CN112226425B

CN112226425B - Asian locusta extracellular protease ERK and coding gene and application thereof

Info

Publication number: CN112226425B
Application number: CN202010925531.7A
Authority: CN
Inventors: 涂雄兵; 张泽华; 李霜; 徐超民
Original assignee: Ningxia Zhongwei Teke Biotechnology Co ltd
Current assignee: Ningxia Zhongwei Teke Biotechnology Co ltd
Priority date: 2020-09-03
Filing date: 2020-09-03
Publication date: 2022-09-30
Anticipated expiration: 2040-09-03
Also published as: CN112226425A

Abstract

The application discloses an Asian locusta extracellular protease ERK, and a coding gene and application thereof. The method comprises the steps of firstly cloning an Asian dolly locust extracellular protease gene ERK from the Asian dolly locust, designing a primer for the Asian dolly locust extracellular protease gene ERK, synthesizing dsRNA for interfering the Asian dolly locust extracellular protease gene ERK, and introducing the dsRNA into the Asian dolly locust by an injection method to perform RNAi on the Asian dolly locust extracellular protease gene ERK. The results show that: after the Asian locusts are injected by dsRNA, the survival rate, the growth rate, the weight and the overall expression capacity are all obviously reduced, which indicates that the Asian locusts extracellular protease gene ERK plays an important role in the growth and development process of insects. The application provides a new method for molecular regulation and control of pests, and also provides a theoretical basis for deep understanding of the growth and development mechanism of insects and creation of a new biopesticide preparation.

Description

Asian locusta extracellular protease ERK and coding gene and application thereof

Technical Field

The application relates to the technical field of biotechnology, in particular to an Asian locusta extracellular protease ERK and a coding gene and application thereof.

Background

In recent years, the damage degree of grassland pests on grasslands is in a remarkable rising trend, the grassland area is endangered to rise year by year, the production of agriculture and animal husbandry is seriously threatened, and meanwhile, the hidden danger of sand storm is also buried. The traditional pest control mainly comprises emergency prevention and control and chemical prevention and control, and the prevention and control means excessively depends on chemical pesticides, so that the environment is harmed, the problems of pesticide residue and the like are important topics which people pay more and more attention to, and the defects that the pest control of crops at the present stage is relatively lagged are shown. Therefore, the pest control is a long process and needs to be carried out in continuous exploration, improvement and summary, the introduction of a new pest control technology does not represent that the traditional control mode is completely abandoned, and only the combination of the new technology and the traditional control mode can make a new breakthrough in pest control.

Disclosure of Invention

The application aims to provide an Asian locusted extracellular protease ERK, and a coding gene and application thereof, which are used for solving the problem of environmental harm caused by pest control through chemical pesticides.

In a first aspect, according to embodiments of the present application, there is provided an asian locusta extracellular protease ERK, comprising:

the amino acid sequence is the protein shown in SEQ ID No.2, or the fusion protein obtained by connecting a label at the N end and/or the C end of the protein shown in SEQ ID No. 2.

In a second aspect, according to embodiments of the present application, there is provided an asian locusta extracellular protease ERK gene encoded by a nucleotide sequence shown in SEQ ID No. 1.

In a third aspect, according to an embodiment of the present application, there is provided a biomaterial comprising:

a nucleic acid molecule encoding said Asian locusted extracellular protease ERK,

alternatively, an expression cassette comprising said nucleic acid molecule;

alternatively, a recombinant vector comprising said nucleic acid molecule;

alternatively, a recombinant vector comprising said expression cassette;

alternatively, a recombinant microorganism comprising said nucleic acid molecule;

alternatively, a recombinant microorganism comprising said expression cassette;

or, a recombinant microorganism containing a recombinant vector for said nucleic acid molecule;

or, a recombinant microorganism containing a recombinant vector for said expression cassette.

Further, the nucleic acid molecule is a cDNA molecule shown as SEQ ID No. 1.

In a fourth aspect, according to the embodiment of the application, the extracellular protease ERK of the Asian dolly locust or the application of the biological material in regulating and controlling the growth and development of the Asian dolly locust, preparing a product for regulating and controlling the growth and development of the Asian dolly locust, controlling the Asian dolly locust, preparing a product for controlling the Asian dolly locust, reducing the survival rate of the Asian dolly locust, preparing a product for reducing the survival rate of the Asian dolly locust, reducing the weight increment of the Asian dolly locust, preparing a product for reducing the weight increment of the Asian dolly locust, reducing the growth rate of the Asian dolly locust and/or preparing a product for reducing the growth rate of the Asian dolly locust is provided.

