CN112063602B - Asian locusta migratoria small G protein Ras and coding gene and application thereof - Google Patents

Abstract

The application provides a small Asian locusts G protein Ras and a coding gene and application thereof, wherein the small Asian locusts G protein Ras has an inhibiting effect on the growth and development of the Asian locusts. The application firstly clones small G protein Ras gene of the Asian dolly locust from the body of the Asian dolly locust, designs a primer for the small G protein Ras gene of the Asian dolly locust, synthesizes dsRNA for interfering the small G protein Ras gene of the Asian dolly locust, and introduces the dsRNA into the Asian dolly locust by an injection method to carry out RNAi on the small G protein Ras gene of the Asian dolly locust. The results show that: after the Asian dolly locust is injected by dsRNA, the survival rate, the growth rate, the weight and the overall expression capacity are all obviously reduced, which indicates that the Asian dolly locust small G protein Ras gene plays an important role in the growth and development process of insects.

Description

Asian locusta migratoria small G protein Ras and coding gene and application thereof

Technical Field

The application relates to the technical field of biology, in particular to a small G protein Ras of locusts in Asia, a coding gene and application thereof.

Background

Grassland locusts occur year after year, and seriously threaten the production of agriculture and animal husbandry. Because of large grassland area and serious disaster, the traditional locust control is mainly emergency control, and chemical pesticide is the main control agent. The locust plague treatment by using chemical pesticide not only harms the environment, but also pesticide residue is a key topic which people pay more and more attention to. Therefore, more and more biotechnology is developed and applied to locust plague prevention.

Currently, biologists have used microorganisms to infect locusts, causing them to develop and die. Pathogenic microorganisms of locusts include microspores, fungi, bacteria, viruses, and the like. The microspore is a single-cell eukaryotic pathogenic microorganism which can infect more than 100 orthoptera insects, and is most characterized in that the microspore can be transmitted to the next generation through infected female locust eggs. Entomopathogenic fungi can also be used to control locust numbers. However, the natural prevalence rate of the fungal diseases in the locust group is very low, and the artificial propagation is applied to the locust group to promote the disease.

With the help of the force of nature, scientists are also beginning to search for relevant viruses to solve the locust plague. The locust virus is a virus which takes locust as a host and has pathogenicity to the locust. Therefore, it is necessary to find a virus which has high specificity and safety and is safe and harmless to human beings, livestock, poultry, crops and the like to control the locust.

Disclosure of Invention

The invention provides an Asian locusta small G protein Ras and a coding gene and application thereof, which solve the problem of locusta control.

In one aspect, the present application provides an asian locusta small G protein Ras, which is any one of the following (a) or (b):

(a) A protein whose nucleotide sequence is that of SEQ ID No. 1;

(b) And (b) a fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of the protein (a).

A small G protein Ras gene of Asian locusta migratoria is encoded by the nucleotide shown in SEQ ID No. 1.

A biomaterial which is any one of the following (A1) to (A8):

(A1) A nucleic acid molecule encoding said protein;

(A2) An expression cassette comprising the nucleic acid molecule of (A1);

(A3) A recombinant vector comprising the nucleic acid molecule of (A1);

(A4) A recombinant vector comprising the expression cassette of (A2);

(A5) A recombinant microorganism comprising the nucleic acid molecule of (A1);

(A6) A recombinant microorganism comprising the expression cassette of (A2);

(A7) A recombinant microorganism comprising the recombinant vector of (A3);

(A8) A recombinant microorganism comprising the recombinant vector of (A4).

The biological material, (A1) the nucleic acid molecule comprises:

(1) Double-stranded RNA consisting of the nucleotide shown in SEQ ID No.1 and the nucleotide shown in a reverse complementary sequence thereof;

or (2) a nucleic acid molecule comprising the sense strand and the antisense strand of cDNA complementary to the RNA described in (1).

The Asian locusta small G protein Ras or the biological material is applied to any one of the following (a 1) to (a 4):

(a1) A method for regulating the growth and development of Asian locusts;

(a2) Preparing a product for regulating and controlling the growth and development of the acridid locusta;

(a3) A method for controlling asian locusts;

(a4) Preparing a product for preventing and controlling Asian locusts.

