CN112266878B - Flammulina velutipes suitable for industrial cultivation and molecular identification method thereof - Google Patents

Abstract

The invention discloses an Flammulina velutipes strain 'nongwanjin 9', belongs to the genus Flammulina velutipes, and is preserved in the common microorganism center of the China Committee for culture Collection of microorganisms. The 'agricultural Wanjin No. 9' strain provided by the invention has the quality characteristics of white mushroom body, small mushroom cap, inward rolling, uniformity, compact mushroom root, uniform longitudinal section pore, hard mushroom stem and other excellent needle mushroom strains. The parent F0321 is improved to have thinner pileus and softer stipe; and the other parent F0323 has the defects of high cultivation and management difficulty, easy occurrence of fungal quilt, terminal bud and the like; the average yield per unit of the strain is 12.9 percent higher than that of 'nong Wanjin No. 8' (significant difference) and 56.2 percent higher than that of 'nong jin No. 3' (significant difference). The 'Nongwanjin No. 9' commodity has good appearance, is suitable for market demand, has excellent comprehensive properties, is suitable for industrial production, and has good popularization prospect.

Description

Flammulina velutipes suitable for industrial cultivation and molecular identification method thereof

Technical Field

The invention relates to a needle mushroom strain, in particular to needle mushroom agricultural Wanjin No. 9 suitable for industrial cultivation and a molecular identification method thereof.

Background

Needle mushroom [ 2 ]Flammulina velutiper (Fr.) Sing]Belonging to Basidiomycotina, hymenomycetes, agaricales, tricholomataceae, and Pleurotus, and has smooth and tender pileus, crisp stem, rich nutrition, and good taste. Fujian province is the main cultivation area of golden mushroom in south China. With the expansion of the cultivation scale of the flammulina velutipes, the market also generates higher and higher judgment standards on the cultivation, color and yield of the flammulina velutipes, such as evaluation standards on the thickness and uniformity of stipe, section gaps, stipe brittleness, preservation durability, pileus size, mushroom body color and the like. At present, uniform stipe, dense mushroom bodies and white mushroom bodies become the main trend of the needle mushroom market. In the existing main cultivated species of the flammulina velutipes, the pileus of 'nongjin No. 3' (Flv 0303) is white, hemispherical, round and inward-curled at the edge, and when the relative humidity is lower than 80%, the center of the pileus is slightly faint yellow. The stipe is white, cylindrical and hollow, the base part of the stipe is fluffy, and the stipulation is a variety recognized by the crop variety approval committee of the Fujian province in 2012, and the stipulation is suitable for industrial bag cultivation of the Fujian province. 'Nongwanjin No. 8' (Flv 0012) has the advantages of thick and straight stipe and the like, but the mushroom cap is easy to open, but along with the development of the market, the market has higher and higher requirements on the quality of flammulina velutipes, the white flammulina velutipes are required to have high yield per unit and crisp and tender mouthfeel, so that the problem of insufficient backup varieties of production enterprises is increasingly highlighted, and the selection of excellent varieties with high quality, high yield, good commodity and good market prospect is particularly important.

Disclosure of Invention

The invention aims to solve the technical problems of low yield per unit of needle mushroom varieties, irregular fruiting, yellow color and the like in the existing production, and provides a needle mushroom strain with more buds, regular mushroom bodies, white mushroom bodies, good taste and brittleness of mushroom stems, high quality and high yield.

The needle mushroom strain 'nongwanjin No. 9' of the present invention belongs to the genus of needle mushroomFlammulina velutipes) The strain is preserved in the common microorganism center of China Committee for culture Collection of microorganisms, the preservation address is No. 3 of Xilu No. 1 of Beijing, chaoyang, the preservation date is 2020 years, 6 months and 28 days, and the preservation number is CGMCC NO.20214.

The invention relates to a contrast golden mushroom strain 'nongwanjin No. 8', which belongs to the golden needle mushroom genusFlammulina velutipes ) The classification of the strain is named as: flammulina velutipes (Flammulina velutipes.) (Flammulina velutipes ) "nongwanjin" No. 8 is deposited in China general microbiological culture Collection center, with the deposition address of No. 3, 6/15/2020 year, and the deposition number of CGMCC No.20203, in Xilu No. 1, north Chen, facing Yang, of Beijing.

The 'Nongwanjin No. 9' strain has the fastest growth of hyphae on a PDA culture medium at 25 ℃, the hyphae at the tip are thicker, but the regularity is slightly poor, and the number of the pollen spores is large. White fruiting body, small cap, uniform and uniform inner roll, compact root, uniform pore in longitudinal section, hard stipe, and good properties (figure 1 and figure 2).

'Nongwanjin No. 9' is bred by needle mushroom 'F0321' and 'F0323' through hybridization, and a hybrid strain 'Nongwanjin No. 9' is numbered as 'Flv0088', and is subjected to a cultivation test after being screened. F0321 has the characteristics of high yield, white mushroom roots, short period and the like, but has large and thin mushroom cap, soft stipe and poor commodity appearance. The main variety of domestic industrial cultivation (bottle cultivation) is from Japan. F0323 has the advantages of small and thick pileus and high yield. However, the variety has high cultivation and management difficulty, is easy to cause problems such as fungal quilt and terminal bud, and has greatly reduced yield or no yield once appearing. The cultivation period of the strain is 2-3 days longer than that of F0321, and the strain is also a main strain for domestic industrial cultivation (bottle cultivation) and is sourced from Japan. The control variety, nongjin No. 3F 0303, is a Fujian province industrial bag-type culture variety recognized and popularized by the crop variety approval committee of Fujian province in 2012, and the strain is white, hemispherical, round and inward-curled at the edge, and when the relative humidity is lower than 80%, the center of the strain is slightly yellowish. The stipe is white, cylindrical and hollow, and the base is provided with villus. The reference variety 'nong Wanjin No. 8' Flv0012 has the advantages of thick and straight stipe and the like, but the mushroom cap is easy to be large and easy to be opened, and is a variety which is suitable for industrialized bottle cultivation production in Fujian province and is identified by a Fujian province seed general station in 2019. Multiple cultivation experiments show that the average yield of the hybrid strain 'Flv0088' is 12.9 percent higher than that of 'Nongwan gold No. 8' (the difference is obvious) and 56.2 percent higher than that of 'Nongjin No. 3' (the difference is obvious), and the data of the size of the pileus, the thickness of the pileus and the diameter of the stipe are all superior to that of the control strain 'Nongjin No. 3' (Flv 0303). The diameter of the 'Nongwanjin No. 9' stipe is obviously larger than that of 'Nongjin No. 3', for the commodity appearance, the (Flv 0088) mushroom body is white, the mushroom cap is small, the mushroom is rolled inside, the mushroom is tidy and uniform, the mushroom root is compact, the pores of the longitudinal section are uniform, the stipe is hard, the character is better, the commodity appearance is good, and the market demand is met. Named 'nong Wan jin No. 9' (FIG. 1).