In a fifth aspect, according to embodiments of the present application, there is provided a method for inhibiting growth and development of an asian dolly locust, comprising reducing expression amount and/or activity of extracellular protease in the asian dolly locust.

Further, the reduction of the expression amount and/or activity of extracellular protease in the locusta asiatica comprises the following steps:

introducing a substance for inhibiting the expression of an encoding gene of extracellular protease in the locusta asiatica into the locusta asiatica.

Further, the substance for inhibiting the expression of the coding gene of the extracellular protease in the locusta asiatica comprises dsRNA for inhibiting the expression of the coding gene of the extracellular protease in the locusta asiatica.

Further, the dsRNA for inhibiting the expression of the coding gene of the extracellular protease in the locusta asiatica is double-stranded RNA consisting of the nucleotide shown in SEQ ID No.1 and the nucleotide shown in a reverse complementary sequence thereof.

Further, the introduction is by injection.

According to the technical scheme, firstly, the Asian dolly locust extracellular protease gene ERK is cloned from the Asian dolly locust, a primer is designed for the Asian dolly locust extracellular protease gene ERK, dsRNA for interfering the Asian dolly locust extracellular protease gene ERK is synthesized, and the dsRNA is introduced into the Asian dolly locust by an injection method to carry out RNAi on the Asian dolly locust extracellular protease gene ERK. The results show that: after the Asian locusts are injected by dsRNA, the survival rate, the growth rate, the weight and the overall expression capacity are all obviously reduced, which indicates that the Asian locusts extracellular protease gene ERK plays an important role in the growth and development process of insects. The invention provides a new method for molecular regulation of pests and also provides a theoretical basis for deeply understanding the growth and development mechanism of insects and creating a new biological pesticide preparation.

Drawings

In order to more clearly illustrate the embodiments of the present application or the technical solutions in the prior art, the drawings needed to be used in the embodiments will be briefly described below, and it is obvious that the drawings in the following description are only some embodiments of the present application, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

Fig. 1 is a bar graph illustrating asian locusts survival rate according to an embodiment of the present application;

FIG. 2 is a bar graph of weight gain of female Asian locusts according to an embodiment of the present application;

FIG. 3 is a bar graph of the body weight gain of male Asian locusts shown according to an embodiment of the present application;

fig. 4 is a bar graph of female asian locusts growth rate according to an embodiment of the present application;

FIG. 5 is a bar graph of male Asian locusts growth rate, according to an embodiment of the present application;

fig. 6 is a bar graph of overall performance of a female asian locusta according to an embodiment of the present application;

fig. 7 is a bar graph of overall performance of a male asian locusts according to an embodiment of the present application.

Detailed Description

The extracellular protease provided by the application is derived from Asian locusts, and is named as ERK by combining a gene naming method.

The embodiment of the application provides an Asian locusts extracellular protease ERK, including: a) or b) or c) or d).

a) The amino acid sequence is protein shown in SEQ ID No. 2;

or b) fusion protein obtained by connecting a label to the N end and/or the C end of the protein shown in SEQ ID No. 2.

In order to facilitate the purification of the protein in a), a tag as shown in Table 1 can be attached to the amino terminus or the carboxyl terminus of the protein shown in SEQ ID No.2 of the sequence Listing.

TABLE 1

c) The Asian locusts extracellular protease ERK also comprises protein which is obtained by substituting and/or deleting and/or adding one or more amino acid residues of the amino acid sequence shown in SEQ ID No.2 and has the same function;

the Asian locusta extracellular protease ERK in c) above, wherein the substitution and/or deletion and/or addition of one or more amino acid residues is a substitution and/or deletion and/or addition of not more than 10 amino acid residues.

The Asian locusta extracellular protease ERK in the step c) can be artificially synthesized, and can also be obtained by synthesizing the coding gene of the Asian locusta extracellular protease ERK and then performing biological expression.

The coding gene of the Asian locusta extracellular protease ERK in c) can be obtained by deleting one or more codons of amino acid residues in the DNA sequence shown in SEQ ID No.1, and/or carrying out missense mutation of one or more base pairs, and/or connecting the coding sequence of the label shown in the table 1 at the 5 'end and/or the 3' end.

d) And (b) a protein having homology of 75% or more than 75% with the amino acid sequence shown in SEQ ID No.2 and having the same function.

The embodiment of the application provides an Asian locusted extracellular protease ERK gene which is obtained by coding a nucleotide shown in SEQ ID No. 1.

Embodiments provide a biomaterial comprising any one of the following a1) to A8):

A1) a nucleic acid molecule encoding an asian locusta extracellular protease ERK;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising the nucleic acid molecule of a 1);

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

In the above biological material, the nucleic acid molecule of A1) is a gene represented by the following 1) or 2) or 3):

1) the coding sequence is cDNA molecule or genome DNA molecule shown in SEQ ID No. 1;

2) a cDNA molecule or a genome DNA molecule which has 75 percent or more than 75 percent of identity with the nucleotide sequence defined by 1) and codes ERK protein;

3) a cDNA molecule or a genome DNA molecule which is hybridized with the nucleotide sequence limited by 1) or 2) under strict conditions and codes ERK protein.

Wherein the nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA, etc.

Wherein, SEQ ID No.1 consists of 1113 nucleotides, and SEQ ID No.2 is the amino acid sequence of SEQ ID No. 1.

The nucleotide sequence encoding the ERK protein of the present application can be readily mutated by one of ordinary skill in the art using known methods, such as directed evolution and point mutation. Those nucleotides which are artificially modified to have 75% or more identity to the nucleotide sequence of ERK isolated herein, are derived from and identical to the nucleotide sequence of the present application as long as they encode ERK and have the same function.

The term "identity" as used herein refers to sequence similarity to a native nucleic acid sequence. "identity" includes a nucleotide sequence having 75% or more, or 85% or more, or 90% or more, or 95% or more identity to the nucleotide sequence of the present invention encoding the protein consisting of the amino acid sequence shown in SEQ ID No. 2. Identity can be assessed visually or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess the identity between related sequences.

The above-mentioned identity of 75% or more may be 80%, 85%, 90% or 95% or more.

The application provides an application of Asian locusta extracellular protease ERK or the biological material in any one of the following a1) -a 12):

a1) regulating and controlling the growth and development of the acridid;

a2) preparing a product for regulating and controlling the growth and development of the acridid locusta;

a3) preventing and controlling Asiatic locusts;

a4) preparing a product for preventing and controlling Asian locusts;

a5) the survival rate of the locusts is reduced;

a6) preparing a product for reducing the survival rate of the locusts;

a7) reducing the weight increment of the locusts in Asian;

a8) preparing a product for reducing the weight increment of the locusts in Asia;

a9) the growth rate of the locusts in Asian is reduced;

a10) preparing a product of Asian locusts with a growth rate;

a11) the overall expressive force of the locusts in Asia is reduced;

a12) preparing a product for reducing the overall expressive force of the locusts in Asia.

Wherein the overall expressive force refers to the development progress and survival condition of the Asian locusts, and the regulation is inhibition.

The embodiment of the application provides a method for inhibiting growth and development of an Asian locusts, which comprises the step of reducing the expression quantity and/or activity of extracellular protease in the Asian locusts.

The application realizes the inhibition of the growth and development of the Asian locusts by reducing the expression quantity and/or activity of extracellular protease in the Asian locusts.

Furthermore, the dsRNA for inhibiting expression of the coding gene of the Asian locusts extracellular protease is double-stranded RNA consisting of the nucleotide shown in SEQ ID No.1 and the nucleotide shown in a reverse complementary sequence of the nucleotide.

Further, the introduction is by injection.

In order to prove that the dsRNA inhibiting the expression of the coding gene of extracellular protease in the locusta asiatica can inhibit the growth and development of the locusta asiatica after being introduced into the locusta asiatica, the following experiments are carried out:

it should be noted that the experimental methods used in the examples of the present application are all conventional methods unless otherwise specified. Materials, reagents and the like used in the examples of the present application are commercially available unless otherwise specified. The quantitative tests in the embodiment of the application are all set to be repeated for three times, and the results are averaged.

The test insect sources in the examples of this application: collecting locusta extracellular protease (with consistent development) from 3-year Asian locusta in the city of Haote, and feeding in an intelligent artificial climate box under the following feeding conditions: the temperature is 26 ℃, the humidity is 70%, the light-dark ratio is 16 h: 8h, and the feed is uniformly fed by the Kjeldahl needle couch grass.