A substance for regulating and controlling the expression of Asian locusta protein coding gene is a double-stranded RNA consisting of the nucleotide shown in SEQ ID No.1 in a sequence table and the nucleotide shown in a reverse complementary sequence thereof.

In another aspect, the application provides a method for regulating and controlling the growth and development of acridid locusta, comprising the following steps:

introducing a substance for regulating and controlling the expression of a small G protein Ras coding gene in the Asian locusts into the Asian locusts so as to regulate and control the growth and development of the Asian locusts;

the substance for regulating and controlling the expression of the coding gene of the small G protein Ras in the Asian small-car locust is dsRNA for regulating and controlling the expression of the coding gene of the small G protein Ras in the Asian small-car locust;

the dsRNA is double-stranded RNA consisting of the nucleotide shown by SEQ ID No.1 in a sequence table and the nucleotide shown by a reverse complementary sequence thereof; the introduction mode is injection.

The application provides a small Asian locusts G protein Ras and a coding gene and application thereof, wherein the small Asian locusts G protein Ras has an inhibiting effect on the growth and development of the Asian locusts. The application firstly clones small G protein Ras gene of the Asian dolly locust from the body of the Asian dolly locust, designs a primer for the small G protein Ras gene of the Asian dolly locust, synthesizes dsRNA for interfering the small G protein Ras gene of the Asian dolly locust, and introduces the dsRNA into the Asian dolly locust by an injection method to carry out RNAi (RNA interference) on the small G protein Ras gene of the Asian dolly locust. The results show that: after the Asian dolly locust is injected by dsRNA, the survival rate, the growth rate, the weight and the overall expression capacity are all obviously reduced, which indicates that the Asian dolly locust small G protein Ras gene plays an important role in the growth and development process of insects.

Drawings

In order to more clearly explain the technical solution of the present application, the drawings needed to be used in the embodiments are briefly described below, and it is obvious for those skilled in the art to obtain other drawings without creative efforts.

FIG. 1 shows the effect of small G protein Ras gene of Asian locusts on survival rate in the examples of this application;

FIG. 2 shows the effect of Asian locusts small G protein Ras gene on body weight gain in the examples of this application;

FIG. 3 shows the effect of Asian locusts small G protein Ras gene on growth rate in the examples of this application;

FIG. 4 shows the effect of Asian locusts small G protein Ras gene on overall expression in the examples of this application;

FIG. 5 shows the effect of expression level of small G protein Ras gene of Asian locusta in the present example.

Detailed Description

Reference will now be made in detail to embodiments, examples of which are illustrated in the accompanying drawings. When the following description refers to the accompanying drawings, like numbers in different drawings represent the same or similar elements unless otherwise indicated. The embodiments described in the following examples do not represent all embodiments consistent with the present application. But merely as exemplifications of systems and methods consistent with certain aspects of the application, as recited in the claims.

The small G protein Ras is the product of Ras gene expression, wherein the Ras gene is a set of genomes in a host cell, and a new gene sequence derived from the Ras genome of the host cell is contained in a progeny virus of the host cell. A small GTP (GTP binding protein, G protein) binding protein, also called guanylate binding regulator protein (GTPase domain), has a GTPase domain, is a key component in signal pathways mediated by tyrosine kinases RTK, and plays an important role in the immunity and development of insects. Ras gene mediates MAPK (serine-threonine activated protein kinase) signal transduction pathway to regulate the development and immunity of insects.

The test insect source in the embodiment of the application is from 3-instar locusts locustae nymphs of 3-instar locusts in Haote, wherein the 3-instar locusts locustae nymphs are in the same growth and development period; 3-instar Asian locusta nymphs are placed in an intelligent artificial climate box for feeding under the following feeding conditions: the temperature is 26 ℃, the humidity is 70%, the light-dark ratio is 16 h: 8h, and the feed is uniformly fed by the Kjeldahl needle couch grass.

