asn Arg Thr Ser Glu
20 25 30
Arg Leu Ser Glu Leu Leu Ser Ile Arg Leu Asp Ile Tyr Ile Lys Asn
35 40 45
Pro Asp Asn Ala Ser Glu Glu Glu Asn Arg Ile Arg Arg Glu Asn Leu
50 55 60
Lys Lys Phe Phe Ser Asn Lys Val Leu His Leu Lys Asp Ser Val Leu
65 70 75 80
Tyr Leu Lys Asn Arg Lys Glu Lys Asn Ala Val Gln Asp Lys Asn Tyr
85 90 95
Ser Glu Glu Asp Ile Ser Glu Tyr Asp Leu Lys Asn Lys Asn Ser Phe
100 105 110
Ser Val Leu Lys Lys Ile Leu Leu Asn Glu Asp Val Asn Ser Glu Glu
115 120 125
Leu Glu Ile Phe Arg Lys Asp Val Glu Ala Lys Leu Asn Lys Ile Asn
130 135 140
Ser Leu Lys Tyr Ser Phe Glu Glu Asn Lys Ala Asn Tyr Gln Lys Ile
145 150 155 160
Asn Glu Asn Asn Val Glu Lys Val Gly Gly Lys Ser Lys Arg Asn Ile
165 170 175
Ile Tyr Asp Tyr Tyr Arg Glu Ser Ala Lys Arg Asn Asp Tyr Ile Asn
180 185 190
Asn Val Gln Glu Ala Phe Asp Lys Leu Tyr Lys Lys Glu Asp Ile Glu
195 200 205
Lys Leu Phe Phe Leu Ile Glu Asn Ser Lys Lys His Glu Lys Tyr Lys
210 215 220
Ile Arg Glu Tyr Tyr His Lys Ile Ile Gly Arg Lys Asn Asp Lys Glu
225 230 235 240
Asn Phe Ala Lys Ile Ile Tyr Glu Glu Ile Gln Asn Val Asn Asn Ile
245 250 255
Lys Glu Leu Ile Glu Lys Ile Pro Asp Met Ser Glu Leu Lys Lys Ser
260 265 270
Gln Val Phe Tyr Lys Tyr Tyr Leu Asp Lys Glu Glu Leu Asn Asp Lys
275 280 285
Asn Ile Lys Tyr Ala Phe Cys His Phe Val Glu Ile Glu Met Ser Gln
290 295 300
Leu Leu Lys Asn Tyr Val Tyr Lys Arg Leu Ser Asn Ile Ser Asn Asp
305 310 315 320
Lys Ile Lys Arg Ile Phe Glu Tyr Gln Asn Leu Lys Lys Leu Ile Glu
325 330 335
Asn Lys Leu Leu Asn Lys Leu Asp Thr Tyr Val Arg Asn Cys Gly Lys
340 345 350
Tyr Asn Tyr Tyr Leu Gln Val Gly Glu Ile Ala Thr Ser Asp Phe Ile
355 360 365
Ala Arg Asn Arg Gln Asn Glu Ala Phe Leu Arg Asn Ile Ile Gly Val
370 375 380
Ser Ser Val Ala Tyr Phe Ser Leu Arg Asn Ile Leu Glu Thr Glu Asn
385 390 395 400
Glu Asn Asp Ile Thr Gly Arg Met Arg Gly Lys Thr Val Lys Asn Asn
405 410 415
Lys Gly Glu Glu Lys Tyr Val Ser Gly Glu Val Asp Lys Ile Tyr Asn
420 425 430
Glu Asn Lys Gln Asn Glu Val Lys Glu Asn Leu Lys Met Phe Tyr Ser
435 440 445
Tyr Asp Phe Asn Met Asp Asn Lys Asn Glu Ile Glu Asp Phe Phe Ala
450 455 460
Asn Ile Asp Glu Ala Ile Ser Ser Ile Arg His Gly Ile Val His Phe
465 470 475 480
Asn Leu Glu Leu Glu Gly Lys Asp Ile Phe Ala Phe Lys Asn Ile Ala
485 490 495
Pro Ser Glu Ile Ser Lys Lys Met Phe Gln Asn Glu Ile Asn Glu Lys
500 505 510
Lys Leu Lys Leu Lys Ile Phe Lys Gln Leu Asn Ser Ala Asn Val Phe
515 520 525
Asn Tyr Tyr Glu Lys Asp Val Ile Ile Lys Tyr Leu Lys Asn Thr Lys
530 535 540
Phe Asn Phe Val Asn Lys Asn Ile Pro Phe Val Pro Ser Phe Thr Lys
545 550 555 560
Leu Tyr Asn Lys Ile Glu Asp Leu Arg Asn Thr Leu Lys Phe Phe Trp
565 570 575
Ser Val Pro Lys Asp Lys Glu Glu Lys Asp Ala Gln Ile Tyr Leu Leu
580 585 590
Lys Asn Ile Tyr Tyr Gly Glu Phe Leu Asn Lys Phe Val Lys Asn Ser
595 600 605
Lys Val Phe Phe Lys Ile Thr Asn Glu Val Ile Lys Ile Asn Lys Gln
610 615 620
Arg Asn Gln Lys Thr Gly His Tyr Lys Tyr Gln Lys Phe Glu Asn Ile
625 630 635 640
Glu Lys Thr Val Pro Val Glu Tyr Leu Ala Ile Ile Gln Ser Arg Glu
645 650 655
Met Ile Asn Asn Gln Asp Lys Glu Glu Lys Asn Thr Tyr Ile Asp Phe
660 665 670
Ile Gln Gln Ile Phe Leu Lys Gly Phe Ile Asp Tyr Leu Asn Lys Asn
675 680 685
Asn Leu Lys Tyr Ile Glu Ser Asn Asn Asn Asn Asp Asn Asn Asp Ile
690 695 700
Phe Ser Lys Ile Lys Ile Lys Lys Asp Asn Lys Glu Lys Tyr Asp Lys
705 710 715 720
Ile Leu Lys Asn Tyr Glu Lys His Asn Arg Asn Lys Glu Ile Pro His
725 730 735
Glu Ile Asn Glu Phe Val Arg Glu Ile Lys Leu Gly Lys Ile Leu Lys
740 745 750
Tyr Thr Glu Asn Leu Asn Met Phe Tyr Leu Ile Leu Lys Leu Leu Asn
755 760 765
His Lys Glu Leu Thr Asn Leu Lys Gly Ser Leu Glu Lys Tyr Gln Ser
770 775 780
Ala Asn Lys Glu Glu Thr Phe Ser Asp Glu Leu Glu Leu Ile Asn Leu
785 790 795 800
Leu Asn Leu Asp Asn Asn Arg Val Thr Glu Asp Phe Glu Leu Glu Ala
805 810 815
Asn Glu Ile Gly Lys Phe Leu Asp Phe Asn Glu Asn Lys Ile Lys Asp
820 825 830
Arg Lys Glu Leu Lys Lys Phe Asp Thr Asn Lys Ile Tyr Phe Asp Gly
835 840 845
Glu Asn Ile Ile Lys His Arg Ala Phe Tyr Asn Ile Lys Lys Tyr Gly
850 855 860
Met Leu Asn Leu Leu Glu Lys Ile Ala Asp Lys Ala Lys Tyr Lys Ile
865 870 875 880
Ser Leu Lys Glu Leu Lys Glu Tyr Ser Asn Lys Lys Asn Glu Ile Glu
885 890 895
Lys Asn Tyr Thr Met Gln Gln Asn Leu His Arg Lys Tyr Ala Arg Pro
900 905 910
Lys Lys Asp Glu Lys Phe Asn Asp Glu Asp Tyr Lys Glu Tyr Glu Lys
915 920 925
Ala Ile Gly Asn Ile Gln Lys Tyr Thr His Leu Lys Asn Lys Val Glu
930 935 940
Phe Asn Glu Leu Asn Leu Leu Gln Gly Leu Leu Leu Lys Ile Leu His
945 950 955 960
Arg Leu Val Gly Tyr Thr Ser Ile Trp Glu Arg Asp Leu Arg Phe Arg
965 970 975
Leu Lys Gly Glu Phe Pro Glu Asn His Tyr Ile Glu Glu Ile Phe Asn
980 985 990
Phe Asp Asn Ser Lys Asn Val Lys Tyr Lys Ser Gly Gln Ile Val Glu
995 1000 1005
Lys Tyr Ile Asn Phe Tyr Lys Glu Leu Tyr Lys Asp Asn Val Glu Lys
1010 1015 1020
Arg Ser Ile Tyr Ser Asp Lys Lys Val Lys Lys Leu Lys Gln Glu Lys