The main reagents and reagents in the examples of the present application:

RNA isolation reagent (Invitrogcn original package), RNA spin column (all-type gold), gel recovery kit (Axygen), EX Taq DNA polymerase (Takara), T4DReagents such as NA ligase (Takara), pGEM-T Easy Vector Systems (Promega), absolute ethanol, isopropanol, and glycerol are all home-made analytical alcohols.

The main instruments in the embodiment of the application: an ultra-clean workbench (Shanghai Bowey Engineers Co., Ltd.), a Dongsheng Longe ETC-811 PCR instrument (Beijing Tosheng Innovation Biotech Co., Ltd.), a German Sigma 3K15 refrigerated centrifuge (German Hegma centrifuge Co., Ltd.), a NanoPhotometer micro spectrophotometer (German IMPLEN Co., Ltd.), an HPX-9052 MBE digital display electrothermal incubator (Shanghai Bowey Engineers Co., Ltd.), a THZ-D desk type constant temperature shaker (Huamei Biochemical apparatus Ltd.), a vortex shaker QL-901 (manufactured by Linbel apparatus of Haimen City), and an autoclave YXQ-LS-50SII (medical apparatus factory of Shanghai Bowey Engineers Co., Ltd.).

Example 1 Asian locusta extracellular protease ERK and acquisition of coding gene thereof

1. Extraction of Asian locusta general RNA

By using

The RNA separating agent extracts RNA of the Asian locusta tissue sample. The method comprises the following specific steps:

1) a2 mL homogenizer was placed in an oven at 160 ℃ for 3 hours for sterilization and cooled to room temperature for use.

2) Place the homogenizer on ice and add 1mL

RNA separating reagent and 100-200mg Asian locusta migratoria mechanism, and grinding.

3) The homogenate was transferred to a 1.5mL centrifuge tube and allowed to stand at room temperature for 5 min. Centrifuge at 13000r for 5min at 4 ℃.

4) The supernatant was transferred to a clean 1.5mL centrifuge tube, 200. mu.L chloroform was added and vortexed for 15 s. Standing at room temperature for 5 min. Centrifuge at 13000r for 10min at 4 ℃.

5) Aspirate 400. mu.L of the supernatant into a new 1.5mL centrifuge tube, add 200. mu.L of chloroform, and vortex for 30 s. Standing at room temperature for 5 min. Centrifuge at 13000r for 10min at 4 ℃.

6) And sucking 300 mu L of supernatant, adding 300 mu L of isopropanol, carrying out vortex oscillation for 30s, transferring the supernatant into an RNA spin column, and standing the mixture on ice for 10 min.

7) Centrifuge at 13000r for 2min at 4 ℃ and discard the filtrate.

8) Add 600. mu.L RNA washsolution, aspirate the sediment and wash it, centrifuge it at 13000r for 2min at 4 ℃ and discard the filtrate. Add 600. mu.L of RNA washsolution again, wash the sediment by pipetting, centrifuge at 13000r for 2min at 4 ℃ and discard the filtrate. Air-separating at 13000r for 3min at 4 ℃, removing excess ethanol, and air-drying for 3 min.

9) A new collection tube was replaced, 50. mu.L of 65 ℃ preheated RNase-free-water was added to the RNA spin column, heated with residual heat for 5min, centrifuged at 13000r for 3min at 4 ℃.

10) The filtrate was collected, and RNA concentration and OD260/280 were measured with a NanoPhotometer micro spectrophotometer to confirm RNA quality. At the same time, 2. mu.L of the extracted RNA was taken and detected by agarose gel electrophoresis, and the remaining RNA was stored at-20 ℃ for further use.

2. Reverse transcription

The cDNA was obtained by reverse transcription using the PrimeScriptTM 1st strand cDNA Synthesis Kit. The method comprises the following specific steps:

1) A10-mu-L system is configured: oligo dT Primer (50. mu.M) 1. mu.L, dNTP mix (10mM each) 1. mu.L, total RNA < 5. mu.L, RNase Free dH2O complement to 10. mu.L.

2) After keeping the temperature at 65 ℃ for 5min, the mixture is rapidly cooled on ice.

3) Prepare 20 μ L of reaction solution: 5 XPrimeScript Buffer 4. mu.L, RNase Inhibitor (400U/. mu.L) 0.5. mu.L (20units), PrimeScript RTase (200U/. mu.L) 1. mu.L (200units), RNase Free dH ₂ O make up to 20. mu.L.

4) Slowly mixing the mixture evenly.

5) Keeping the temperature at 42 ℃ for 30-60 min.

6) The temperature was maintained at 95 ℃ for 5min to inactivate the enzyme, placed on ice and the cDNA was stored at-20 ℃.

3. Asian locusta extracellular protease and obtaining of coding gene thereof

1) Primer design

An ERK gene sequence is obtained according to the Asian locusta transcriptome obtained in the early stage, and DNAMAN8 is utilized to design an ERK gene full-length primer or a fragment primer. The primers were designed as follows:

ERK-F：5’-GAACTGAGCAACGACCACA-3’；

ERK-R：5’-GAGCGTCTTCAACAACTATCC-3’。

2) PCR reaction

And (3) carrying out PCR amplification by using Asian locusta cDNA as a template and using a primer ERK-F/ERK-R to obtain a PCR product.

The PCR reaction system was as follows (total volume 50. mu.L): cDNA template 1. mu. L, dNTP 4. mu.L, 10 XBuffer 5. mu.L, front primer 1. mu.L, rear primer 1. mu. L, Taq enzyme 0.25. mu. L, ddH ₂ O 38μL。

The PCR reaction conditions were as follows: 3min at 95 ℃; 30s at 95 ℃, 30s at 55 ℃, 1min at 72 ℃ and 30s for 35 cycles; 10min at 72 ℃; storing at 4 ℃.

3) PCR product recovery, cloning, sequencing

3-1) the PCR product was electrophoresed on a 1% agarose gel formulated in TAE, and when the band of interest was well separated, the gel block in which the band of interest was located was cut off with a razor blade and placed in a sterile centrifuge tube. The target band was recovered and purified using an agarose recovery kit (Axygen), and the recovery and purification process was performed according to the kit instructions.

3-2) recovering the PCR product, and then connecting the PCR product with a pGEM-T Easy vector to obtain a recombinant vector. The linking system is as follows: t4 DNA ligase 1. mu.L, 2 XBuffer 5. mu. L, pGEM-T Easy 1. mu. L, PCR recovery product 3. mu.L. Connection conditions are as follows: the connection was carried out at room temperature for 6 hours.

3-3) preparation and transformation of competent cells

To a 1.5mL centrifuge tube, 33.3. mu.L of Trans1-t1 competent cells were added, placed on ice for 15min, water bath at 42 ℃ for 90s, and placed on ice for 10 min. 500. mu.L of liquid LB medium was added to each 1.5mL centrifuge tube, and the cells were shaken at 200rpm at 37 ℃ for 2 hours. After shaking, 100. mu.L of the bacterial solution was aspirated into 1 ‰ AMP LB solid medium and cultured overnight at 37 ℃. Single colonies were picked in 2mL centrifuge tubes containing 1mL of 1 ‰ AMP LB broth. And (5) shaking the bacteria at the speed of 200rpm for 3-6h at the temperature of 37 ℃ and observing the growth condition.

3-4) PCR of bacterial liquid

Performing PCR verification on the bacterial liquid in the step 3-3), and performing PCR reaction on the bacterial liquidThe system (total volume 50. mu.L) was as follows: bacterial suspension 1. mu. L, dNTP 4. mu.L, 10 XBuffer 5. mu.L, front primer 1. mu.L, rear primer 1. mu. L, Taq enzyme 0.25. mu. L, ddH ₂ O 38μL。

The reaction conditions were as follows: 3min at 95 ℃; 30s at 95 ℃, 30s at 55 ℃, 1min at 72 ℃ and 30s for 35 cycles; 10min at 72 ℃; storing at 4 ℃.

The positive clone bacterial strain is sent to Shanghai biological engineering technology service company Limited to carry out sequence determination and analyze the sequence determination result.

The sequencing result shows that: the DNA fragment with the size of 1113bp is obtained by PCR amplification, the nucleotide sequence of the DNA fragment is shown as SEQ ID No.1, the gene shown as SEQ ID No.1 is named as Asian dolly locust extracellular protease gene ERK, the amino acid sequence of the coded extracellular protease is shown as SEQ ID No.2, and the amino acid sequence shown as SEQ ID No.2 is named as Asian dolly locust extracellular protease ERK.

Example 2 dsRNA of Asian locusta extracellular protease gene ERK and application thereof in pest control

Synthesis of first and second RNAs

dsRNA was synthesized using the T7 RiboMAX TM Express RNAi System kit. The method comprises the following specific steps:

1) synthesis of dsRNA primers

Designing a primer according to the cloned gene fragment, amplifying a target fragment to be about 500bp, and introducing a T7 promoter at the 5' end of the primer. The primer sequences are as follows:

erk-2F：5’-TAATACGACTCACTATAGGAACTGAGCAACGACCACA-3’；

erk-2R：5’-TAATACGACTCACTATAGGGAGCGTCTTCAACAACTATCC-3’。

2) preparation of DNA template

The kit is used for extracting bacteria liquid plasmids, plasmids containing gene segments (recombinant vectors in example 1) are used as templates, ERK-2F and ERK-2R are adopted for PCR amplification, and target segments containing T7 promoter sequences are obtained.

The PCR reaction system was as follows (total volume 50. mu.L): plasmid 1. mu. L, dNTP 4. mu.L, 10 XBuffer 5. mu.L, pre-primer 1. mu.L, post-primer 1. mu. L, Taq enzyme 0.25. mu. L, ddH2O 38. mu.L.

The PCR reaction conditions were as follows: 3min at 95 ℃; at 95 ℃ for 30s, at 55 ℃ for 30s, at 72 ℃ for 1min, for 35 cycles; 10min at 72 ℃; storing at 4 ℃.

And recovering the PCR product, and detecting the concentration of the target DNA by using a NanoPhotometer micro spectrophotometer, wherein the recovery concentration needs to be more than 150 ng/. mu.L.

3) Synthesis of dsRNA

The recycled DNA is transcribed in vitro to synthesize dsRNA of the Asian locusta extracellular protease gene ERK by adopting a T7 RiboMAX TM Express RNAi System kit, and the concentration of the dsRNA is detected by a NanoPhotometer micro spectrophotometer, wherein the concentration of the dsRNA needs to be more than 1000 ng/muL. The dsRNA concentration was adjusted to 1 ng/. mu.L to obtain a dsRNA solution (as a solvent, Nuclear free water).

The dsRNA of the Asian locusta protease gene ERK obtained by the application is double-stranded RNA and consists of a sense strand and an antisense strand. The dsRNA of the Asian locusta protease gene ERK can also be obtained by an artificial synthesis method. The dsRNA of the Asian locusta extracellular protease gene ERK is named dsERK.

4) dsRNA of control GFP

dsRNA of control GFP was synthesized as described above, and the dsRNA of control GFP was named dsGFP to obtain a dsGFP solution at a concentration of 1 ng/. mu.L. The dsRNA of control GFP was double-stranded RNA, consisting of a sense strand and an antisense strand. Primers for synthesis of GFP dsRNA were as follows:

GFP-1F：5’-TAATACGACTCACTATAGGTACGACTCACTATAGGAGTAAAGG-3’；

GFP-1R：5’-TAATACGACTCACTATAGGTAGGTTTGTATAGTTCATCCATACC-3’。

second, application of dsRNA in pest control

1. Experimental methods

Introducing dsRNA into Asian locusts. The method comprises the following specific steps: and (3) sucking 5 mu L of dsERK solution (experimental group) and dsGFP solution (dsGFP control group) with the concentration of 1 ng/mu L by using a10 mu L micro-syringe, injecting the dsERK solution and the dsGFP solution from an internode membrane between a second abdominal node and a third abdominal node of the locust abdomen respectively, wherein the needle head of the syringe is parallel to the abdomen, and the internal organ tissues of the locust are prevented from being damaged. A blank control group (CK) injected with 3. mu.L of Nuclear free water was set, and each treatment was repeated 5 times, and 20 3-instar Asiatic locusts were treated every repetition (male-female ratio 1: 1). Feeding the mixture in an intelligent artificial climate box after injection under the following feeding conditions: the temperature is 26 ℃, the humidity is 70%, the light-dark ratio is 16 h: 8h, the growth and development conditions of the locusts in Asia are observed every day, and the survival rate, the weight increment, the growth rate and the overall expressive force are sampled and counted after the adult stage is started. Counting days D, survival rate S of each treatment group, and survival rate S/20; the average body length of each treatment group before the experiment is A1, the average body length of each treatment group after the adult stage is A2, and the increase of the body length is A2-A1; the average weight of each treatment group before the experiment is B1, the average weight of each treatment group after the adult stage is B2, and the weight increment is B2-B1; growth rate ═ (B2-B1)/D; total performance ═ S/20 x [ (B2-B1)/D ].

2. Real-time fluorescent quantitative PCR

Extracting total RNA of Asian locusts in experimental group and control group (dsGFP control group and blank control group) 72h after injection, synthesizing cDNA by Takara reverse transcription kit, and detecting ERK gene expression amount. The actin gene was used as an internal reference gene. The ERK gene primer sequence is as follows: A-ERK-146-F: CAGACATACTGTCAAAGGACG and A-ERK-121-R: GTCTCCATAAGGCATTGCAC, respectively; the sequence of the actin gene primer is A-actin-119-F: CAGAAGGAAATCACCGCC, A-actin-119-R: TGGAAGGTGGACAGCGAA are provided.

The results show that: compared with the control group (dsGFP control group and blank control group), the expression level of the ERK gene in the Asian locusts of the dsERK experimental group is obviously reduced, which indicates that the dsERK successfully interferes the expression of the ERK gene in the Asian locusts. There was no significant difference in the results of the dsGFP control group and the blank control group.

3. Survival rate, weight gain, growth rate and overall expression detection results

The results are shown in fig. 1 to fig. 7, the survival rate, weight increase, growth rate and overall expression of the asian dolly locust after the ERK gene RNAi are significantly different from those of the control group (dsGFP control group and blank control group) (P is less than 0.05, each index of the asian dolly locust after interfering with the ERK gene is significantly lower than that of the control group, and the results of the dsGFP control group and the blank control group are not significantly different, which indicates that the ERK gene RNAi plays a role in inhibiting the growth and development of the asian dolly locust.

Other embodiments of the present application will be apparent to those skilled in the art from consideration of the specification and practice of the application disclosed herein. This application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the application and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains. It is intended that the specification and examples be considered as exemplary only, with a true scope and spirit of the application being indicated by the following claims.

It will be understood that the present application is not limited to the precise arrangements described above and shown in the drawings and that various modifications and changes may be made without departing from the scope thereof. The scope of the application is limited only by the appended claims.

Claims

1. An Asian locusta extracellular protease ERK is characterized in that the amino acid sequence is shown in SEQ ID No. 2.

2. An Asian locusta extracellular protease ERK gene is characterized in that the nucleotide sequence is shown in SEQ ID No. 1.

3. A biomaterial comprising any one of a1) to A8):

A1) a nucleic acid molecule encoding the asian dolly locust extracellular protease ERK according to claim 1;

A2) an expression cassette comprising the nucleic acid molecule of a 1);

A3) a recombinant vector comprising the nucleic acid molecule of a 1);

A4) a recombinant vector comprising the expression cassette of a 2);

A5) a recombinant microorganism comprising a1) the nucleic acid molecule;

A6) a recombinant microorganism comprising the expression cassette of a 2);

A7) a recombinant microorganism comprising a3) said recombinant vector;

A8) a recombinant microorganism comprising the recombinant vector of a 4).

4. The biomaterial according to claim 3, wherein the nucleic acid molecule of A1) is a cDNA molecule represented by SEQ ID No. 1.

5. Use of the asian locusta extracellular protease ERK according to claim 1 or the biomaterial according to claim 3 or 4 for regulating growth and development of the asian locusta, preparing a product for regulating growth and development of the asian locusta, controlling the asian locusta, preparing a product for controlling the asian locusta, reducing survival rate of the asian locusta, preparing a product for reducing survival rate of the asian locusta, reducing weight gain of the asian locusta, preparing a product for reducing weight gain of the asian locusta, reducing growth rate of the asian locusta, and/or preparing a product for reducing growth rate of the asian locusta.

6. A method for inhibiting growth and development of an Asian locusts, comprising reducing the expression level of the extracellular protease ERK in the Asian locusts of claim 1.

7. The method according to claim 6, wherein the reducing the expression level of extracellular protease ERK in locusta asia comprises:

introducing a substance inhibiting the expression of an encoding gene of extracellular protease ERK in the locustus asiaticus into the locustus asiaticus.

8. The method according to claim 7, wherein the substance inhibiting expression of the gene encoding extracellular protease in the locusta asiasari comprises dsRNA inhibiting expression of the gene encoding extracellular protease in the locusta asiasari.

9. The method of claim 7, wherein the introducing is by injection.