The main reagents in the following examples:

reagents for RNA isolation (Invitrogen kit), RNA spin column (all-purpose gold), gel recovery kit (Axygen), EX Taq DNA polymerase (Takara), T4DNA ligase (Takara), pGEM-T Easy Vector Systems (Promega), absolute ethanol, isopropanol, propylene glycol, and the like, are all home-made analytical alcohols.

In one aspect, the present application provides an asian locusta small G protein Ras, which is any one of the following (a) or (b):

(a) A protein whose nucleotide sequence is the nucleic acid molecule with SEQ ID No. 1;

(b) And (b) a fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of the protein (a).

A small G protein Ras gene of Asian locusta migratoria is encoded by the nucleotide shown in SEQ ID No. 1.

A biomaterial which is any one of the following (A1) to (A8):

(A1) A nucleic acid molecule encoding said protein;

(A2) An expression cassette comprising the nucleic acid molecule of (A1);

(A3) A recombinant vector comprising the nucleic acid molecule of (A1);

(A4) A recombinant vector comprising the expression cassette of (A2);

(A5) A recombinant microorganism comprising the nucleic acid molecule of (A1);

(A6) A recombinant microorganism comprising the expression cassette of (A2);

(A7) A recombinant microorganism containing the recombinant vector of (A3);

(A8) A recombinant microorganism comprising the recombinant vector of (A4).

The biological material, (A1) the nucleic acid molecule comprises:

(1) Double-stranded RNA consisting of the nucleotide shown in SEQ ID No.1 and the nucleotide shown in a reverse complementary sequence thereof;

or (2) a nucleic acid molecule comprising the sense strand and the antisense strand of cDNA complementary to the RNA described in (1).

A substance for regulating and controlling the expression of Asian locusta protein coding gene is a double-stranded RNA consisting of the nucleotide shown in SEQ ID No.1 in a sequence table and the nucleotide shown in a reverse complementary sequence thereof.

The Asian locusta small G protein Ras or the biological material is applied to any one of the following (a 1) to (a 4):

(a1) A method for regulating and controlling the growth and development of Asian locusts;

(a2) Preparing a product for regulating and controlling the growth and development of Asian locusts;

(a3) A method for controlling asian locusts;

(a4) Preparing a product for preventing and controlling Asian locusts.

The application comprises the following steps:

a method for regulating and controlling the growth and development of Asian locusts;

preparing a product for regulating and controlling the growth and development of the acridid locusta;

a method for controlling asian locusts;

preparing a product for preventing and controlling Asian locusts;

a method of reducing survival rate of locusts asiaticus;

preparing a product for reducing the survival rate of the locusts;

a method for reducing the weight gain of locusts migratoria (L.) medic;

preparing a product for reducing the weight increment of the locusts in Asia;

a method for reducing the growth rate of locusts asiaticus;

preparing a product for reducing the growth rate of the locusts in Asia;

a method for reducing the overall expression of locusts asiaticus;

preparing a product for reducing the overall expressive force of locusts in Asia.

In another aspect, the application provides a method for regulating and controlling the growth and development of acridid locusta, comprising the following steps:

introducing a substance for regulating and controlling the expression of a small G protein Ras coding gene in the Asian locusts into the Asian locusts so as to regulate and control the growth and development of the Asian locusts;

the substance for regulating and controlling the expression of the coding gene of the small G protein Ras in the Asian small locust is dsRNA (double-stranded ribonucleic acid) for regulating and controlling the expression of the coding gene of the small G protein Ras in the Asian small locust;

the dsRNA is double-stranded RNA consisting of nucleotide shown in SEQ ID No.1 in a sequence table and nucleotide shown in a reverse complementary sequence of the dsRNA; the introduction mode is injection.

Wherein, the acquisition of Asian locusts small G protein Ras encoding gene comprises the following steps:

extracting total RNA of the locusta;

carrying out reverse transcription on total RNA of the locusts in Asia;

and performing PCR amplification and sequencing on Ras genes obtained from Asian locusts.

The extraction of Asian locusta general RNA comprises the following steps:

will be provided with

Putting the RNA separation reagent and Asian locusta migratoria mechanism into a homogenizer, and grinding at the temperature below 0 ℃ to obtain homogenate;

standing the homogenate at room temperature for 5-10min, and centrifuging to obtain supernatant;

adding chloroform into the supernatant, performing vortex oscillation, and centrifuging after the vortex oscillation to obtain a solution 1;

adding isopropanol into the solution 1, then carrying out vortex oscillation, adding the solution into RNA spin column (nucleic acid purification column) after the vortex oscillation, standing for 10-20min at the temperature of below 0 ℃, and then centrifuging to obtain a solution 2;

adding RNA wash solution into the solution 2, washing the solution 2, centrifugally filtering, and drying the RNA spin column filled with the solution 2;

adding RNase-free-water (DEPC treated water is ultrapure water) preheated at 50-70 ℃ into the RNA spin column, and centrifuging to obtain filtrate;

the filtrate was tested for RNA concentration and OD260/280 with a spectrophotometer, the quality of RNA in the filtrate was confirmed, and agarose gel electrophoresis was performed, and the remaining filtrate was stored at-20 ℃ for future use.

The reverse transcription of the total RNA of the locusta migratoria includes the following steps:

reverse transcription with reverse transcription kit to obtain cDNA:

configuring Oligo dT Primer, dNTP Mixture, total RNA, RNase Free dH ₂ O solution;

reacting the solution at 65 deg.C for 5-10min, and cooling below 0 deg.C;

preparing reaction solution PrimeScript Buffer, RNase Inhibitor, primeScript RTase and RNase Free dH ₂ O (RNase-free water).

Shaking the reaction solution uniformly and keeping the temperature at 40-50 ℃ for 30-60min;

keeping the above solution at 90-100 deg.C for 5-10min, placing in ice water, and collecting the solution at-20 deg.C.

The PCR amplification and sequencing of Ras gene obtained from Asian locusts group comprises the following steps:

designing a small G protein Ras gene full-length primer or a fragment primer by using a Ras gene sequence obtained by an Asian locusta transcriptome and DNAMAN 8;

taking Asian locusts cDNA as a template, and performing PCR amplification by using a primer Ras-F/Ras-R to obtain a PCR product;

recovering the PCR product;

recovering the PCR product and connecting the PCR product with a pGEM-T Easy vector to obtain a recombinant vector;

preparing competent cells;

competent cells were subjected to PCR validation.

The gene (dsRNA) for obtaining the Asian locusta small G protein Ras and the application thereof in regulating and controlling pests comprise the following steps:

synthesizing a dsRNA primer;

preparing a DNA template;

synthesizing dsRNA;

the dsRNA is applied to controlling Asian locusts.

The following are specific examples provided herein.

Placing the homogenizer in an oven, sterilizing for 4 hours at 150 ℃, and cooling to room temperature for later use; 1mL of the solution is added

The RNA separating agent and 100mg Asian locusta migratoria mechanism are put into a homogenizer and ground at the temperature below 0 ℃ to obtain homogenate.

The homogenate was allowed to stand at room temperature for 5min and then centrifuged (13000 r) to obtain a supernatant.

The supernatant was transferred to a clean 1.5mL centrifuge tube, 200. Mu.L chloroform was added and vortexed for 15s. Standing at room temperature for 5min. Centrifuge at 13000r for 10min at 4 ℃.

Aspirate 400. Mu.L of supernatant and transfer to a new 1.5mL centrifuge tube, add 200. Mu.L chloroform and vortex for 30s. Standing at room temperature for 5min. Centrifuge at 13000r for 10min at 4 ℃.

And sucking 300 mu L of supernatant, adding 300 mu L of isopropanol, shaking in a vortex for 30s, transferring into an RNA spin column, and standing on ice for 10min.

Adding 600 μ L of RNA wash solution into the above solution, sucking to wash the precipitate, centrifuging at 4 deg.C and 13000r for 2min, discarding the filtrate, sucking twice, centrifuging, separating the RNA spin column containing the solution at 4 deg.C and 13000r for 3min, removing excess ethanol, and air drying for 3min.