1025 1030 1035 1040
Lys Asp Leu Tyr Ile Arg Asn Tyr Ile Ala His Phe Asn Tyr Ile Pro
1045 1050 1055
His Ala Glu Ile Ser Leu Leu Glu Val Leu Glu Asn Leu Arg Lys Leu
1060 1065 1070
Leu Ser Tyr Asp Arg Lys Leu Lys Asn Ala Ile Met Lys Ser Ile Val
1075 1080 1085
Asp Ile Leu Lys Glu Tyr Gly Phe Val Ala Thr Phe Lys Ile Gly Ala
1090 1095 1100
Asp Lys Lys Ile Glu Ile Gln Thr Leu Glu Ser Glu Lys Ile Val His
1105 1110 1115 1120
Leu Lys Asn Leu Lys Lys Lys Lys Leu Met Thr Asp Arg Asn Ser Glu
1125 1130 1135
Glu Leu Cys Glu Leu Val Lys Val Met Phe Glu Tyr Lys Ala Leu Glu
1140 1145 1150
Claims (10)
1. A crRNA has a target sequence shown as a sequence 3 in a sequence table.
2. The crRNA is shown as a sequence 1 in a sequence table.
3. A nucleic acid molecule composition consists of a primer Coxiella-F, a primer Coxiella-R and specific crRNA;
the primer Coxiella-F is a single-stranded DNA molecule shown in a sequence 6 of the sequence table;
the primer Coxiella-R is a single-stranded DNA molecule shown in a sequence 7 of a sequence table;
the specific crRNA is the crRNA of claim 1 or 2.
4. Use of the crRNA of claim 1 or 2 or the nucleic acid molecule composition of claim 3 in the preparation of a kit; the kit has the function of detecting the coxiella burnetii nucleic acid.
5. A kit for detecting coxiella burnetii nucleic acid comprising the crRNA of claim 1 or 2 or the nucleic acid molecule composition of claim 3.
6. The kit of claim 5, wherein: the kit also includes a Cas13a protein.
7. The kit of claim 6, wherein: the Cas13a protein is an LwCas13a protein.
8. Use of the crRNA of claim 1 or 2, the nucleic acid molecule composition of claim 3, or the kit of any one of claims 5 to 7 for detecting coxiella burnetii nucleic acid.
9. A method of detecting coxiella burnetii nucleic acid comprising the steps of:
(1) extracting total DNA of a sample as a template solution;
(2) taking a template solution, and carrying out RPA amplification by adopting a primer pair consisting of a primer Coxiella-F and a primer Coxiella-R; the primer Coxiella-F is a single-stranded DNA molecule shown in a sequence 6 of the sequence table; the primer Coxiella-R is a single-stranded DNA molecule shown in a sequence 7 of a sequence table;
(3) taking the product solution in the step (2), and carrying out visual detection based on a CRISPR-Cas13a system; the crRNA in the CRISPR-Cas13a system is the crRNA of claim 1 or 2.
10. A method of detecting coxiella burnetii comprising the steps of:
extracting total DNA of a sample to be tested, and carrying out visual detection based on a CRISPR-Cas13a system; the crRNA in the CRISPR-Cas13a system is the crRNA of claim 1 or 2.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011237867.0A CN112280877B (en) | 2020-11-09 | 2020-11-09 | CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011237867.0A CN112280877B (en) | 2020-11-09 | 2020-11-09 | CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112280877A true CN112280877A (en) | 2021-01-29 |
| CN112280877B CN112280877B (en) | 2022-12-20 |
Family
ID=74350686
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011237867.0A Active CN112280877B (en) | 2020-11-09 | 2020-11-09 | CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112280877B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941237A (en) * | 2021-03-25 | 2021-06-11 | 中国人民解放军军事科学院军事医学研究院 | CRISPR nucleic acid detection kit for specifically detecting H7N9 avian influenza A virus |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925574A (en) * | 2012-11-08 | 2013-02-13 | 中国人民解放军军事医学科学院微生物流行病研究所 | Primers special for detecting coxiella burnetii |
| CN108913790A (en) * | 2017-09-20 | 2018-11-30 | 李佳萌 | It is a kind of detect Coxiella burnetii recombinase polymerase constant-temperature amplification method, primer special and probe and application |
| CN111630162A (en) * | 2017-10-04 | 2020-09-04 | 博德研究所 | CRISPR-Effector System-based diagnostics |
-
2020
- 2020-11-09 CN CN202011237867.0A patent/CN112280877B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102925574A (en) * | 2012-11-08 | 2013-02-13 | 中国人民解放军军事医学科学院微生物流行病研究所 | Primers special for detecting coxiella burnetii |
| CN108913790A (en) * | 2017-09-20 | 2018-11-30 | 李佳萌 | It is a kind of detect Coxiella burnetii recombinase polymerase constant-temperature amplification method, primer special and probe and application |
| CN111630162A (en) * | 2017-10-04 | 2020-09-04 | 博德研究所 | CRISPR-Effector System-based diagnostics |
Non-Patent Citations (1)
| Title |
|---|
| J. S. GOOTENBERG等: "Nucleic acid detection with CRISPR-Cas13a/C2c2", 《SCIENCE》, vol. 356, no. 6336, 13 April 2017 (2017-04-13), pages 438 - 442 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112941237A (en) * | 2021-03-25 | 2021-06-11 | 中国人民解放军军事科学院军事医学研究院 | CRISPR nucleic acid detection kit for specifically detecting H7N9 avian influenza A virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112280877B (en) | 2022-12-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110628955B (en) | CrRNA target and CRISPR-Cas13a system for detecting Ebola virus | |
| JP5295206B2 (en) | Luciferase expression cassette and method of use | |
| KR101394421B1 (en) | Method of detection of classical swine fever | |
| WO2014079350A1 (en) | Cho cell dna detection method | |
| JP2003509029A5 (en) | ||
| CN111154923A (en) | Primer for amplifying nucleotide fragment of novel coronavirus (SARS-CoV-2) gene and application thereof | |
| CN116676429A (en) | LAMP primer group and method for detecting pangolin respiratory syncytial virus A and B | |
| CN114807401A (en) | Composition for visually detecting melioidosis based on RPA-LbCas12a system and application thereof | |
| CN112280877B (en) | CRISPR-Cas13a system for detecting coxiella burnetii nucleic acid | |
| CN114134253A (en) | Fluorescent quantitative detection primer and kit for identifying African swine fever wild strain and gene deletion strain | |
| CN110373502B (en) | Complete set of nucleic acid, kit and detection method for detecting Hantaan virus by RPA | |
| CN111635959A (en) | LAMP primer of Fluoxapiprolin resistance genotype G700V phytophthora capsici and application | |
| CN116814857A (en) | Cat parvovirus and kit thereof and fluorescent recombinase polymerase amplification method | |
| Byrne et al. | Chimerism analysis in sex-mismatched murine transplantation using quantitative real-time PCR | |
| CN116622909A (en) | Isothermal amplification detection reagent and detection method for feline herpesvirus I type | |
| CN107604101B (en) | Novel pigeon adenovirus real-time fluorescent quantitative PCR detection kit | |
| CN113234862B (en) | African swine fever virus LAMP detection primer group and kit | |
| CN114182046B (en) | Pathogen nucleic acid detection primer probe combination of human herpesvirus, kit and application thereof | |
| CN108315487B (en) | Primer group and kit for detecting eel herpesvirus and application of primer group and kit | |
| CN107604099B (en) | LAMP (Loop-mediated isothermal amplification) detection primer group and kit for novel pigeon adenovirus | |
| WO2007119557A1 (en) | Method of detecting koi herpes virus (khv) | |
| RU2812859C1 (en) | Method of differentiating arriah-g333 genome of genetically modified strain from pb-97 vaccine strain of rabies virus using real-time polymerase chain reaction with high-resolution peak analysis | |
| RU2786213C1 (en) | Method for differentiating the genome of the nishi vaccine strain from field isolates of sheep pox virus by real-time polymerase chain reaction with high-resolution peak analysis | |
| RU2740480C1 (en) | Method for identification of bedbugs of genus polymerus - p_cognatus and p_vulneratus based on restriction analysis of cytochrome oxidase gene of mitochondrial dna | |
| KR101387288B1 (en) | Method of detecting cereus strain producing emetic toxin and primer set for the method |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |