CN112251533A - SNP molecular marker closely linked with main effect QTL site of eggplant fruit length and application - Google Patents
SNP molecular marker closely linked with main effect QTL site of eggplant fruit length and application Download PDFInfo
- Publication number
- CN112251533A CN112251533A CN202011238129.8A CN202011238129A CN112251533A CN 112251533 A CN112251533 A CN 112251533A CN 202011238129 A CN202011238129 A CN 202011238129A CN 112251533 A CN112251533 A CN 112251533A
- Authority
- CN
- China
- Prior art keywords
- eggplant
- kasp
- length
- molecular marker
- base
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Abstract
The invention relates to the technical field of molecular genetic breeding, and particularly discloses an SNP molecular marker closely linked with an eggplant fruit length major QTL locus, a detection method and application, wherein the SNP molecular marker is located at 78393511 th base of eggplant chromosome 3, and the 78393511 th base is T or A; the SNP locus is converted into a KASP marker, and the KASP primer is as follows: forward primer, F-1: GAAGGTGACCAAGTTCATGCTCGACAATGTTCACGGAACAAGT, as shown in SEQ ID NO. 3; forward primer, F-2: GAAGGTCGGAGTCAACGGATTCGACAATGTTCACGGAACAAGA, as shown in SEQ ID NO. 4; reverse primer, R: AGATATACTAGGATTTGGTTTC, as shown in SEQ ID NO: 5. The invention has the characteristics of reducing the breeding workload, shortening the breeding time and improving the breeding efficiency.
Description
Technical Field
The invention relates to the technical field of molecular genetic breeding, in particular to an SNP molecular marker closely linked with a main effect QTL locus of the length of an eggplant fruit, a detection method and application.
Background
Eggplant (solanommelognal, 2n ═ 24) is an important vegetable crop of Solanaceae (Solanaceae) Solanum, and has important agricultural and economic values and health care functions; china is the first producing country of eggplants, and the annual yield of the eggplants accounts for about 60 percent of the world yield all the year round; the eggplant variety types in China have obvious regional differences due to different ecological environments and consumption habits, particularly the differences in fruit lengths are obvious, and the eggplant fruit lengths are controlled by complex Quantitative Trait Loci (QTL). The breeding of the length characters of the eggplant fruits by using the traditional breeding method is time-consuming and labor-consuming, the fruit length of a commodity eggplant can be known only after the eggplant flowers and fruits, the breeding period is long, and a large amount of workload needs to be invested in the period.
The development of the molecular marker closely linked with the eggplant fruit length character has important guiding significance for the assistant selection breeding of the eggplant molecular marker, is a necessary premise for realizing the high-efficiency molecular breeding of the target fruit length, and has important breeding practice value. Developing a molecular marker closely linked with the length character of the eggplant, utilizing a special primer sequence designed by the marker, amplifying target fragments by technologies such as PCR amplification and the like, detecting the genotype of an SNP locus by utilizing a KASP typing technology, and determining whether the target genotypes are the same or not, thereby predicting the length of the eggplant in advance, accurately predicting the length of the eggplant at a seedling stage, further pollinating in advance, preparing a corresponding hybridization combination or selecting a target single plant for selfing and reserving seeds, saving the breeding time and the field breeding workload, and further improving the breeding efficiency.
Disclosure of Invention
The invention provides an SNP molecular marker closely linked with a main effect QTL locus of the length of an eggplant fruit, a detection method and application thereof, aiming at solving the technical problems in the existing eggplant fruit length selective breeding process, and the SNP molecular marker has the characteristics of reducing the breeding workload, shortening the breeding time and improving the breeding efficiency.
The first technical scheme of the invention is as follows: an SNP molecular marker closely linked with an eggplant fruit length major QTL locus, wherein the SNP molecular marker is located at 78393511 th base of eggplant chromosome 3, and the 78393511 th base is T or A;
the 100 base sequences of the 78393511 th base upstream of the eggplant No. 3 chromosome are shown as SEQ ID NO. 1;
the 100 base sequence of the downstream of 78393511 base of eggplant No. 3 chromosome is shown as SEQ ID NO. 2.
Wherein, the base sequence information of the 78393511 th base upstream and downstream of the chromosome 3 of the eggplant is selected from the genome of the Zhejiang eggplant: http:// eggplant-hq.cn/;
the SNP marker is the transition between T and A,
the 100 base sequences at the upstream of 78393511 th base of eggplant chromosome 3 are as follows:
AGATAGATACATGGAAACCACGTTTAAACCCCAAACCAAGTGAGAAAAAGTCTCGCAATTCACATTATTCATCTTGGAACGACAATGTTCACGGAACAAG
the 100 base sequences downstream of 78393511 th base of eggplant chromosome 3 are as follows:
ACTGTCAACTCTATATCTAAACATTTGGCAAACCATATGAAACCAAATCCTAGTATATCTTCAGGGGAAGTGTCATCTTTAAGGTCACTGACATTTTGTC
the SNP molecular marker is located at 78393511 th base of eggplant No. 3 chromosome, the 78393511 th base is T or A, the SNP molecular marker can be used for early molecular marker assisted selection of eggplant fruit length character breeding, and the SNP molecular marker is ingenious in design, simple, convenient and quick to detect, low in cost, free of environmental influence and suitable for large-scale popularization and application; in the conventional breeding method, the length of the commercial eggplant fruits needs to be obtained and can be determined only after the commercial eggplant fruits are mature, a large amount of time and energy are wasted, and the molecular markers linked with the length characters of the eggplant fruits can be detected and eliminated in the seedling stage, so that the production cost is saved, and the selection efficiency is greatly improved; according to the invention, the position of a main effect QTL site related to the length character of the eggplant fruits is determined by QTL-seq technology and genetic map positioning, and a molecular marker tightly linked with the site is found, so that the method can be used for screening the molecular marker of the length character of the eggplant fruits, which lays an important foundation and a necessary premise for realizing the genetic improvement of the polygene control character based on molecular assisted breeding, so that the workload for selecting the eggplant variety with the target breeding length is greatly reduced, the selection time is greatly shortened, the breeding efficiency is also greatly improved, and the method is suitable for large-scale popularization and application; the SNP marker tightly linked with the main effect QTL site of the length of the eggplant fruits has higher linkage and reliability through test detection, which has important significance for improving the accuracy and efficiency of the auxiliary selection of the molecular marker.
The second technical scheme of the invention is as follows: the SNP molecular marker detection method closely linked with the main effect QTL locus of the length of the eggplant fruits comprises the following steps,
(1) extracting 100 base sequences at the upstream and 100 base sequences at the downstream of the SNP molecular marker;
(2) converting the SNP molecular marker in the whole base sequence in the step (1) into a KASP marker through primer design software;
(3) and (3) carrying out SNP genotyping detection based on KASP by using the whole base sequence in the step (2) through a genotyping detection platform.
According to the invention, the length of the eggplant fruits can be predicted by detecting the molecular marker related to the length characters of the eggplant fruits, so that excellent individual plants of the longer-fruit eggplant can be accurately and rapidly screened, and the detection method of the molecular marker loci is convenient and rapid and is not influenced by the environment; the method can detect the length of the eggplant fruits, can predict the length of the eggplant fruits, can effectively select the eggplant seeds or seedlings with required length, can also be used for molecular marker assisted breeding of the length of the eggplant fruits, accelerates the process of breeding aiming at the length of the eggplant fruits, and is suitable for large-scale popularization and application; according to the invention, DNA is extracted from seeds or seedling stage leaves of unknown eggplant materials, and a KASP molecular marker typing test is carried out by combining with a KASP primer, so that the fruit length of the eggplant can be predicted by the marked typing result, and the measurement and judgment are not carried out when the eggplant fruits reach commodity fruits like in conventional breeding, thus the breeding efficiency can be obviously improved, and the breeding cost is saved. The primer design software can be selected from Oligo primer design software.
Preferably, the KASP primer used in step (3) is,
forward primer, F-1: GAAGGTGACCAAGTTCATGCTCGACAATGTTCACGGAACAAGT, as shown in SEQ ID NO. 3;
forward primer, F-2: GAAGGTCGGAGTCAACGGATTCGACAATGTTCACGGAACAAGA, as shown in SEQ ID NO. 4;
reverse primer, R: AGATATACTAGGATTTGGTTTC, as shown in SEQ ID NO: 5.
According to the method, KASP primers for detecting the length of the eggplant fruits are developed according to the located main effect QTL sites of the length characters of the eggplant fruits, are used for detecting the difference of the lengths of the eggplant fruits expressed by polymorphism of SNP sites and predicting the difference of the lengths of the eggplant fruits, and provide a reliable molecular marker source for the pre-selection of the lengths of the eggplant fruits.
Preferably, the reaction system of the KASP comprises a KASP primer mixture, a KASP master mixture and a DNA template; the KASP primer mixture comprises a forward primer F-1, a forward primer F-2 and a reverse primer R; the KASP master mix comprises a forward primer F-1 tail FAM-labeled oligonucleotide sequence, a forward primer F-2 tail HEX-labeled oligonucleotide sequence, FAM dye, HEX dye and a quencher; the DNA template is eggplant genome DNA. And each substance in the reaction system provides a good reaction environment for the difference detection of the length of the eggplant fruits expressed by the polymorphism of the SNP sites, and ensures the smooth completion of the whole detection process.
The third technical scheme of the invention is as follows: the application of the SNP molecular marker closely linked with the main effect QTL site of the length of the eggplant fruits in early identification and screening of the length traits of the eggplant fruits.
In the located QTL site of the length main effect of the eggplant fruits, the molecular markers tightly linked with the characters are developed, the reliability of the markers is verified, the length of the eggplant fruits can be predicted by detecting the molecular markers, and a molecular marker auxiliary selection technology is provided for realizing the early identification and screening of the length characters of the eggplant fruits.
The invention has the following beneficial effects:
(1) the SNP molecular marker is located at 78393511 th base of eggplant chromosome 3, the 78393511 th base is T or A, the SNP molecular marker can be used for early molecular marker assisted selection of eggplant fruit length trait breeding, and the SNP molecular marker is ingenious in design, simple, convenient and quick to detect, low in cost, free of environmental influence and suitable for large-scale popularization and application; in the conventional breeding method, the length of the commercial eggplant fruits needs to be obtained and can be determined after the commercial eggplant fruits are mature, a large amount of time and energy are wasted, and the molecular markers linked with the main effective loci of the lengths of the eggplant fruits can be eliminated in the seedling stage by detecting the molecular markers, so that the production cost is saved, and the selection efficiency is greatly improved;
(2) the method has the advantages that the position of the major QTL locus of the length of the eggplant fruits is determined by QTL-seq technology and genetic map positioning, and the molecular marker tightly linked with the locus is found, so that the method can be used for screening the molecular marker of the length character of the eggplant fruits, lays an important foundation and necessary premise for realizing the genetic improvement of the polygene control character based on molecular assisted breeding, greatly reduces the workload for selecting the eggplant variety with the target breeding length, greatly shortens the selection time, greatly improves the breeding efficiency, and is suitable for large-scale popularization and application;
(3) the molecular marker which is closely linked with the eggplant fruit length character is positioned in the eggplant fruit length major QTL site, and the linkage and the reliability are both high, which has important significance for improving the accuracy and the efficiency of the molecular marker auxiliary selection.
Drawings
FIG. 1 is a map of QTL-seq for eggplant fruit length in accordance with the invention; in FIG. 1, the abscissa represents the chromosome and the ordinate represents the difference between SNP-index of two offspring;
FIG. 2 is a diagram of the KASP typing visualization results of the present invention; in FIG. 2, the abscissa represents the FAM allele type and the ordinate represents the HEX allele type.
The labels in the figures are: 100-TT base type, 200-water as a negative control display, 300-AT hybrid base type, 400-AA base type.
Detailed Description
The invention is further illustrated by the following figures and examples, which are not to be construed as limiting the invention.
Example 1:
obtaining SNP molecular markers closely linked with the main effect QTL locus of the length of the eggplant fruits:
A. f is obtained by hybridizing red eggplant ' 1838 ' in Zhejiang and green egg round eggplant ' 18151，F1Selfing to obtain 131F strains2Separating the population as the research object;
B. for F2Measuring the fruit length of 3 normal commercial fruits by each single plant, taking an average value as the fruit length value of the single plant, then selecting the first 18 extremely long plants and the 18 extremely short plants according to the fruit length value, and extracting the extreme single plants and parent DNA by using an improved CTAB method;
C. performing concentration determination on the DNA of the single strain at the extreme end, performing DNA equivalent mixed pool according to the determined concentration value, constructing an L pool and an S pool, performing high-depth re-sequencing on the DNA in the two pools, wherein the sequencing depths are 27.72X and 26.57X respectively, and the parental re-sequencing is 16.40X and 15.63X respectively;
D. screening SNP markers of homozygous difference between two parents by using an extreme character mixed pool sequencing QTL-seq method based on the genotyping result shown in figure 1, co-selecting 1019131 polymorphic markers, selecting the parents as reference parents, and analyzing and calculating SNP-index of 1019131 marker sites between the parents of two filial generations; as can be seen from FIG. 1, on chromosome E03, there is a distinct peak region, and a major QTL locus region (71.29-79.00Mb) can be defined with 99% confidence interval;
E. calculate Δ (SNP-index), i.e., the difference between two progeny SNP-index: Δ (SNP-index) SNPindex (extreme trait L) -SNPindex (extreme trait S). Performing 1000 times of replacement tests, selecting 99% confidence level as a screening threshold, and detecting a main effect QTL locus fl3.1 related to the fruit length on No. 3 chromosome of the eggplant;
F. the fl3.1 is located at 71.29-79.00Mb, 2670 candidate polymorphic marker sites are located in the interval, the annotation result of ANNOVAR is extracted, and the gene causing the stop loss or stop gain or non-synonymous mutation or alternative splicing site is preferentially selected as a candidate gene;
G. meanwhile, homologous genes related to the fruit size are searched by comparing in a site fl3.1 in a homologous comparison mode, and genes Smechr0301760 and Smechr0301963 are CNR and SUN homologous genes for controlling the fruit size respectively;
H. combining the candidate gene information, the parental re-sequencing data and the reference genome information, selecting 21 polymorphic SNP sites in the interval, respectively extracting base sequences of 100bp at upstream and downstream, and designing a KASP marker primer according to a primer design principle;
I. the KASP primer developed based on the SNP site information on 78393511 th base of chromosome 3 has the sequence information:
forward primer, F-1: GAAGGTGACCAAGTTCATGCTCGACAATGTTCACGGAACAAGT
Forward primer, F-2: GAAGGTCGGAGTCAACGGATTCGACAATGTTCACGGAACAAGA
Reverse primer, R: AGATATACTAGGATTTGGTTTC;
J. parental and F pairs Using IntelliQube platform from LGC2Carrying out SNP genotyping detection test based on KSAP technology for single plants with different fruit lengths, and specifically carrying out the test by referring to KASP test steps;
KASP reaction system: the reaction system was performed with reference to the LGC IntelliQube platform Specification, and specifically contains a KASP primer mixture, a KASP master mixture and a DNA template. Wherein the KASP primer mixture comprises two allele-specific forward primers and a common reverse primer; the KASP master mix comprises F-1 tail FAM labeled oligo sequence, F-2 tail HEX labeled oligo sequence, FAM dye, HEX dye, quencher; the DNA template is mainly eggplant genome DNA;
the KASP test steps are as follows:
a. DNA samples were dispensed onto 96-well PCR plates. DNA samples were prepared at uniform appropriate concentrations (5-10 ng/. mu.l) and applied to 96-well PCR plates with 2 negative controls (NTC) per PCR plate;
b. preparing KASP gene typing mixed liquor. Reference 384-well array tape, wherein wet DNA: 0.8ul, 2x KASP Master mix + Assay: 0.8ul, total reaction volume: 1.6 ul;
c. the KASP genotyping mix was added to the array tape membrane already containing the DNA template. Programming by utilizing an SNP gene detection platform of IntelliQube, sequentially placing 384Array tape, a DNA sample plate and a KASP genotyping mixed solution into a machine, operating the machine to execute a program, and respectively and automatically performing the processes of subpackaging and membrane sealing of the DNA sample diluent and the KASP genotyping mixed solution into the Array tape with 384 holes;
d. PCR cycling reaction is carried out. The PCR reaction can be carried out in an IntelliQube machine in an SNP (single membrane) mode, and can also be carried out in a Hydrocycler in a SNP genotyping outline (multi-membrane) mode in a water bath PCR. The program settings were as follows: 1. pre-denaturation: the temperature is 94 ℃, 15min, 1 cycle; 2. denaturation: temperature 94 ℃, 20 sec; renaturation/extension: the temperature is 61-55 ℃, and 60sec (-0.6 ℃/cycle); step 2, 10 cycles; 3. denaturation: temperature 94 ℃, 20 sec; renaturation/extension: the temperature is 55 ℃, the temperature is 60sec, and the 3 rd step comprises 26 cycles;
e. fluorescence data reading and analysis. After the PCR reaction is finished, reading and analyzing fluorescence data by using an IntelliQube machine; fluorescence FAM excitation (nm)485, emission (nm) 520; HEX excitation 535, emission 556, ROX excitation 575, emission 610;
f. and (4) adding circulation. If the data fluorescence signal is low and the grouping is scattered, the fluorescence reading can be carried out after the circulation is increased; the conditions of the addition cycle were as follows: denaturation: temperature 94 ℃, 20 sec; renaturation/extension: the temperature is 57 ℃, the temperature is 60sec, and the cycle number is 3;
K. the results of KASP typing of the molecular marker were analyzed, and 131 strains F2The gene types are divided into 3, wherein 30 strains are F2The TT basic group type in the generations is 100, the average fruit length is 21.85cm, and the parent Zhejiang purple eggplant '1838' is the genotype; 69 strains were F2Mid-generation AT hybrid base type 300, average length 16.22 cm; 32 strains are F2The generation AA base type is 400, the average length is 11.97cm, and the parent green oval eggplant '1815' is the genotype. For 131 strains F2Significance tests are carried out on the average fruit length of the generation individual plants, and analysis shows that the average difference values of the fruit lengths of the three types of genotype individuals shown in figure 2 are respectively 5.63cm (TT-AT), 9.88cm (TT-AA) and 4.25cm (AT-AA), and the difference is extremely significant (P<0.005); in FIG. 2 TT base type 100, display with water as negative control 200, AT hybrid base type 300 and AA base type 400, F2Fruit Length ratio F of TT base type 100 in Generation2The AA base type in the generation is 400, the fruit degree is required to be long, and for an unknown variety, the fruit length is similar to that of a sample fruit with the same mark type after the known variety is marked by KASP (Kasp);
l, therefore, by comparing the measured value of the fruit length with the KASP typing test result, the SNP marker at 78393511 th base of chromosome 3 is proved to be closely linked with the fruit length character and can be used for detecting the difference of the eggplant fruit length;
KASP typing results: firstly, the primers and the method can detect whether a major QTL site fl3.1 related to the fruit length exists on the eggplant, detect the polymorphism type of the marker, and predict the fruit length character through the marker type, so that the purpose of predicting the fruit length in advance is achieved, and the molecular marker-assisted selection of the fruit length character of the eggplant is realized.
The invention discovers a main effect QTL site fl3.1 which is positioned on the chromosome 3 of an eggplant and is related to the fruit length character through a QTL-seq technology and genetic map positioning, further develops molecular markers which are closely linked with the fruit length character in the site, extracts DNA from seeds or seedling leaves of unknown eggplant materials, and performs KASP molecular marker typing test by combining with the KASP primer of the invention, so that the fruit length of the eggplant can be predicted through the typing result of the markers, and the measurement and judgment are not needed when the eggplant fruits reach commercial fruits like in conventional breeding, thereby obviously improving the breeding efficiency and saving the breeding cost.
Sequence listing
<110> Zhejiang province academy of agricultural sciences
<120> SNP molecular marker closely linked with main effect QTL locus of eggplant fruit length and application
<160> 5
<170> SIPOSequenceListing 1.0
<210> 1
<211> 100
<212> DNA
<213> eggplant (Artificial Sequence)
<400> 1
agatagatac atggaaacca cgtttaaacc ccaaaccaag tgagaaaaag tctcgcaatt 60
cacattattc atcttggaac gacaatgttc acggaacaag 100
<210> 2
<211> 100
<212> DNA
<213> eggplant (Artificial Sequence)
<400> 2
actgtcaact ctatatctaa acatttggca aaccatatga aaccaaatcc tagtatatct 60
tcaggggaag tgtcatcttt aaggtcactg acattttgtc 100
<210> 3
<211> 43
<212> DNA
<213> eggplant (Artificial Sequence)
<400> 3
gaaggtgacc aagttcatgc tcgacaatgt tcacggaaca agt 43
<210> 4
<211> 43
<212> DNA
<213> eggplant (Artificial Sequence)
<400> 4
gaaggtcgga gtcaacggat tcgacaatgt tcacggaaca aga 43
<210> 5
<211> 22
<212> DNA
<213> eggplant (Artificial Sequence)
<400> 5
agatatacta ggatttggtt tc 22
Claims (5)
1. The SNP molecular marker closely linked with the main effect QTL locus of the length of the eggplant fruits is characterized in that: the SNP molecular marker is located at 78393511 th base of eggplant chromosome 3, and the 78393511 th base is T or A;
the 100 base sequences of the 78393511 th base upstream of the eggplant No. 3 chromosome are shown as SEQ ID NO. 1;
the 100 base sequence of the downstream of 78393511 base of eggplant No. 3 chromosome is shown as SEQ ID NO. 2.
2. The method for detecting the SNP molecular markers tightly linked with the main effect QTL sites of the length of the eggplant fruits as claimed in claim 1, which is characterized in that: comprises the following steps of (a) carrying out,
(1) extracting 100 base sequences at the upstream and 100 base sequences at the downstream of the SNP molecular marker;
(2) converting the SNP molecular marker in the whole base sequence in the step (1) into a KASP marker through primer design software;
(3) and (3) carrying out SNP genotyping detection based on KASP by using the whole base sequence in the step (2) through a genotyping detection platform.
3. The method for detecting the SNP molecular markers tightly linked with the main effect QTL sites of the length of the eggplant fruits as claimed in claim 2, which is characterized in that: the KASP primer used in the step (3) is,
forward primer, F-1: GAAGGTGACCAAGTTCATGCTCGACAATGTTCACGGAACAAGT, as shown in SEQ ID NO. 3;
forward primer, F-2: GAAGGTCGGAGTCAACGGATTCGACAATGTTCACGGAACAAGA, as shown in SEQ ID NO. 4;
reverse primer, R: AGATATACTAGGATTTGGTTTC, as shown in SEQ ID NO: 5.
4. The method for detecting the SNP molecular markers tightly linked with the main effect QTL sites of the length of the eggplant fruits as claimed in claim 3, which is characterized in that: the reaction system of the KASP comprises a KASP primer mixture, a KASP master mixture and a DNA template; the KASP primer mixture comprises a forward primer F-1, a forward primer F-2 and a reverse primer R; the KASP master mix comprises a forward primer F-1 tail FAM-labeled oligonucleotide sequence, a forward primer F-2 tail HEX-labeled oligonucleotide sequence, FAM dye, HEX dye and a quencher; the DNA template is eggplant genome DNA.
5. The application of the SNP molecular marker closely linked with the main effect QTL site of the length of the eggplant fruits in early identification and screening of the length traits of the eggplant fruits.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011238129.8A CN112251533B (en) | 2020-11-09 | 2020-11-09 | SNP molecular marker closely linked with main effect QTL site of eggplant fruit length and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011238129.8A CN112251533B (en) | 2020-11-09 | 2020-11-09 | SNP molecular marker closely linked with main effect QTL site of eggplant fruit length and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112251533A true CN112251533A (en) | 2021-01-22 |
| CN112251533B CN112251533B (en) | 2022-08-23 |
Family
ID=74266300
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011238129.8A Active CN112251533B (en) | 2020-11-09 | 2020-11-09 | SNP molecular marker closely linked with main effect QTL site of eggplant fruit length and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112251533B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112813191A (en) * | 2021-03-30 | 2021-05-18 | 天津市农业科学院 | Molecular marker related to eggplant sepal covering pericarp color and application |
| CN113151487A (en) * | 2021-02-09 | 2021-07-23 | 大连海洋大学 | Molecular identification marker primer combination for quantitative character of stichopus japonicus and thorn and application method thereof |
| NL2031136B1 (en) * | 2022-03-02 | 2023-09-08 | Inst Vegetables & Flowers Caas | Set of kompetitive allele specific pcr (kasp)-based core single nucleotide polymorphism (snp) markers for eggplant and use thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103268A (en) * | 2013-01-22 | 2013-05-15 | 上海交通大学 | Development and application method of solanum melongena L. EST-SSR marker |
| CN108165657A (en) * | 2018-03-05 | 2018-06-15 | 南京农业大学 | A kind of and the relevant SSR marker of cucumber fruit length character and its application |
| CN108624710A (en) * | 2018-06-19 | 2018-10-09 | 南京农业大学 | A kind of and the relevant SSR marker of cucumber fruit length character and its application |
-
2020
- 2020-11-09 CN CN202011238129.8A patent/CN112251533B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103103268A (en) * | 2013-01-22 | 2013-05-15 | 上海交通大学 | Development and application method of solanum melongena L. EST-SSR marker |
| CN108165657A (en) * | 2018-03-05 | 2018-06-15 | 南京农业大学 | A kind of and the relevant SSR marker of cucumber fruit length character and its application |
| CN108624710A (en) * | 2018-06-19 | 2018-10-09 | 南京农业大学 | A kind of and the relevant SSR marker of cucumber fruit length character and its application |
Non-Patent Citations (2)
| Title |
|---|
| QINGZHEN WEI等: "Construction of a SNP-Based Genetic Map Using SLAF-Seq and QTL Analysis of Morphological Traits in Eggplant", 《FRONTIERS IN GENETICS》, 31 March 2020 (2020-03-31) * |
| 魏庆镇等: "茄子种间高密度遗传图谱构建及重要农艺性状QTL定位分析", 《中国园艺学会2019年学术年会暨成立90周年纪念大会论文摘要集》, 21 October 2019 (2019-10-21), pages 1 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113151487A (en) * | 2021-02-09 | 2021-07-23 | 大连海洋大学 | Molecular identification marker primer combination for quantitative character of stichopus japonicus and thorn and application method thereof |
| CN112813191A (en) * | 2021-03-30 | 2021-05-18 | 天津市农业科学院 | Molecular marker related to eggplant sepal covering pericarp color and application |
| CN112813191B (en) * | 2021-03-30 | 2021-08-10 | 天津市农业科学院 | Molecular marker related to eggplant sepal covering pericarp color and application |
| NL2031136B1 (en) * | 2022-03-02 | 2023-09-08 | Inst Vegetables & Flowers Caas | Set of kompetitive allele specific pcr (kasp)-based core single nucleotide polymorphism (snp) markers for eggplant and use thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112251533B (en) | 2022-08-23 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112251533B (en) | SNP molecular marker closely linked with main effect QTL site of eggplant fruit length and application | |
| CN109706263A (en) | Chain SNP marker and application with wheat stripe rust resisting ospc gene QYr.sicau-1B-1 | |
| CN109825621A (en) | Wheat spikelet number QTL chain SNP marker and its application | |
| CN112626257B (en) | SNP molecular marker for detecting purity of sunflower variety and application thereof | |
| CN110499387A (en) | A kind of molecular labeling and its application that the long QTL of wheat flag leaf is chain | |
| CN111926098B (en) | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application | |
| CN108374054A (en) | Suitable for one group of rice SSR molecular marker of capillary electrophoresis detection technology and its application | |
| CN109762812A (en) | Wheat growth gesture related SNP and its as target spot identification wheat growth gesture character in application | |
| CN110438252A (en) | Molecular labeling and its application with spinach male and female gender close linkage | |
| CN114774570B (en) | Molecular marker closely linked with wheat stem rot resistance QTL and application | |
| CN114107548B (en) | KASP molecular marker for detecting color of waxberry fruits and application thereof | |
| CN114657277A (en) | KASP molecular marker related to wheat grain length and application thereof | |
| CN108531642B (en) | SSR molecular markers for identifying corn varieties and application thereof | |
| CN109439788A (en) | KASP molecular labeling and its application with Plant Height in Wheat major gene loci close linkage | |
| CN112391489B (en) | SNP molecular marker related to watermelon flesh color and application thereof | |
| CN117512175B (en) | SNP molecular marker closely linked with brassica napus dwarf gene BnA03.IAA7 and application thereof | |
| CN112342309B (en) | SNP molecular marker related to cotton flower basal leaf spot character and application thereof | |
| CN110724755B (en) | CAPS marker primer group linked with watermelon internode length and application thereof | |
| CN117604151B (en) | SNP molecular marker closely linked with cabbage type rape black shank gene BnRlm and application thereof | |
| CN114058734B (en) | SNP molecular marker combination for detecting rape varieties and application thereof | |
| CN114686614B (en) | KASP molecular marker for detecting pea leaf configuration and application thereof | |
| CN117604157A (en) | SNP molecular marker closely linked with brassica napus leaf chromogen BnA03.PL1 and application thereof | |
| CN115873974A (en) | KaSP molecular marker related to radish anti-clubroot and application thereof | |
| CN117418036A (en) | SNP molecular marker closely linked with cabbage type rape oil content gene BnA05.OC and application thereof | |
| CN115011725A (en) | SNP molecular markers closely linked with eggplant flower number and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |