WO2006024961A2 - Production of artificial hybrid lingzhi and uses thereof - Google Patents

Abstract

An artificial hybrid lingzhi was created by protoplast fusion between a cultivar Ganoderma tsugae and a field isolate of Ganoderma lucidum. This biotechnologically bred hybrid was named Peninsular Lingzhi strain Innovation No.1. The created hybrid was fertile producing lingzhi mushrooms and basidiospores in one and 1/2 months using sawdust-coconut fibre based substrate, showed growth even at 18 and 37°C, and was characterized by unique DNA fingerprints by random amplified polymorphic DNA markers using arbitrary primers: PP4L, PS3L, PS1L, POM and UK, and sequences of nuclear ribosomal DNA gene and mitochondrial ribosomal DNA gene different from those of the parental cultivar.

Description

PRODUCTION OF ARTIFICIAL HYBRID LINGZHI AND USES THEREOF

This application claims the benefit of U.S. Serial No. 60/606,274, Filed September 1, 2004 and of Chinese App'l No. 200410074082.0, Filed September 3, 2004, which are incorporated in their entirety by reference into this application.

The present application includes a Sequence Listing filed herewith on a floppy disc. The Sequence Listing is presented in a single file named sequence.txt, and having 19,456 bytes, the disclosure of which is incorporated herein by reference in its entirety.

Throughout this application, various publications are referenced and full citations for these publications may be found in the text where they are referenced. Disclosures of these publications in their entireties are hereby incorporated by reference into this application to more fully describe the state of the art to which this invention pertains.

BACKGROUND OF THE INVENTION

Lingzhi is a group of medicinal fungi. Lingzhi refers to a group of fungi including Ganoderma lucidum, G. tsugae and G. sinense (Adaskaveg & Gilbertson, 1986 & 1988; Zhao, 1989;

Anonymous 1998; Chiu et al. , 2000b) . These species are sexually incompatible and show differences in nucleotide sequences of nuclear ribosomal DNA and mitochondrial ribosomal DNA genes (Moncalvo et al. , 1995; Cheung, 2001; Hong et al.,

2002; Ma, 2002) . Ganoderma lucidum grows at a wider range of temperatures than G. tsugae (Adaskaveg & Gilbertson, 1986) .

These medicinal fungi are found to show different medicinal efficacies, and their bioactive components include polysaccharides and terpenes (Anonymous, 1998; Yen & Wu, 1999; Cheung et al., 2000; Chiu et al. , 2000c; Hu efc al., 2002; Jiang efc al. , 2004; Wang efc al. , 2004) . In nature these fungi occupy different biogeographies and/or defend their own territories (Zhao, 1989; Moncalvo & Ryvarden, 1997; Ryvarden, 2000; Cheung, 2001; Ma, 2002).

The present study expands the growth temperature of a lingzhi cultivar by artificially introducing the wild gemnplasm of another lingzhi species by protoplast fusion which brings two genomes in a common cytoplasm (Lau, 1985; Peberdy & Fox, 1993; Zhao, 1994; Cheung, 2001; Hanson & Howell, 2002; Yoo efc al. , 2002; Wang et al. , 2003; Yuan efc al. , 2004). The expansion in growth temperatures favors commercial production throughout the year and reduces the investment cost in areas with seasonal climate. This protoplast fusion biotechnology is advantageous for introducing one or more polygenic trait(s) and traits with unknown genetic mechanisms, and/or to cross the reproduction barrier of two biological species. Success of the technology is still within the framework of 'natural selection' based on the fitness of the ^λsurvivors'. Screening and selection among the survivors are artificially carried out to isolate the improved bred lingzhi. Although application of protoplast fusion in edible and medicinal mushrooms for artificial breeding has been carried out in laboratory studies, real application has not been reported. This may reflect the problem of using laboratory isolates, e.g. auxotrophic mutants, in experimental design to render commercial exploitation, and/or the decreased quality of the artificial hybrid, e.g. sterility, poor growth and/or fruiting, or the failure in generating hybrids (Lau, 1985; Chiu et al. , 1993; Peberdy & Fox, 1993; Zhao, 1994; Yoo efc al. , 2002) .

This invention improves the quality of a cultivar lingzhi by introducing the wild germplasm of another lingzhi species to expand the range of growing temperatures, and the resultant artificial hybrid reduced the fruiting time for lingzhi production by one-third and was fertile in bearing lingzhi mushrooms and mass production of lingzhi basidiospores .

SUMMARY OF THE INVENTION

An artificial hybrid lingzhi was created by protoplast fusion between a cultivar Ganoderma tsugae and a field isolate of Ganoderma lucidum. This biotechnologically bred hybrid was named Peninsular Lingzhi strain Innovation No. 1 (CGMCC No. 1208) . In comparison with the parental cultivar G. tsugae, the created hybrid showed an expansion in growth temperature, faster growth rates, and changes in nucleotide sequences of nuclear and mitochondrial marker genes. Also, the DNA fingerprints of this artificial hybrid were different from those of parents. The artificial hybrid was fertile producing lingzhi mushrooms taken one and a half-months, when was faster than the fruiting time of the parental cultivar by 1/3, and bearing sexual basidiospores.

DETAILED DESCRIPTION OF THE FIGURES

Figure 1. The target-driven method in strain improvement by artificial hybridization of two species.

Figure 2. The screening and selection principle for isolating a hybrid with better performance than the parent cultivar.

Figure 3. Growth temperatures and rates of the hybrid. Growth rates were measured by the increase in colony radius after incubation of the fungal cultures in complete medium at the specified temperature for 5 days in darkness. Data are presented in mean and standard deviation of 5 replicates. At the optimum temperature (30¹C), the hybrid grows at double the rate of that of the cultivar. This hybrid shows growth at 18°C and 37"C unlike its cultivar parent and dies at 40°C as with its cultivar parent. Hybrid, A. Cultivar parent, ■.

Figure 4. DNA fingerprints of the hybrid and parents by randomly amplified polymorphic DNA markers using arbitrary primers. Arbitrary Primers: PP4L, PS3L, PSlL, POM and UK. Lane M, GeneRuler™ lOObp DNA Ladder Plus, ready-to-use (MBI Fermentas) ; H, hybrid; C, cultivar; W, wild germplasm.

Figure 5. Nucleotide sequence of the nuclear ribosomal DNA gene of the hybrid (SEQ ID No. 1) .

Figure 6. Nucleotide sequence of the mitochondrial ribosomal DNA gene of the hybrid (SEQ ID No. 2) .

Figure 7. Phase contrast light micrograph showing the vegetative mycelium of the hybrid which bears clamp connection at septum between two neighbouring hyphal cells. The thick- walled chlamydospores are at terminal or in intercalary position (in-between two cells) . Figure 8. Mushrooms of the lingzhi hybrid, (a) A stalk-like primordium. (b) Bright-red mushrooms with concentric rings of coloration bear central to lateral stems, (c) A fully mature mushroom is covered by the discharged brown basidiospores losing the shiny cap appearance.

Figure 9. Basidiospores of the hybrid, (a) Scanning electron micrograph showing two basidia, each bearing four basidiospores. (b) Light micrograph showing double-walled, brown-colored and oval-shaped basidiospores. (c) Scanning electron micrograph showing 'pores' in some basidiospores with weakened outer wall.

DETAILED DESCRIPTION OF THE INVENTION

This invention provides a method for producing fertile mushroom hybrids of at least two species comprising (a) protoplast fusion between one species of Ganoderma with another species of Ganoderma to produce hybrid of the two species; and screening and selecting for fertile hybrid.

This invention provides a solution to produce stable fertile mushroom hybrid which is derived from more than one species . In mushroom breeding, multiple spores may be mixed to give a production spawn (seed culture for mushroom production) . This ^vmultispore' culture is practiced by mushroom farmers who do not have facility and technique of keeping cultures. They collect the mushrooms as sources of the "multispores' for inoculation. However, this limits to intraspecific hybridization. More important, such ^λmultispore' culture does not provide a consistent performance in production. So the use of monoculture is still the trend. Protoplast fusion will not be handicapped by mixing two or more batches of protoplast suspension. But the success of the screening and selection of good hybrids will be affected by the no. of species in the ^λparents'. Intraspecific hybridization (all of the same species) is not a problem. Yet for intraspecific hybridization, the conventional breeding method may be adopted too.

In an embodiment, this invention provides a target-driven method for producing fertile mushroom hybrids of two species comprising steps of: (a) preparing protoplast fusion between an isolate of Ganoderma tsugae and an isolate of Ganoderma lucidum, and (b) screen and select among the viable isolates for fertile hybrids.

As used herein, target-driven is used to describe the situation where the design and experimental procedure to be adopted are directed by the target set for the breeding program. Target refers to the desirable/ improved trait(s) of the artificial hybrid to be created. If more than one trait is concerned, the priority of these traits defines the degree of significance of the targets, and lay down the priority of the screening and selection criteria in the experimental work to be carried out. Therefore, the method is target-driven.

For instance, in this study, there are many traits involved, and the expected hybrid is a lingzhi strain with an expanded range of growth temperatures, fast growing and fertile with consistent performance for commercial exploitation. Hybrids expanding the high and low temperature tolerance will significantly reduce the investment and running cost (by energy saving) of mushroom production. This then became the most important target to be achieved. Temperature screening was simple to be performed and provided a vigorous platform for identifying a specific group of hybrids with expanding range of growth temperatures and fast growers measured in a semi-quantitative manner as largest colonies on screening medium. Fruiting quality and consistent performance were then set as the later criteria in selection.

Although application of protoplast fusion in edible and medicinal mushrooms for artificial breeding has been carried out in laboratory studies, real application has not been reported. This may reflect the problem of using laboratory isolates, e.g. auxotrophic mutants, in experimental design to render commercial exploitation, and/or the decreased quality of the artificial hybrid, e.g. sterility, poor growth and/or fruiting, or the failure in generating hybrids (Lau, 1985;

Chiu et al., 1993; Peberdy & Fox, 1993; Zhao, 1994; Yoo et al. ,

2002) . In particular, no one has attempted to do protoplast fusion of Ganoderma lucidum and G. tusgae, both of which are lingzhi. In an embodiment, the method is as set forth in Figure 1. In another embodiment, the method further comprises characterization of selected hybrid by gene sequences and DNA fingerprints at the molecular level. In a separate embodiment, the method comprises characterizing the selected hybrid morphologically by the vegetative and mushroom characteristics.

In an embodiment of this invention, the screening and selection is as set forth in Figure 2.

This invention also provides a hybrid selected by the above- described method. In an embodiment, this hybrid is fast growing. In another embodiment, the hybrid can grow in an expanded range of temperatures. In a further embodiment, the temperature is from 5 degree Celsius to 37 degree Celsius.

A selected hybrid, named Peninsular Lingzhi strain Innovation No. 1, was deposited on August 24, 2004 at China General Microbiological Culture Collection Center (CGMCC) , Beijing, 100080, China, under the provisions of the Budapest Treaty for the International Recognition of the Deposit of Microorganism for the Purposes of Patent Procedure. Peninsular Lingzhi strain Innovation No. 1 was accorded CGMCC Accession Number 1208.

This invention also provides lingzhi mushrooms, or lingzhi basidiospores produced by the selected hybrids.

This invention further provides extract, concentrates, broken spore preparation, mushroom slices, mycelium powder, polysaccharide preparation, spore oils, terpene preparation, tea, brewery products of the lingzhi mushrooms or spores of the selected hybrids. Finally, this invention provides different uses of the hybrids, the lingzhi mushrooms or lingzhi basidiospores produced by the hybrids. Said uses include dietary or medicinal applications.

This invention will be better understood from the examples which follow. However, one skilled in the art will readily appreciate that the specific methods and results discussed are merely illustrative of the invention as described more fully in the claims which follow thereafter.

EXPERIMENTAL DETAILS

Artificial hybridisation of Ganoderma tsugae and G. lucidium by protoplast fusion (a) Both parents in the form of vegetative mycelia were cultivated to a log phase by incubating in a complete medium (CM) broth consisting of (g/L) : MgSO₄-7H₂O, 0.5; KH₂PO₄, 0.46; K₂HPO₄, 1; peptone, 2; D-glucose, 20; at 28°C in darkness at 120 rpm. Using aseptic techniques, the actively growing mycelia were harvested by filtration through a nickel sieve of 1 mm in diam and rinsed with an osmotic buffer (0.6 M sucrose solution) (Zhao, 1994; Cheung, 2001) . Then the mycelium was incubated in an osmotic buffer containing 10 mg Lywallzyme/mL (Gangdong Institute of Microbiology, P.R. China) at 10 rpm for 1-3 h to enzymatically remove the fungal cell wall (Cheung, 2001) . Yield of protoplasts was quantified using a hemacytometer under phase contrast light microscopy. When sufficient protoplasts were released, protoplasts were harvested by filtrating through a column of glasswool packed in a syringe to hold the undigested mycelia and concentrated by centrifugation at 2,000 x g for 10 min (Zhao, 1994; Cheung, 2001) . Protoplasts in the supernatant were harvested and separated from the cell debris. By centrifugation at 6000 x g for 15 min, the pellet of concentrated protoplasts were harvested. The two batches of protoplasts were resuspended in osmotic buffer and mixed together in the presence of 30% (w/v) polyethylene glycol (MW 4,000) in 0.01M CaCl₂ for 1 h at 28°C in darkness (Zhao, 1994; Yuan et al. , 2004). Then the protoplast mixture was plated onto regeneration medium consisting of (g/L) : D-glucose, 4; yeast extract, 4; malt extract, 10; and agar, 15 in osmotic buffer for regeneration of cell wall (Lau, 1985; Zhao, 1994; Cheung, 2001) . After incubation at 28°C in darkness for 5 days, 100 visible colonies were picked and transferred to CM as purified isolates .

Screening and selection for the desirable hybrids were done by incubating the purified isolates at extreme growth temperatures (18 and 35"C) on CM for 5 days. The two parents were examined in parallel. Five replicates were done for each isolate. Survivors at both extreme temperatures with their growth rates faster than that of the parental cultivar were selected as exemplified in Figure 3. Five isolates were obtained, and they were tested for their fruiting abilities and fruiting yield in the mushroom cultivation complex, The Chinese University of Hong Kong (CUHK) for experimental production (30 bags per isolate) and the workshop, Peninsular Innovations Limited for pilot-scale production (180 bags per isolate) . The fruiting tests were repeated for three times in CUHK and another three times in the workshop.

Fruiting trial was carried out using autoclavable plastic bags each of which contained 500 g of a fruiting substrate, consisting of (%, w/w) : sawdust, 60; milled coconut fibre, 20; wheat bran, 14; sucrose, 5; (agricultural grade) and lime, 1

(Chiu et al., 1998, 2000a). In the mushroom cultivation complex located at the Chinese University of Hong Kong, mycelial running was carried out at 28°C in darkness. In the workshop located at Peninsular Innovations Limited, there was no control in the room temperature which fluctuated between 10 to 33 "C. When the compost was completely colonized (it usually took 25 - 45 days depending on the isolate performance) , the colonized compost was transferred to a fruiting environmental chamber in the mushroom cultivation complex. Lingzhi mushrooms were induced by a photoperiod of 12 hr light 12 hr dark, 28°C and relative humidity of 85% or above. The fruiting test in the workshop was under natural photoperiod at temperature fluctuating from 15 to 33°C and relative humidity of 80% or above. One fertile isolate with the highest fruiting yield and consistent fruiting performance was selected.

(b) Characterisation of the biotechnologically bred hybrid

DNA Fingerprints by random amplified polymorphic DNA markers Genomic DNA was extracted from harvested mycelium from broth cultures as incubated above, frozen in liquid nitrogen and purified (Kwan et al. , 1992; Chiu et al. , 1993 & 1996; Cheung, 2001; Ma, 2002) . The concentration and purity of a DNA sample were measured by the spectrophotometry absorbance and the ratio of OD₂6o:OD₂8o- A sample having a ratio greater than 1.8 was considered suitable for use, and its concentration and purity were further checked by agarose gel electrophoresis using ethidium bromide staining.

The sequences of different pairs of arbitrary primers are as follows:

UK: 5'-CAATTTCAATGTTCCGGACC-S' (SEQ ID No. 3) 3 '-CAGTTGGTGGAAGGAAAGGA-S' (SEQ ID NO. 4) PS3L: 5'-GAGCAGGGCAAGCGTTATAG-S' (SEQ ID No. 5) 3'-CTATTCGAAACGCGGACAAT -5' (SEQ ID No. 6)

PSlL: 5'-GAATGCGGTGCTTCCTACTG -3' (SEQ ID No. 7)

3 '-CCGACAGCTAAAGCGGGTAT-S' (SEQ ID NO. 8) POM: 5'-AGCCGTATCTTTGCCTCAGA-S' (SEQ ID No. 9)

3 '-ATCGTCTCGAGCGAACAAGT-S' (SEQ ID NO. 10) PP4L: 5'- GTCGAAATTCATGGCAAGGT-3 ' (SEQ ID No. 11) 3'- CAGTATTGCGACGGTCTCAG -5' (SEQ ID No. 12)

The reaction mixture contained: 1 x PCR buffer II (Perkin

Elmer Cetus), 3.5 mM MgCl₂, 200 M each of dNTPs (Perkin Elmer Cetus), 1 M of the primer and 2.5 U Tag DNA polymerase

(Boehringer Mannheim) and 25 ng of genomic DNA (Welsh &

McClelland, 1990; Williams et al. , 1990; Chiu et al., 1993,

1996) . The thermal program was: 36 medium stringency cycles of

94°C for 2 min, 45°C for 1 min and 72°C for 2 min with the last extension time lengthened to 10 min.

Experiments were repeated to verify consistency, and controls without DNA were amplified in parallel to check for contamination or carry-over. DNA fingerprints were resolved by agarose gel electrophoresis, and images were captured using a gel documentation system (BIO-RAD Gel Doc 1000) .

Figure 4 shows the different DNA fingerprinting profiles of the hybrid in contrast to those of the parents used in protoplast fusion.

Specific polymerase chain reaction (PCR) and DNA Sequencing The fungal-specific primers ITS 4 and 5 were used to amplify the region (ITSl, 5.8S and ITS2) of the nuclear ribosomal DNA and another pair of primers were used to amplify the mitochondrial ribosomal DNA by a thermal cycler PTC-100™ (MJ Research, Inc.) (White et al., 1990; Cheung, 2001; Ma, 2002) . The nuclear primer sequences were as follows: 5'- TCCTCCGCTTATTGATATGC-3' (SEQ ID No. 13) and 5'- GGAAGTAAAAGTCGTAACAAGG-S' (SEQ ID NO. 14) respectively. The mitochondrial primer sequences were as follows: 5'CAGCAGTCAAGAATATTAGTCAATG-S' (SEQ ID NO. 15) and 5'- GCGGATTATCGAATTAAATAAC-3' (SEQ ID No. 16) . A total volume of 10 μL of reaction mixture consisted: IX Reaction Buffer VI, 2.5 mM MgCl₂, 10 mM dNTPs, 10 pM of each primers, 2U Thermoprime Plus Taq DNA polymerase (AB Gene) and about 100 ng genomic DNA. Specific PCR programme comprised of: 95°C for 1 min; 60⁰C for 1 min and 70°C for 1 min for 39 cycles with the last extension time lengthened to 10 min (Kwan efc al., 1992; Chiu efc al. , 1996; Cheung, 2001; Ma, 2002) .

PCR-amplified fragments were further purified by using GENECLEAN^® II KIT. Three volumes of sodium iodide stock solution were added to PCR mixture before adding 1 μL GLASSMILK^® suspension. After 5 min of thorough mixing, the solution was centrifuged for 15 s to pellet the GLASSMILK^®/DNA complex. Then this pellet was washed with 20 μL New Wash for three times and vacuum dried. Eight μL ultra pure water were used to resuspend the dried pellet, and the mixture was allowed to stand for 5 min before centrifugation. The eluted purified DNA supernatant was collected for cycling sequencing to label the amplified DNA with different fluorescent dyes using DNA sequencing kit (PE Applied Biosystems) . A mixture consisting of purified DNA template, 2 μL; forward primer of the target gene, 2 μL; dRhodamine Terminator, 4 μL (PE Applied Biosystems) and ultrapure water to a final volume of 10 μL. The following thermal profile was used: 36 cycles of DNA denaturation at 95°C for 30 s, annealing at 50°C for 30 s and extension at 70°C for 1 min.

The products were then purified by ethanol precipitation with 70% ethanol in 0.5 mM MgCl₂ at -20⁰C for 2-3 h. After centrifugation at 14,000 x g for 15 min, the pellet was washed by pre-chilled 70% ethanol. The washed pellet was then dried under vacuum. Twelve μL Template Suppresser Reagent (PE Biosystems) were added to resuspend the dried pellet. The solution was denatured at 95°C for 2 min and then quickly chilled on ice. A brief centrifugation was performed to collect the evaporated sample. Samples were then sequenced by ABI Prism 310 Genetic Analyser (PE Biosystems) and processed by using software Sequencing Analysis version 3.0 (PE Biosystems) .

Figures 5 and 6 show the nucleotide sequences of the hybrid. The verified artificial hybrid was deposited in Department of Biology, The Chinese University of Hong Kong. This lingzhi isolate was a dikaryon (diploid-equivalent condition in lingzhi) , not a haploid generated by protoplasting process, and bears clamp connection (Fig. 7) . In comparison to the cultivar parent, the fruiting time only took one and one-half months, and has a faster or reduced production time. Normal mushroom morphology and production of sexual basidiospores were obtained with the hybrid (Figs 8 and 9) .

REFERENCES

1. Anonymous 1998. Chinese Medicinal Mycology. Peking: Peking Medicinal University and China Kigua Medicinal University Joint Press. In Chinese.

2. Adaskaveg, J.E. & Gilbertson, R.L. 1986. Cultural studies and genetics of sexuality of Ganoderma lucidum and G. tsuage in relation to taxonomy of the G. lucidum complex. Mycologia 78, 694-705.

3. Adaskaveg, J.E. & Gilbertson, R.L. 1988. Basidiospores, pilocystidia and other basidiocarp characters in several species of the Ganoderma lucidum complex. Mycologia 80, 493- 507.

4. Cheung, K. W. 2001. An Integrated Approach to Study Pathogenic Ganoderma lucidum. M.Phil. Thesis. The Chinese University of Hong Kong, Hong Kong.

5.Cheung, W.M.W. , Hui, W.S., Chu, P.W.K., Chiu, S.W. & Ip, N.Y. 2000 Ganoderma extract activates MAP kinases and induces the neuronal differentiation of rat pheochromocytoma PC12 cells. FEBS Letters 24409, 1-6.

6. Chiu, S.W., Chan, Y.H., Law, S.C, Cheung, K.T. & Moore, D. 1998. Cadmium and manganese in contrast to beneficial calcium reduce yield and nutritional values of the edible mushroom Pleurotus pulmonarius. Mycological Research 102, 449-457.

7.Chiu, S.W., Cheung, K.W., Law, W.M. , Au Yeung, H.W., Ma, S.Y. & Chu, W.L. 2000a. Developmental plasticity of Hong Kong lingzhi as a response to the environment. In Science and Cultivation of Edible Fungi. vol.2. ed. Van Griensven L.J.L.D., pp.757-761, Brookfield: A. A. Balkema: Rotterdam.

8. Chiu, S.W., Kwan, H.S. & Cheng, S.C. 1993. Application of arbitrarily-primed polymerase chain reaction in molecular studies of mushroom species with emphasis on Lentinula edodes. In Genetics and Breeding of Edible Mushrooms, eds. Chang, S.T., Buswell, J.A. & Miles, P.G., pp. 265-283. Gordon & Breach Sci Pub.

9.Chiu, S.W., Law, S.C, Ching, M.L., Cheung, K.W. & Chen, M.J. 2000b. Themes for mushroom exploitation in the 21^st century: Sustainability, waste management and conservation. Journal of General and Applied Microbiology 46, 269-282.

10. Chiu, S.W., Ma, A.M., Lin, F.C. & Moore, D. 1996. Genetic homogeneity of cultivated strains of shiitake (Lentinula edodes) used in China as revealed by the polymerase chain reaction. Mycological Research 100, 1393-1399.

11. Chiu, S.W., Wang, Z.M. & Moore, D. 2000c. Nutritional value of Ganoderma extract and assessment of its genotoxicity and antigenotoxicity using comet assays of mouse lymphocytes. Food and Chemistry Toxicology 38, 173-178.

12. Hanson, L.E. & Howell, CR. 2002. Biocontrol efficacy and other characteristics of protoplast fusants between Trichoderma koningii and T. virens. Mycological Research 106, 321-328.

13. Hong, S.-G.; Jeong, W. & Jung, H.-S. 2002. Amplification of mitochondrial small subunit ribosomal DNA of polypores and its potential for phylogenetic analysis. Mycologia 94, 823-833. 14. Hu, H., Ahn, N.S., Yang, X., Lee, Y.S. & Rang, K.S. 2002. Ganoderma lucidum extract induces cell cycle arrest and apoptosis in MCF-7 human breast cancer cell. International Journal of Cancer 102, 250-253.

15. Jiang, J., Slivova, V., Valachovicova, T., Harvey, K. & Sliva, D. 2004. Ganoderma lucidum inhibits proliferation and induces apoptosis human prostate cancer cells PC-3. International Journal of Oncology 24, 1093-1099.

16. Kwan, H.S., Chiu, S.W., Pang, K.M. & Cheng, S.C. 1992. Strain typing in Lentinula edodes by polymerase chain reaction. Experimental Mycology 16,163-166.

17. Lau, W.C. 1985 Study on the Interspecific Hybridization of Pleurotus by Protoplast Fusion. PhD Thesis, The Chinese University of Hong Kong, Hong Kong.

18. Ma, S.Y. 2002. A Study on Populations and Contaminations of Field Ganoderma lucidum. M. Phil. Thesis. Hong Kong: The

Chinese University of Hong Kong.

19. Moncalvo, J.M. & Ryvarden. L. 1997. A Nomenclatural Study of the Ganodermataceae Donk. Oslo: Fungiflora.

20. Moncalvo, J.M., Wang, H.F. & Hseu, R.S. 1995. Gene phylogeny of the Ganoderma lucidum complex. Comparison with traditional taxonomic characters. Mycological Research 99, 1489-1499.

21. Peberdy, J.F. & Fox, H.M. 1993. Protoplast technology and edible mushrooms. In Genetics and Breeding of Edible Mushrooms, eds. Chang, S.T., Buswell, J.A. & Miles, P.G., pp. 125-155. Gordon & Breach Sci Pub. 22. Ryvarden, L. 2000. Studies in neotropical polypores 2: a preliminary key to neotropical species of Ganoderma with a laccate pileus. Mycologiα 92, 180-191.

23. Wang, H.X., Ng, T.B. & Chiu, S.W. 2004. A distinctive ribonuclease from fresh fruiting bodies of the medicinal mushroom Ganoderma lucidum. Biochemical and Biophysical Research Communications 314, 519-522.

24. Wang, Y.P., Sonntag, K & Rudloff, E. 2003. Development of rapeseed with high erucic acid content by asymmetric somatic hybridization between Brassica napus and Crambe- abyssinica. Theoretical and Applied Genetics 106, 1147-1155.

25. Welsh, J. & McClelland, M. 1990. Fingerprinting genomes using PCR with arbitrary primers. Nucleic Acids Research 18, 7213-7218.

26. White, T.J., Bruns, T., Lee, S. & Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In PCR Protocols: A Guide to Methods and Applications, eds Innis, M.A. , Gelfand, D.H., Sninsky, J.J. & White, T.J., pp. 315-322. Academic Press: San Diego.

27. Williams, J.G.K., Kubelik, A.R., Livak, K.J., Rafalski, J.A. Sc Tingey, S.V. 1990. DNA polymorphisms amplified by arbitrary primers are useful as genetic markers. Nucleic Acids Research 18, 6531-6536.

28. Yen G.C. & Wu J.Y. 1999. Antioxidant and radical scavenging properties of extracts from Ganoderma tsugae. Food Chemistry 65, 375-379. 29. Yoo, Y.B., Lee, K.H. & Kim, B.G. 2002. Characterization of somatic hybrids with compatible and incompatible species by protoplast fusion in genera Pleurotus (Fr.) P. Karst. and Ganoderma P. Karst. by RAPD-PCR analysis. International Journal of Medicinal Mushrooms 4, 147-157.

30. Yuan, Y., Guo, X., He, X., Zhang, B. & Lui, S. 2004. Construction of a high-biomass, iron-enriched yeast strain and study on distribution of iron in the cells of Saccharomyces cerevisiae. Biotechnology Letters 26, 311-315.

31. Zhao, J. 1994 Isolation, Identification and Application of Protoplast Fusion Products in Edible Mushrooms. PhD Thesis, The Chinese University of Hong Kong, Hong Kong.

32. Zhao J.D. 1989. The Ganodermataceae in China. Bibliotheca Mycologia 132, 1-176. Berlin: J. Cramer.

Claims

What is claimed is:

1. A method for producing fertile mushroom hybrids of at least two species comprising steps of: a) preparing protoplast fusion between an isolate of

Ganoderma tsugae and an isolate of Ganoderma lucidum to produce viable isolates, and b) screening and selecting among the viable isolates for fertile hybrids.

2. The method of claim 1, which is target-driven, wherein the design and experimental procedure to be adopted are directed by the target set for the breeding program.

3. The method of claim 1, as set forth in Figure 1.

4. The method of claim 1, further comprising characterization of selected hybrid by gene sequences and DNA fingerprints at the molecular level.

5. The method of claim 1, further comprising characterizing the selected hybrid morphologically by the vegetative and mushroom characteristics.

6. The method of claim 1, wherein the screening and selection is as set forth in Figure 2.

7. The hybrid selected by method of claim 1.

8. A fast growing hybrid of claim 7.

9. An expansion of growing temperature hybrid of claim 7.

10. The hybrid of claim 7, named Peninsular Lingzhi strain Innovation No. 1, deposited at CGMCC and accorded with CGMCC No. 1208.

11. The lingzhi mushrooms, or lingzhi basidiospores produced by the hybrid of any of claim 7-10.

12. The extract, concentrates, broken spore preparation, mushroom slices, mycelium powder, polysaccharide preparation, spore oils, terpene preparation, tea, brewery products of the lingzhi mushrooms or spores of any of claim 11.