As shown in FIG. 3, the antagonism results show that 'nong Wanjin No. 9' (Flv 0088) and F0323 and F0321 both have obvious antagonism, and the colony morphology is similar to that of F0321 and is obviously different from that of F0323. No antagonism was observed between 'Nongwan gold No. 9' (Flv 0088) and 'Nongwan gold No. 3' (F0303) and 'Nongwan gold No. 8' (Flv 0012), but the difference in colony morphology was significant. As can be seen from the antagonism results in FIG. 3, F0323 has significant antagonism with 'nong jin No. 3' (F0303), and the colony morphology is not significantly different; there was no significant antagonism between F0321 and F0323 or 'Nongjin No. 3' (F0303), but the differences in colony morphology were more pronounced. As can be seen from the results of fig. 3 antagonism, there is no significant antagonism between F0323, F0321 and Flv0012, the colony morphologies of F0323 and Flv0012 are similar, and the colony morphologies of F0321, F0323 and Fv0012 are significantly different. By combining the results of the antagonism experiments, whether Flv0088, flv0012, F0323, F0321 and F0303 are different varieties needs to be identified through DNA fingerprints.

The flammulina velutipes strain adopts a Kmer subtraction assembly technology according to genome sequencing data to obtain differential fragments (SV), 11 SV sequences are selected to design specific primers (F1-F11), and Flv0088, flv0012, F0323, F0321 and F0303 are amplified to obtain PCR products, wherein the amplification result is shown in figure 5. From the detection results, it can be seen that the bands of the agrobacterium tumefaciens 9 and the parent and the control strain are different, so that the DNA fingerprints of Flv0088, F0323, F0321, flv0012 and F0303 are significantly different, and the agrobacterium tumefaciens is determined to be different varieties.

The invention has the advantages that: the average yield of 'agricultural gold 9' (Flv 0088) provided by the invention is 428.3 g/bottle, the total average yield of the control variety 'agricultural gold 8' (Flv 0012) is 379.5 g/bottle, and the total average yield of 'agricultural gold 3' (F0303) is 274.3 g/bottle. 'Nongwan Jinjin No. 9' has an average yield 12.9% (significant difference) higher than 'Nongwan No. 8' and 56.2% (significant difference) higher than 'Nongjin No. 3'. The data of the size of the pileus, the thickness of the pileus and the diameter of the stipe are all superior to those of a control strain 'Nongwanjin No. 8' (Flv 0012). For the appearance of a commodity, 'nongwanjin No. 9' (Flv 0088) mushroom is white, mushroom caps are small, rolled in, and neat and uniform, mushroom roots are compact, longitudinal section pores are uniform, mushroom stems are hard, and the character is better.

Drawings

FIG. 1 is a standard picture of "Nongwan gold 9" and a reference variety "Nongwan gold 8" or "Nongjin No. 3

FIG. 2 is a longitudinal section of "Nongwan gold 9' (Flv 0088) and control varieties" Nongwan gold 8 "and" Nongwan gold 3 ";

FIG. 3 shows the results of comparison of "Nongwan gold 9' (Flv 0088) with the control variety 1: 'Nongwanjin No. 8' (Flv 0012), control variety 2: antagonism test of 'nongjin No. 3' (F0303), F0321, F0323;

FIG. 4 is a diagram showing the amplification results of each specific fragment;

FIG. 5 is a PCR electrophoretogram of each specific fragment; m.1000bp Marker;1.Flv0088; f0321;3.F0323;4, flv0012; f0303;6. and (5) negative control.

Detailed Description

Example 1: selecting mainly cultivated flammulina velutipes 'F0321' and 'F0323' as hybridization parents, selecting the experiment to prepare 180 combinations together, screening 59 hybrids containing lock combinations by microscopic examination, screening 50 hybrid strains with better growth vigor, performing a primary screening fruiting experiment, and selecting 11 hybrids capable of fruiting to enter a secondary screening. 4 hybrid strains in 11 rescreened hybrid strains have average yield of more than 400g, wherein Flv0088 comprehensive character is better, and the hybrid strains reach the expected breeding target, are named as 'Nongwanjin No. 9' and are used for carrying out subsequent batch tests.

Selecting mainly-cultivated flammulina velutipes 'F0321' and 'F0323' as hybridization parents, selecting 20 'F0321' monospore strains and 20 'F0323' monospore strains with higher growth speed and more developed aerial hyphae as the parents, pairing the strains according to a full combination mode, preparing the strains to obtain 60 combinations, performing microscopic examination to obtain 47 parts of hybrids containing locked combinations, performing a primary screening and fruiting experiment, and selecting 20 hybrids capable of fruiting to enter secondary screening. After secondary screening, 14 crossbreed seeds normally grow, the number of the crossbreed seeds with the yield higher than that of a contrast strain 'nongjin No. 3' is 13, but the number of the strains with the yield higher than 400 g/bottle is only 3, wherein Flv0012 has better comprehensive characters and achieves the expected breeding target, and the crossbreed strain is named as 'nongwanjin No. 8' and is used for carrying out subsequent batch tests.

The difference comparison of 'Nongwanjin No. 9' strain and its parent strain is carried out by antagonism reaction method.

The detection basis is as follows: inoculating, culturing and observing the sample to be detected according to the agricultural industry standard NY/T1845-2010 edible fungus strain differential identification antagonistic reaction of the people's republic of China.

Detection materials: 5 needle mushroom strains, wherein the strains to be detected are 'Nongwanjin No. 9', and the reference variety 1: 'Nongwanjin No. 8' (Flv 0012), control variety 2: 'Nongjin No. 3' (F0303), F0321 and F0323.

The detection method comprises the following steps: and (3) according to strict aseptic operation, respectively punching edges of activated bacterial colonies of the strains of the proper age by using a phi 8 mm puncher to serve as inoculation blocks, wherein the interval between the two inoculation blocks is 10 mm, and hyphae face upwards. Culturing at 20 deg.C under ventilation and dark condition until inoculated mycelium comes into contact, and culturing in natural light for 7d.

Results and analysis: the hyphal reaction at the interface between the two strains on the surface of the culture was observed under light or natural light, and the results are shown in the figure (FIG. 3).

And (4) detection conclusion: as can be seen from the antagonism results in FIG. 3, the obvious antagonism phenomenon appears between the ` Nongwanjin No. 9 ` and the parents F0321 and F0323, the hyphae have obvious difference, and the hyphae forms are completely different. The antagonism phenomenon between 'Nongwanjin No. 9' (Flv 0088) and 'Nongjin No. 3' (F0303) and 'Nongwanjin No. 8' (Flv 0012) is not obvious, but the colony morphology difference is obvious.

Example 2: and (3) carrying out DNA difference comparison on the strain and the parent strain by using SV detection technology.

Detection materials: 5 needle mushroom strains, wherein the strains to be detected are 'Nongwanjin No. 9', and the reference variety 1: 'Nongwanjin No. 8' (Flv 0012), control variety 2: 'Nongjin No. 3' (F0303), F0321 and F0323.

The detection method comprises the following steps: and according to genome sequencing data, obtaining differential fragments (SV) by adopting a Kmer subtraction assembly technology, and correspondingly selecting a plurality of SV sequence design specific primers to amplify the sample to be detected. (see Alkan, C., coe, B. P for reference.& Eichler, E. E. Genome structural variation discovery and genotyping. Nature reviews. Genetics,2011 (12), 363-376; zhufengli et al, korean Ganoderma lucidum genome-wide re-sequencing analysis, world science and technology-Chinese medicine modernization, 21 (4) 764-774.). The SV test primer sequence was synthesized by Ongchoma Biotech Ltd.

The activation, culture, genome DNA extraction and electrophoresis detection of the mycelium of the strain to be detected are carried out according to the agricultural industry standard of the people's republic of China.

The 11 pairs of SV primers used for identifying the authenticity of the strain are as follows

Primer sequences for SV of Table 1

Results and analysis: the DNA fingerprint of the flammulina velutipes strain is established by SV detection technology: according to genome sequencing data, a Kmer subtraction assembly technology is adopted to obtain differential fragments (SV), 11 SV sequences are selected to design specific primers (F1-F11), and Flv0088, flv0012, F0323, F0321 and F0303 are amplified to obtain PCR products, wherein the amplification result is shown in figure 5. The analysis of the PCR amplification results for each specific fragment is shown in fig. 4: F1-F3 are consensus sequences of Flv0088, flv0012 and F0303, and are different from F0321 and F0323. F6, F7, F11 are consensus sequences of Flv0088, F0321, flv0012, F0303, different from F0323. F4 and F5 are consensus sequences of Flv0088, F0321, F0323 and F0303, and are different from Flv 0012. F8 and F9 are consensus sequences of F0323 and F0303, and are different from Flv0088, F0321 and Flv 0012. F10 is a consensus sequence of F0323, flv0012, F0303, different from Flv0088 and F0321. By combining the detection results, the DNA fingerprints of Flv0088, F0323, F0321, flv0012 and F0303 are obviously different, and different varieties are determined.

And (4) detection conclusion: SV analysis results show that the flammulina velutipes to be detected, namely 'nongwan jin 9', is a hybrid of 'F0321' and 'F0323', has obvious difference with DNA fingerprints of parents and varieties recognized by provinces, and is different varieties.

The DNA sequence of each specific fragment is as follows:

F1（787bp）

GTGTGTGGCATAAGGATCGGTAATAAGCTCAACCTCGTGTCCCTTATCAGATGATGCCAGCGCTTAAATATCTCGGACCACATTTTTAGACCTTCAGCTTCTTCCTTGAGTACTACCATGTCGTACGACTGGGATGCGGCTAGTGCTGCATTGATCTCGCAGCTGATCCTCGACGACATCGAAGAGATCAACGGACGACGCAAGGGTAAAGGCCGCGACGACGTTGGTCCCTCTGATGAGGAGATCGCTTTCAGGATACAAGAAGAGAGCTTTCGTGCAATGCTTATGGATGTTAGACTCGCTCAGAGTATCGATCAGGCTCTTATGACCGACGCAGATGTCCTAGCTGCCGAACAAGCTGCGCATGATGACCGCGAGTATGCACAGGCGCTCGCTGAAGGTCGTCCGTTGCCTGAACAATCCGAGCATCAACGAAGCTTGGAAGGTAATCGGTGAGTGCCATTCTGCCAATTCCGTGTAACACGTTGTTTTAATTGTATCTAGACCATCATCTCCTCCCACACCGGATGACGATGATGACACTTCTGTTGTGCGAGTGGCAACTAGTAGCAACACAACCCGGATGGAGTGTGTCATTTGTGGCGACGGCGTCCATCTTCACACATCCTACTCAGCACCATGCCGGCATAGGTATTGTCTTGACTGTCTGCGTGACCTCATACGAGCGTGCGTCAATGACGAATCGCTCTACCCTCCCCGATGCTGCAACCAGCCTTTCATCCACTCTACTATTTTCCCCCTCCTCGACAAAACTCTCCACCAGCAA；

F2（584bp）

AGCGGGACTCTCCTTATTGTTCTTCTGGCGCCGCTGCTCGTCCTCCTCAAGAATGTCCTTGATGCCTGGCATGTAGATTTCTTGATGCCGCCTAAAGACCTTCAGTCTGCTGAAAAAGGCCAAGTGCCGCTCATGAATCTTCGTTTGGCGGCCCACCGGCATGTTTACAGCCGTCTTCTTTTCGCTGACAATACGACGTCTGGACTGTCATCAGTATCCCATGGCAAAGAACGAGCATGAGAGCTTACTGCATATCCTCGAGTTGTAGACCCAAGATAAGGAAGCCCGCCTGAGTGACTCCATGTGCGCCCGCGGATTTCCGCCTACTCTTCTTACGCCTCCTGCCTGATAGCTCCTCGTGGGTAGAAGAATCGTCCTCCTCAGGCGTCATCGACTGTGCGTCGTCTGCCGCCTCACGGACCTCCGCTTGCTGGAGCTCCAGCCTGACCGACACCTCCGACATCATCGCTACACAACCATGTCAGACACTCAGACCCCTAAATGCATTGTACCATTTACCTTCACCAGACGGGGCATATGGATTGGGTTTTGAGTGATCCGCTACCCACTCTTTGACCATTGCT；

F3（658bp）

GGCAGTCAAGTGCTACAAACGTTGCCCTGGTCATCATCAACTTGCGCTCCGTTTCTATAATTTTAAGATTCATACTTGCATTCACGTCAAGTGATAAATGTGTGCTTGCATTCTACATTATAGAGGTGTCAATCATCCAGTTTCATGAATAGTGAGGAAAGGACTCCACTGTGGTATCGAGACAGCAGTAACACTTGAACGAGATGTTACATAGAACATGACTGACTGATGTGAATTGGGAATCAATTCCGGGACTTCTTGATTATCTGCAAGTCAGCTGCATGAATCGGAGTCGGACACATAAGATTATCTGGGAAAGATAGGCTAGACCTATAAACCACTTCAATTAGAATCAAGAGCGCCGTAGCTCTACCCTCGGAGAACAATTATCTAGTAAAAGTAGGAATGTGGAACCCGATTTAGATGTCAATGATTGACGACACGCGTATTATTTCTTGACTTCCTACTGTGACCAAGGTTTTCCTTTATCCTCCCGCATGACCTACAAGACTGAAAAGGAGAGAAAAGAGGCGATCTTGACCTCAAAGAGACTGTACTGGAAGAGGTATGCTCTGAATTCAAGACTGGCGCCCCGACTGACCGTTCCATAGACATCGCAGTCGGTTAGTCCCAGAGGCAAAGAAGCGCTATCAGCTCA；

F4（902bp）

TTCCATCAATCCAAGCCTCGGATCGGGTCTTCCTATAGCACTCCTTTGCATTCTTGCGCAAGCGCAGGCGCTCCCTGGTCAATATTGTCAAGTTGTGCGCATTACATCACAAGAATATATGCCTACCTGGCCCAGTACGCTCTCTTGGAGCGGAGGACAGCCTGAACTCGTGCAGTGTCCGTCTGATAAGTCATGAATTCTATGACAAGGACTCGGTGGAGCGCTGACTGAACGCGCAACGTTGGTCTAAGTAGGTGGTCGAAAGGTGATCTCCGTTCCGAATCCCGAGAATTGATCTCCGTGCATACAGTAGGTTTTAGCTAGATACTTTTGCTTTGCTGTCCTCAATGTACTCCGGCGCGGCGTCGGCTGCCTTTGAAACGAAGCTTTGGCTCGTTTGTAAATGGTTAGCCTACCCTACAAGTGTATGTATAGTGCATGACCAGCTAACAAGACAAAAATACCCTACTTTCGCTAGAATATTCGGCTACGCTCCCTCATCTCTCACTCTAGTAGGTAATCACTGGCTCTCCCCAGATACACTCAATGTCTCACTTCGTTTTCAGAGTAAGGTGTCATCTAAACTAATTCCTCTGTCTACCACTACTCGCTTCACACCGCCGCCTCAAATCTTGTTAAGAAATACATAACCTTTGAACTCTATGCTATAGCTTCCCGTGCTCGACGGTTAGACCAGGGCTCAAATATCGGCCTTTGCCTTTACCTTAGGCTTAAACCATCATGGTCAGGCTCCCTCCATCCCCCGACTTCCACTCCAAGTGTTTCTCTGAGGAGCCCGTGGACGTATCCGTTGTCTCATTATTGTGGGTACTATGATATAAATTTTCAAGCGTCGCCTAATAACGAGATATTTTTGTTAGTGTCCTTCGTTGTCATTTGCG；

F5（713bp）

TTCGAGCGAGCGATGAAATAGCTCCTTTTTGAAGGTTCGAAAAGCAGCATCATTGTCGTGCTTACGAGAGCCTATTGAAAAGTCAGTGCAAACACAGACGGAGCAATAGTTGTACTGACTTTTTGGGATTGCGAGAAAGCCGATCGGTAGTACGCCATTGCGATGGCCTCGTCGTGCACCATTGTGCAGGTTTCCTATGCTGAGATACAATGGCCAGTACTCGACATTGCCCGTGGCAACGGATACGGTAGTCTTGTCGCTCCCGAGGATGATCGTCACAAGCATTGCTCCATCGGTGGAATTATCGGCGATATATATTGTGTCCTGTGGGTGTTTTAGTCGGGGGCAACACAAAAAAGAGGAAGGCGACGCACTGCATGTCTCCATGCATACTTTCCCGACATGAAGTCTGCCCATCGCCTTGAACCATCCGGGCCCCTCTCAATGTATGGCGCTTCATCAAACTCATCCTTGAACTCGGGGTTGGCCAGCATGTTGCTAATAACAGTATCTGGGTCCCGATACCAGATCTGGTATGGAACACGTCGATATTCAGGAAGTGCGGGATCACTTGAGGCTTCGGTTTCGAAGCAGCGCCAGGGAGCACTGCCATGCTGGATCTCATCGATAGTCGCATGAATCTGCTGGTGATCTTTGAAGGGCGCCTCCACGTCGTTCATGGCAAGCTGAATGATTTCGCAGAGTTCGTCAGT；

F6（886bp）

GCCAAACGAAGGATGACGATGAAATCGAAGAGGAAGAGGAACGGGAGGCATCGGTCAATGAGGGCGAGGCAGACGAAGACAACGAGGCCACCCTCCAATTCGATCCTAGTTGGTCAACGTCCCCTCGGGTCCCTTTTCCGTCGAGGGAGGAGAAGACGGGAAACTTCCCGTACGCCGTCATCCGCCAGCATTGCGGTCTTCCGTCGTACGGTGTGGATCGTGCGCATGTTCCGTATCACGCAAATATTCTGGTGGCCCTTCGGGAGGGTTTGCGCAATGGGACTCTCATGGTATGTGTTTTTTATCTTCCTCTTTTTATTCTGCTCAAGCCTTTATGCAAGATTCACGACCCTCCGTGCCCTCGATGTGCCACCAAACCCCCCGCGCAGAAGTGGCTGGGCTGGTGCTGCATTGGCATCACCAACGATCCTCGTACCGTGTGCTTCAACTGCACCATCCATTCCGGCTATCTTTGCTTCCCCTCCGATGGGGCTGCCGTCGTCGCTTCCTCTACCGTGGATGACCGCAGTGTGGCGATGCGCAAAGCATCGCGTCCTCGTGCCGCCACTCGTTCCGCGACGAAGGGGAAGAAGCGTCAGCGGGACGAATCACCGTCATCGTCCAGGTCACTGGTTGCCACAGGAAGCGGCCAGACGTGGAAGTCCATGGATGGGCGCGAGTACGGAATATTCATTCCAAAGTCGCGCCTCTCCTCCACCCAGCCTTCCGAAATCCCTTCCCGCGCACCACGAGATGATGATCAACTTGGGGAAATGTTGGCAGTAATGAAGGAGTCAGTGTCTGAGATGAAGGGTATTCGCCTGGAGATGAAGGGTGTTCGCCAGGATGTGGAGGGTCTTCGCTTGGATGTGAAGTGGTTGCGTGA；

F7（593bp）

CGAAAGTCCAACATCCGACAACACAAACAGGTAGAGCTCTTCAAAGCCTTCTACAACCTGATTAGCCGCACATCCCAACCGTTGAAGCTCACTAGCTGCTCCCATCTGCAACCAATGCACAATTGACGCCTCTGTAGTCACCGATGGCTCAACAATAATCCCTGCCTCCACCATATCAACCACGAGAAGATAGGAAGTTAATCGTCCAAAAGCAGGGAGACGAGTCTTCACCAGCGCTTTGACAAGTCCATCAAAGTCTGCACGGTAAATACGAACCAGCTCCAGAATCTCCATACGTCTATCCCAATATGTCTGAGCACATTTTGTAGCTCGACCTTTGGTAACTCCATGAGCGGCATTAGAACAGAAGAACTTCTCCCCTTGTATCTTGCCGTCCCAAGGTGTCGTTAAGAAGGCTGACCAGCTGTCCAAATCGGCAAAGTAAAGAGAGTGTCCCGAAGTGCGAGCAGCGGGAGTATTGAATAGGATACCGCGCCAGATCAAAAGACTGAAGATCTTGCTCTGATTGAGTGGATGAGCAGAATCGAACGGTCCTCCAATACGTGTGACTGCCTGACGTGAAGGTGCATGAT；

F8（828bp）

GCCGCGTCACTCATTCTATTTGTGCGTATCTTCCGCGTCTGAAAGGTTCCGGCATTTATTCACTCAACAGGACGTCAATTGGTCGGGTGTAATGGCCCACCAAATATATGGTCGAATCCATCGTCGTGGACAAACACGCGAGACCTTTATCATACAACTGGTTTGCGCGAGGACGGTTGAAGTCTTGCTAGTGGCCAACGGTCTGTCTAAACACACACTTCTTTGCAACTTCCTTGAGGCAGAGCGCAATGAAGGTATGTCAGTTTATGTTGATGCACGTCAATACTAACAATAGTGCAGAGCTGTGGAATCTAATCCAAAACCGGGACAGTTGTGACGATAACCTGCCCGCTGTCGACGCACTAGCCGGATTCGACGACGACGCCCGTGCGCAAGCGAAGGCAGCCAAAGTCAAGGTCCGTGCCACTGCCGGTCCGTCGAAAGCCAAGAAGCGGAAAGTCACAAGTGTCGAGACCGTTGGGGACGACGATGCCGTTACTTCGAAGGCGGTGCGCCCCAAGAAGGGAAAGGCTCCCGTCGGCGAGATCGTGGTTGACAACCCCGCCGCTGCTCCATCTACTGGACCTTCCAAAGGAAAGGGCAAGGGCAAAGCCTCCATACCCATAGACGTCAGTGACGACTCGGAGGAGGAGGAGGAAGATGATGCACTGCCTCCCGCCAAGAAGAAGAAGGGGGGGAAAGAGGTGGCGCTGCCTACGGCGGGGGTCGGAGGGTCGAAGAAACGGAAGACTCTAGCTGGGAGCAACGCCTCACAGCCTCCTTCGCCTGTCAAACCTCCGGCGAAAAAGAGCAAGACTGACATTCCGG；

F9（907bp）

CTGCTACAAGTGCCATCTCCCAAATGGGACGGACGACCTCATCCATGGAAAGTTTGGCGAAACGGCTTGTCCGTACCCTGATCTTCTCGGGACAATCGGCTACGGGATCGTCACGTCCCCGTCGATGCGCCAAAACCTTGAGCAACACGCCAACGTTGAATGGACCGGTGTTGGCGATTTCGCCCAATGGGCAGCGAAGCGGTCTGTCCGTTTCCCATCCAACCTGATCGAGATATTGGTATGGTACCGAAACACTTACTTCTAGAGCCATCGTGCACATGTAACCTGTCCTGTACCCTTTTAATCTAACTGAGCCCACCGTTGGCATTCATGCGATTATGTGGCCCTTGTTCGCCGTGCGGTTGGAAGTAGCAGCTCAGCATCACCTGACTTGTGCATCATGGGTAGGTTTCGGTGATCCAGCTACAAGTACTGCACGTGGCGCACTCCCATGCACGATCACGTGGTAATTATTTGCCCCTTTTCTTGGTCTCCTCGTTGCACTTGTTTGGCAAGAGGCGACTAAAAAGATATATATATAAGGTGTGTCTTCAAGATTGTGTCCTTCCTTCCTTCCCCTCACCCCACAAACCAGATGCCTCAAGCCAGCAAGTCCTTGCACGACGGTGACAATTCTAAACCGTTTGCTAAGAAGAAGAACGCAGTAAGTTCATATCTGGTTTGGGGCGACTTTTCATTCACCAATGGGGTCACCTTAGCATTTACCTACAAGCGACAACAATCCCGGAAAGTCAATGATTGTACACCAGGTCTGTCGTCAGCAACCGACAGATCCTGCTTCCGTTGGTACTGCTAGCGCCACCACTGTGAGGCCCATCGTTCCCCGATTGGCGCCCATTATTGACCCAAAGCACGGTCTTTCAGCTGGACAACACTCATCCCCCTA；

F10（274bp）

CCGCGGTATAACATTCAGCCTGCGCCCATTGTTCGAAGCGCACCACGTACGTATCAACGATTCATATTGCCGACTTTGATCCCCGTCGACTCGTGACGGGGACACAGGATATCTATCTTCCCTCCCACCATCATCTACGGTCGTCGTTTCGCGCTGCGACAATCCGATAGCGAGAGGCTCGCTCGCCGCGGGGCTTGGGGTTTCAGAAAAAGGTGTGTATTTTTCATGCTACTATACAACTGCGTTTGACGTTTAAACACAGTTAATGCCACGT；

F11（721bp）

ACATTTGAGAAGATGGGCGGCTGGGAGTCCAAGCCATGTCGTAATGATGCGAAGAACAGACTCTAGTATTTTTTGGTCCAAGGTACGTGAATTGGGTACGTTGTTGGGCATGCTAACAAGCGCACCAACCGAAGGTTGAAGAGAGGGTAGATAGTCCGTGGAATTGAAAGTTATCGTTTCTTTTGGGTGCTGTCGCATTTGTTGCTTGAGATGTCGCACTAATCGAGACAGCCAGGGGATCTTGCCTGGATCATCAATTGCACGAAGAGCTCCAAGCAACCACGACCTGACGAGGTGGTGATGATTGAGGACAATGTCCTTCAAGACAAGTGTCTCGGCAACAAGCGAATCGATTTGCTGTAGTACACGGTCCATTGTCGATTGCGCTGCGATAGTAGTCGTGATACTTGTTGGCTCCCATGGTGCATCTTCAAGAACCCCCCAAGCAGTCATCAACTTGATGATGTCGGGACTGATTTCCTGGAACGAATGAGAGGTCGTGGTGGCGCTAAACACAGCAGAGACCCGATCGATGCTTTCCACCGTAAAATTACGAAGAAACGGAATATCTAGAGAAATGAGTATCGGAGAGATGATCTATGATACTTGCAACATACCAGTAGTGAAGTTCTCGTCATCCTCATCTTCGATCGATAAAGGCATTTCATCACGGGACTCAGCGAACTGCCACATTGCTGTACTTTCGGCATCAACTCTCTCC。

example 3: the results of multiple stable yield tests carried out by the 'Nongwanjin No. 9' show that the 'Nongwanjin No. 9' has the requirement of industrial cultivation and has the yield remarkably higher than that of control varieties 'Nongwanjin No. 8' and Nongjin No. 3 (F0303).

Multiple batches of reference strains for stable yield and productivity tests: 'Nongwanjin No. 8', 'Nongjin No. 3' (Flv 0303).

Test site: fujian Wanchen Biotechnology corporation.

Test arrangement: the strains are prepared uniformly, the test points are cultivated in a factory according to a local production management mode, and the strains are cultivated in bottles by adopting a multi-system moving bed frame mode (plastic bottles, 0.43kg (dry materials)/bottles). Specific cultivation information is shown in table 2:

TABLE 2 Multi-batch test information sheet

Hypha growth test results: in the experimental seed production period, mycelia of 'Nongwanjin No. 9' are dense in PDA, and the optimal growth temperature is 25 ℃ (Table 3).

TABLE 3 hyphal growth rate test results (unit: cm/day)

The metastable productivity test finds that: (1) The time from inoculation to harvest is 'nong Wan jin No. 9' Flv0088 which is the same as that of a contrast strain 'nong jin No. 3' and 'nong Wan jin No. 9', and the time is 45 days; (2) 'Nongwan 9' (Flv 0088) average yield 428.3 g/bottle, 'Nongwan 9' average yield is 12.9% higher (significant difference) than 'Nongwan 8', and 56.2% higher (significant difference) than 'Nongwan 3'. (3) The data of the size of the pileus, the thickness of the pileus and the diameter of the stipe of the Nongwan gold No. 9' (Flv 0088) are all superior to that of the control strain Nongwan gold No. 8, and the Nongwan gold is not easy to open the umbrella. (4) For the commodity appearance, the mushroom body of 'nong Wanjin No. 9' (Flv 0088) is pure white, the mushroom cap is small, the mushroom root is compact, the mushroom stem is hard and the like, which all meet the market requirements (figures 1 and 2).

Statistics of yield results of multi-batch stable yield test strains

TABLE 4 Multi-batch test results

Note: a, b, c means that the difference is significant at the level of p =0.05

Statistical analysis of test strain yield: the results of three batches of experiments show that the average yield of the 'nong Wanjin No. 9' (Flv 0088) is 428.3 g/bottle, the average yield of the control variety 'nong jin No. 3' (Flv 0303) is 274.3 g/bottle, the yield is increased by 56.2 percent (significant difference) compared with the control strain 'nong jin No. 3'), the average yield of the control variety 'nong Wanjin No. 8' (Flv 0012) is 379.5 g/bottle, and the yield is increased by 12.9 percent (significant difference) compared with the control strain 'nong jin No. 3').

The test results of multiple batches show that: 'Nongjin No. 3' has smaller pileus, thinner stipe, softer mushroom body, more villus at the base of the mushroom body and poor commodity appearance; the 'Nongwanjin No. 8' has slightly larger pileus, easy opening, slightly thicker stipe, more caking phenomenon, less fluff at the base part and good commodity appearance; the 'nong Wanjin No. 9' mushroom has white mushroom body, small mushroom cap, small and uniform inner roll, compact mushroom root, uniform longitudinal section pore, hard mushroom stem, better character, superior commodity appearance, accordance with the industrialized cultivation mode and great market potential.

SEQUENCE LISTING

<110> Fujian university of agriculture and forestry

FUJIAN VANCHEN BIOTECHNOLOGY Co.,Ltd.

<120> needle mushroom Nongwanjin No. 9 suitable for industrial cultivation and molecular identification method thereof

<130> 33

<160> 33

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Artificial sequence

<400> 1

gtgtgtggca taaggatcgg 20

<210> 2

<211> 20

<212> DNA

<213> Artificial sequence

<400> 2

ttgctggtgg agagttttgt 20

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

agcgggactc tccttattgt 20

<210> 4

<211> 20

<212> DNA

<213> Artificial sequence

<400> 4

agcaatggtc aaagagtggg 20

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

ggcagtcaag tgctacaaac 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

tgagctgata gcgcttcttt 20

<210> 7

<211> 20

<212> DNA

<213> Artificial sequence

<400> 7

ttccatcaat ccaagcctcg 20

<210> 8

<211> 20

<212> DNA

<213> Artificial sequence

<400> 8

cgcaaatgac aacgaaggac 20

<210> 9

<211> 20

<212> DNA

<213> Artificial sequence

<400> 9

ttcgagcgag cgatgaaata 20

<210> 10

<211> 20

<212> DNA

<213> Artificial sequence

<400> 10

actgacgaac tctgcgaaat 20

<210> 11

<211> 19

<212> DNA

<213> Artificial sequence

<400> 11

gccaaacgaa ggatgacga 19

<210> 12

<211> 20

<212> DNA

<213> Artificial sequence

<400> 12

tcacgcaacc acttcacatc 20

<210> 13

<211> 20

<212> DNA

<213> Artificial sequence

<400> 13

cgaaagtcca acatccgaca 20

<210> 14

<211> 20

<212> DNA

<213> Artificial sequence

<400> 14

atcatgcacc ttcacgtcag 20

<210> 15

<211> 20

<212> DNA

<213> Artificial sequence

<400> 15

gccgcgtcac tcattctatt 20

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

ccggaatgtc agtcttgctc 20

<210> 17

<211> 20

<212> DNA

<213> Artificial sequence

<400> 17

ctgctacaag tgccatctcc 20

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

tagggggatg agtgttgtcc 20

<210> 19

<211> 20

<212> DNA

<213> Artificial sequence

<400> 19

ccgcggtata acattcagcc 20

<210> 20

<211> 20

<212> DNA

<213> Artificial sequence

<400> 20

acgtggcatt aactgtgttt 20

<210> 21

<211> 20

<212> DNA

<213> Artificial sequence

<400> 21

acatttgaga agatgggcgg 20

<210> 22

<211> 20

<212> DNA

<213> Artificial sequence

<400> 22

ggagagagtt gatgccgaaa 20

<210> 23

<211> 787

<212> DNA

<213> Artificial sequence

<400> 23

gtgtgtggca taaggatcgg taataagctc aacctcgtgt cccttatcag atgatgccag 60

cgcttaaata tctcggacca catttttaga ccttcagctt cttccttgag tactaccatg 120

tcgtacgact gggatgcggc tagtgctgca ttgatctcgc agctgatcct cgacgacatc 180

gaagagatca acggacgacg caagggtaaa ggccgcgacg acgttggtcc ctctgatgag 240

gagatcgctt tcaggataca agaagagagc tttcgtgcaa tgcttatgga tgttagactc 300

gctcagagta tcgatcaggc tcttatgacc gacgcagatg tcctagctgc cgaacaagct 360

gcgcatgatg accgcgagta tgcacaggcg ctcgctgaag gtcgtccgtt gcctgaacaa 420

tccgagcatc aacgaagctt ggaaggtaat cggtgagtgc cattctgcca attccgtgta 480

acacgttgtt ttaattgtat ctagaccatc atctcctccc acaccggatg acgatgatga 540

cacttctgtt gtgcgagtgg caactagtag caacacaacc cggatggagt gtgtcatttg 600

tggcgacggc gtccatcttc acacatccta ctcagcacca tgccggcata ggtattgtct 660

tgactgtctg cgtgacctca tacgagcgtg cgtcaatgac gaatcgctct accctccccg 720

atgctgcaac cagcctttca tccactctac tattttcccc ctcctcgaca aaactctcca 780

ccagcaa 787

<210> 24

<211> 584

<212> DNA

<213> Artificial sequence

<400> 24

agcgggactc tccttattgt tcttctggcg ccgctgctcg tcctcctcaa gaatgtcctt 60

gatgcctggc atgtagattt cttgatgccg cctaaagacc ttcagtctgc tgaaaaaggc 120

caagtgccgc tcatgaatct tcgtttggcg gcccaccggc atgtttacag ccgtcttctt 180

ttcgctgaca atacgacgtc tggactgtca tcagtatccc atggcaaaga acgagcatga 240

gagcttactg catatcctcg agttgtagac ccaagataag gaagcccgcc tgagtgactc 300

catgtgcgcc cgcggatttc cgcctactct tcttacgcct cctgcctgat agctcctcgt 360

gggtagaaga atcgtcctcc tcaggcgtca tcgactgtgc gtcgtctgcc gcctcacgga 420

cctccgcttg ctggagctcc agcctgaccg acacctccga catcatcgct acacaaccat 480

gtcagacact cagaccccta aatgcattgt accatttacc ttcaccagac ggggcatatg 540

gattgggttt tgagtgatcc gctacccact ctttgaccat tgct 584

<210> 25

<211> 658

<212> DNA

<213> Artificial sequence

<400> 25

ggcagtcaag tgctacaaac gttgccctgg tcatcatcaa cttgcgctcc gtttctataa 60

ttttaagatt catacttgca ttcacgtcaa gtgataaatg tgtgcttgca ttctacatta 120

tagaggtgtc aatcatccag tttcatgaat agtgaggaaa ggactccact gtggtatcga 180

gacagcagta acacttgaac gagatgttac atagaacatg actgactgat gtgaattggg 240

aatcaattcc gggacttctt gattatctgc aagtcagctg catgaatcgg agtcggacac 300

ataagattat ctgggaaaga taggctagac ctataaacca cttcaattag aatcaagagc 360

gccgtagctc taccctcgga gaacaattat ctagtaaaag taggaatgtg gaacccgatt 420

tagatgtcaa tgattgacga cacgcgtatt atttcttgac ttcctactgt gaccaaggtt 480

ttcctttatc ctcccgcatg acctacaaga ctgaaaagga gagaaaagag gcgatcttga 540

cctcaaagag actgtactgg aagaggtatg ctctgaattc aagactggcg ccccgactga 600

ccgttccata gacatcgcag tcggttagtc ccagaggcaa agaagcgcta tcagctca 658

<210> 26

<211> 902

<212> DNA

<213> Artificial sequence

<400> 26

ttccatcaat ccaagcctcg gatcgggtct tcctatagca ctcctttgca ttcttgcgca 60

agcgcaggcg ctccctggtc aatattgtca agttgtgcgc attacatcac aagaatatat 120

gcctacctgg cccagtacgc tctcttggag cggaggacag cctgaactcg tgcagtgtcc 180

gtctgataag tcatgaattc tatgacaagg actcggtgga gcgctgactg aacgcgcaac 240

gttggtctaa gtaggtggtc gaaaggtgat ctccgttccg aatcccgaga attgatctcc 300

gtgcatacag taggttttag ctagatactt ttgctttgct gtcctcaatg tactccggcg 360

cggcgtcggc tgcctttgaa acgaagcttt ggctcgtttg taaatggtta gcctacccta 420

caagtgtatg tatagtgcat gaccagctaa caagacaaaa ataccctact ttcgctagaa 480

tattcggcta cgctccctca tctctcactc tagtaggtaa tcactggctc tccccagata 540

cactcaatgt ctcacttcgt tttcagagta aggtgtcatc taaactaatt cctctgtcta 600

ccactactcg cttcacaccg ccgcctcaaa tcttgttaag aaatacataa cctttgaact 660

ctatgctata gcttcccgtg ctcgacggtt agaccagggc tcaaatatcg gcctttgcct 720

ttaccttagg cttaaaccat catggtcagg ctccctccat cccccgactt ccactccaag 780

tgtttctctg aggagcccgt ggacgtatcc gttgtctcat tattgtgggt actatgatat 840

aaattttcaa gcgtcgccta ataacgagat atttttgtta gtgtccttcg ttgtcatttg 900

cg 902

<210> 27

<211> 713

<212> DNA

<213> Artificial sequence

<400> 27

ttcgagcgag cgatgaaata gctccttttt gaaggttcga aaagcagcat cattgtcgtg 60

cttacgagag cctattgaaa agtcagtgca aacacagacg gagcaatagt tgtactgact 120

ttttgggatt gcgagaaagc cgatcggtag tacgccattg cgatggcctc gtcgtgcacc 180

attgtgcagg tttcctatgc tgagatacaa tggccagtac tcgacattgc ccgtggcaac 240

ggatacggta gtcttgtcgc tcccgaggat gatcgtcaca agcattgctc catcggtgga 300

attatcggcg atatatattg tgtcctgtgg gtgttttagt cgggggcaac acaaaaaaga 360

ggaaggcgac gcactgcatg tctccatgca tactttcccg acatgaagtc tgcccatcgc 420

cttgaaccat ccgggcccct ctcaatgtat ggcgcttcat caaactcatc cttgaactcg 480

gggttggcca gcatgttgct aataacagta tctgggtccc gataccagat ctggtatgga 540

acacgtcgat attcaggaag tgcgggatca cttgaggctt cggtttcgaa gcagcgccag 600

ggagcactgc catgctggat ctcatcgata gtcgcatgaa tctgctggtg atctttgaag 660

ggcgcctcca cgtcgttcat ggcaagctga atgatttcgc agagttcgtc agt 713

<210> 28

<211> 886

<212> DNA

<213> Artificial sequence

<400> 28

gccaaacgaa ggatgacgat gaaatcgaag aggaagagga acgggaggca tcggtcaatg 60

agggcgaggc agacgaagac aacgaggcca ccctccaatt cgatcctagt tggtcaacgt 120

cccctcgggt cccttttccg tcgagggagg agaagacggg aaacttcccg tacgccgtca 180

tccgccagca ttgcggtctt ccgtcgtacg gtgtggatcg tgcgcatgtt ccgtatcacg 240

caaatattct ggtggccctt cgggagggtt tgcgcaatgg gactctcatg gtatgtgttt 300

tttatcttcc tctttttatt ctgctcaagc ctttatgcaa gattcacgac cctccgtgcc 360

ctcgatgtgc caccaaaccc cccgcgcaga agtggctggg ctggtgctgc attggcatca 420

ccaacgatcc tcgtaccgtg tgcttcaact gcaccatcca ttccggctat ctttgcttcc 480

cctccgatgg ggctgccgtc gtcgcttcct ctaccgtgga tgaccgcagt gtggcgatgc 540

gcaaagcatc gcgtcctcgt gccgccactc gttccgcgac gaaggggaag aagcgtcagc 600

gggacgaatc accgtcatcg tccaggtcac tggttgccac aggaagcggc cagacgtgga 660

agtccatgga tgggcgcgag tacggaatat tcattccaaa gtcgcgcctc tcctccaccc 720

agccttccga aatcccttcc cgcgcaccac gagatgatga tcaacttggg gaaatgttgg 780

cagtaatgaa ggagtcagtg tctgagatga agggtattcg cctggagatg aagggtgttc 840

gccaggatgt ggagggtctt cgcttggatg tgaagtggtt gcgtga 886

<210> 29

<211> 593

<212> DNA

<213> Artificial sequence

<400> 29

cgaaagtcca acatccgaca acacaaacag gtagagctct tcaaagcctt ctacaacctg 60

attagccgca catcccaacc gttgaagctc actagctgct cccatctgca accaatgcac 120

aattgacgcc tctgtagtca ccgatggctc aacaataatc cctgcctcca ccatatcaac 180

cacgagaaga taggaagtta atcgtccaaa agcagggaga cgagtcttca ccagcgcttt 240

gacaagtcca tcaaagtctg cacggtaaat acgaaccagc tccagaatct ccatacgtct 300

atcccaatat gtctgagcac attttgtagc tcgacctttg gtaactccat gagcggcatt 360

agaacagaag aacttctccc cttgtatctt gccgtcccaa ggtgtcgtta agaaggctga 420

ccagctgtcc aaatcggcaa agtaaagaga gtgtcccgaa gtgcgagcag cgggagtatt 480

gaataggata ccgcgccaga tcaaaagact gaagatcttg ctctgattga gtggatgagc 540

agaatcgaac ggtcctccaa tacgtgtgac tgcctgacgt gaaggtgcat gat 593

<210> 30

<211> 828

<212> DNA

<213> Artificial sequence

<400> 30

gccgcgtcac tcattctatt tgtgcgtatc ttccgcgtct gaaaggttcc ggcatttatt 60

cactcaacag gacgtcaatt ggtcgggtgt aatggcccac caaatatatg gtcgaatcca 120

tcgtcgtgga caaacacgcg agacctttat catacaactg gtttgcgcga ggacggttga 180

agtcttgcta gtggccaacg gtctgtctaa acacacactt ctttgcaact tccttgaggc 240

agagcgcaat gaaggtatgt cagtttatgt tgatgcacgt caatactaac aatagtgcag 300

agctgtggaa tctaatccaa aaccgggaca gttgtgacga taacctgccc gctgtcgacg 360

cactagccgg attcgacgac gacgcccgtg cgcaagcgaa ggcagccaaa gtcaaggtcc 420

gtgccactgc cggtccgtcg aaagccaaga agcggaaagt cacaagtgtc gagaccgttg 480

gggacgacga tgccgttact tcgaaggcgg tgcgccccaa gaagggaaag gctcccgtcg 540

gcgagatcgt ggttgacaac cccgccgctg ctccatctac tggaccttcc aaaggaaagg 600

gcaagggcaa agcctccata cccatagacg tcagtgacga ctcggaggag gaggaggaag 660

atgatgcact gcctcccgcc aagaagaaga agggggggaa agaggtggcg ctgcctacgg 720

cgggggtcgg agggtcgaag aaacggaaga ctctagctgg gagcaacgcc tcacagcctc 780

cttcgcctgt caaacctccg gcgaaaaaga gcaagactga cattccgg 828

<210> 31

<211> 907

<212> DNA

<213> Artificial sequence

<400> 31

ctgctacaag tgccatctcc caaatgggac ggacgacctc atccatggaa agtttggcga 60

aacggcttgt ccgtaccctg atcttctcgg gacaatcggc tacgggatcg tcacgtcccc 120

gtcgatgcgc caaaaccttg agcaacacgc caacgttgaa tggaccggtg ttggcgattt 180

cgcccaatgg gcagcgaagc ggtctgtccg tttcccatcc aacctgatcg agatattggt 240

atggtaccga aacacttact tctagagcca tcgtgcacat gtaacctgtc ctgtaccctt 300

ttaatctaac tgagcccacc gttggcattc atgcgattat gtggcccttg ttcgccgtgc 360

ggttggaagt agcagctcag catcacctga cttgtgcatc atgggtaggt ttcggtgatc 420

cagctacaag tactgcacgt ggcgcactcc catgcacgat cacgtggtaa ttatttgccc 480

cttttcttgg tctcctcgtt gcacttgttt ggcaagaggc gactaaaaag atatatatat 540

aaggtgtgtc ttcaagattg tgtccttcct tccttcccct caccccacaa accagatgcc 600

tcaagccagc aagtccttgc acgacggtga caattctaaa ccgtttgcta agaagaagaa 660

cgcagtaagt tcatatctgg tttggggcga cttttcattc accaatgggg tcaccttagc 720

atttacctac aagcgacaac aatcccggaa agtcaatgat tgtacaccag gtctgtcgtc 780

agcaaccgac agatcctgct tccgttggta ctgctagcgc caccactgtg aggcccatcg 840

ttccccgatt ggcgcccatt attgacccaa agcacggtct ttcagctgga caacactcat 900

cccccta 907

<210> 32

<211> 274

<212> DNA

<213> Artificial sequence

<400> 32

ccgcggtata acattcagcc tgcgcccatt gttcgaagcg caccacgtac gtatcaacga 60

ttcatattgc cgactttgat ccccgtcgac tcgtgacggg gacacaggat atctatcttc 120

cctcccacca tcatctacgg tcgtcgtttc gcgctgcgac aatccgatag cgagaggctc 180

gctcgccgcg gggcttgggg tttcagaaaa aggtgtgtat ttttcatgct actatacaac 240

tgcgtttgac gtttaaacac agttaatgcc acgt 274

<210> 33

<211> 721

<212> DNA

<213> Artificial sequence

<400> 33

acatttgaga agatgggcgg ctgggagtcc aagccatgtc gtaatgatgc gaagaacaga 60

ctctagtatt ttttggtcca aggtacgtga attgggtacg ttgttgggca tgctaacaag 120

cgcaccaacc gaaggttgaa gagagggtag atagtccgtg gaattgaaag ttatcgtttc 180

ttttgggtgc tgtcgcattt gttgcttgag atgtcgcact aatcgagaca gccaggggat 240

cttgcctgga tcatcaattg cacgaagagc tccaagcaac cacgacctga cgaggtggtg 300

atgattgagg acaatgtcct tcaagacaag tgtctcggca acaagcgaat cgatttgctg 360

tagtacacgg tccattgtcg attgcgctgc gatagtagtc gtgatacttg ttggctccca 420

tggtgcatct tcaagaaccc cccaagcagt catcaacttg atgatgtcgg gactgatttc 480

ctggaacgaa tgagaggtcg tggtggcgct aaacacagca gagacccgat cgatgctttc 540

caccgtaaaa ttacgaagaa acggaatatc tagagaaatg agtatcggag agatgatcta 600

tgatacttgc aacataccag tagtgaagtt ctcgtcatcc tcatcttcga tcgataaagg 660

catttcatca cgggactcag cgaactgcca cattgctgta ctttcggcat caactctctc 720

c 721

Claims (2)

1. A health food prepared from Flammulina velutipes (Fr.) SingFlammulina velutipes) The bacterial strain Nongwanjin No. 9 is characterized in that the classification and the name of the bacterial strain are as follows: flammulina velutipes (Flammulina velutipes.) (Flammulina velutipes) "nong Wanjin No. 9", which has been deposited in China general microbiological culture Collection center (CGMCC) at 28.6.2020, and is depositedThe serial number is CGMCC NO.20214;

the parent strain of Flammulina velutipes No. 9 is Flammulina velutipes F0321 and F0323.

2. The method for authenticating the authenticity of the strain of Flammulina velutipes (Vietnam. Et al., 9) as claimed in claim 1, wherein the DNA fingerprint of the strain of Flammulina velutipes (Fr.) Sing is established by SV detection technique: according to genome sequencing data, obtaining differential fragments by using a Kmer subtraction assembly technology, selecting 11 SV sequence design specific primers for amplification, and analyzing DNA fingerprint differences;

the specific primers are as follows:

Fl：F：GTGTGTGGCATAAGGATCGG，R：TTGCTOOTGGAGAGTTTTGT；

F2：F：AGCGGGACTCTCCTTATTGT，R：AGCAATGGTCAAAGAOTGGG；

F3：F：GGCAGTCAAGTGCTACAAAC，R：TGAGCTGATAGCGCTTCTTT；

F4：F：TTCCATCAATCCAAGCCTCG，R：CGCAAATGACAACGAAGGAC；

F5：F：TTCGAGCGAGCGATGAAATA，R：ACTGACGAACTCTGCGAAAT；

F6：F：GCCAAACGAAGGATGACGA，R：TCACGCAACCACTTCACATC；

F7：F：CGAAAOTCCAACATCCGACA，R：ATCATGCACCTTCACGTCAG；

F8：F：GCCGCGTCACTCATTCTATT，R：CCGGAATOTCAGTCTTGCTC；

F9：F：CTGCTACAAGTGCCATCTCC，R：TAGGGGGATGAGTGTTGTCC；

Fl0：F：CCGCGGTATAACATTCAGCC，R：ACGTGGCATTAACTGTGTTT；

Fl1：F：ACATTTGAGAAGATGGGCGG，R：GGAGAGAGTTGATGCCGAAA。

Images