To the RNA spin column was added 50. Mu.L of RNase-free-water (DEPC-treated water, i.e., ultrapure water) preheated at 65 ℃ and heated for 5min, and centrifuged at 13000r for 3min to obtain a filtrate.

The filtrate was checked for RNA concentration and OD260/280 with a NanoPhotometer spectrophotometer, the quality of RNA in the filtrate was confirmed, and 2. Mu.L of the extracted RNA was subjected to agarose gel electrophoresis, and the remaining filtrate was stored at-20 ℃ for further use.

The cDNA was obtained by reverse transcription using PrimeScriptTM 1st strand cDNA Synthesis Kit (reverse transcription Kit).

Weighing Oligo dT Primer, dNTP mix, total RNA and RNase Free dH ₂ O10. Mu.L of solution was prepared.

The solution was reacted at 65 ℃ for 5min, cooled in ice water and stored at-20 ℃ for further use.

Weighing PrimeScript Buffer, RNase Inhibitor, primeScript RTase and RNase Free dH ₂ O20. Mu.L of the reaction solution was prepared.

Shaking the reaction solution uniformly and keeping the temperature at 42 ℃ for 60min;

the solution was incubated at 95 ℃ for 5min, then placed in ice water and collected for storage at-20 ℃.

Obtaining a Ras gene sequence according to the Asian locusta transcriptome obtained in the early stage, and designing a small G protein Ras gene full-length primer or a fragment primer by using DNAMAN8 software. The primers were designed as follows:

Ras-F：5’-GGAAAGACGATAAAGGCACA-3’；

Ras-R：5’-TGTTCACTGGCAGCATTG-3’。

weighing cDNA template 1 μ L, dNTP 4 μ L, 10 × Buffer 5 μ L, front primer 1 μ L, rear primer 1 μ L, taq enzyme 0.25 μ L, ddH ₂ O38. Mu.L of PCR solution was prepared.

The reaction solution is heated to 95 ℃ for 3min; PCR products were obtained by 35 cycles at 95 ℃ 30s,55 ℃ 30s,72 ℃ 1min30s and stored at 4 ℃.

The PCR products were electrophoresed on a 1% agarose gel prepared in TAE, and the gel block where the target band was located was cut out with a razor blade and placed in a sterile centrifuge tube. And recovering and purifying the target band by using a gel recovery kit (Axygen), and recovering and purifying.

Weighing 1 muL of T4DNA ligase, 5 muL of 2 XBuffer, 1 muL of pGEM-T Easy and 3 muL of PCR recovery product to obtain the pGEM-T Easy vector.

And recovering the PCR product, and connecting the pGEM-T Easy vector for 6 hours at room temperature to obtain the recombinant vector.

In a 1.5mL centrifuge tube, 33.3. Mu.L of Trans1-t1 competent cells were added, and after placing the competent cells in ice water for 15min, the competent cells were placed on ice for 10min in a water bath at 42 ℃ for 90s in a water bath. To each 1.5mL centrifuge tube was added 500. Mu.L of liquid LB medium and shaken at 200rpm at 37 ℃ for 2h. After shaking, 100. Mu.L of the bacterial solution was aspirated into 1 ‰ AMP LB solid medium and cultured overnight at 37 ℃. Single colonies were picked in 2mL centrifuge tubes containing 1mL of 1 ‰ AMP LB broth. And (5) shaking the bacteria at the speed of 200rpm for 3-6h at the temperature of 37 ℃ and observing the growth condition.

Weighing 1 μ L of bacterial solution, 4 μ L of dNTP, 5 μ L of 10 xBuffer, 1 μ L of front primer, 1 μ L of back primer, 0.25 μ L of Taq enzyme, and ddH ₂ O38. Mu.L was used to prepare a reaction system.

Placing the bacterial liquid in the reaction system and at 95 ℃ for 3min; 30s at 95 deg.C, 30s at 55 deg.C, 1min30s at 72 deg.C, 35 cycles; reacted at 72 ℃ for 10min and then stored at 4 ℃.

The positive clone bacterial strain is sent to Shanghai biological engineering technology service company for sequence determination and analysis of the sequencing result.

The sequencing result shows that: the DNA fragment with the size of 1113bp is obtained by PCR amplification, the nucleotide sequence of the DNA fragment is shown as SEQ ID No.1, the gene shown as SEQ ID No.1 is named as Asian small G protein Ras gene, the amino acid sequence of the encoded small G protein is shown as SEQ ID No.1, and the amino acid sequence shown as SEQ ID No.1 is named as Asian small G protein Ras.

dsRNA was synthesized using T7 RiboMAX TM Express RNAi System kit. The method comprises the following specific steps:

designing a primer according to the cloned gene segment, amplifying a target segment to be about 500bp, and introducing a T7 promoter at the 5' end of the primer. The primer sequences are as follows:

Ras-2F：5’-TAATACGACTCACTATAGGAATGAAAATGACGGAATATAAGTTGG-3’；

Ras-2R：5’-TAATACGACTCACTATAGGGATAGCAAACAGCACTGTCTCCG-3’。

weighing 1 μ L plasmid, 4 μ L dNTP, 5 μ L10 XBuffer, 1 μ L front primer, 1 μ L rear primer, 0.25 μ L Taq enzyme, ddH ₂ O38. Mu.L, a PCR reaction system was prepared.

Extracting bacterium liquid plasmid with the kit, performing PCR amplification by using plasmid containing gene fragment as template and adopting Ras-2F and Ras-2R under the PCR reaction system to obtain target fragment containing T7 promoter sequence.

Wherein, the PCR reaction conditions are as follows: 3min at 95 ℃; 30s at 95 deg.C, 30s at 55 deg.C, 1min at 72 deg.C, and 35 cycles; 10min at 72 ℃; storing at 4 ℃.

Recovering PCR product, and detecting the target DNA concentration with a NanoPhotometer spectrophotometer, wherein the recovered concentration needs to be more than 150 ng/. Mu.L.

The recycled DNA is transcribed in vitro by adopting a T7 RiboMAX (TM) Express RNAi System kit to synthesize dsRNA of the small G protein Ras gene of the locusta asiatica, and a NanoPhotometer micro spectrophotometer is used for detecting the concentration of the dsRNA, wherein the concentration of the dsRNA needs to be more than 1000 ng/mu L. Then, the dsRNA concentration was adjusted to 1. Mu.g/. Mu.L to obtain a dsRNA solution (solvent: nucleic free water).

The dsRNA expressed by the coding gene of the Asian locusta small G protein Ras obtained in the embodiment is double-stranded RNA and consists of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is SEQ ID No.1, and the nucleotide sequence of the antisense strand is a reverse complementary sequence of SEQ ID No. 1. The dsRNA of the Asian locusta small G protein Ras gene can also be obtained by an artificial synthesis method. The dsRNA was named dsRas.

dsRas controls asian locusts:

first, dsRNA for control GFP was prepared and designated as dsGFP control.

A blank control group was prepared.

Three groups, dsRas experimental group, dsGFP control group and blank control group, were tested.

dsRNA of control GFP was synthesized as described above, and the dsRNA of control GFP was named dsGFP to obtain a dsGFP solution at a concentration of 1 ng/. Mu.L. The dsRNA of the contrast GFP is double-stranded RNA and consists of a sense strand and an antisense strand, wherein the nucleotide sequence of the sense strand is SEQ ID No.1, and the nucleotide sequence of the antisense strand is the reverse complementary sequence of SEQ ID No. 1. Primers for synthesis of GFP dsRNA were as follows:

GFP-1F：5’-TAATACGACTCACTATAGGTACGACTCACTATAGGAGTAAAGG-3’；

GFP-1R：5’-TAATACGACTCACTATAGGTAGGTTTGTATAGTTCATCCATACC-3’。

5 mul of dsRas solution (experimental group) and dsGFP solution (dsGFP control group) with the concentration of 1 mug/mul are sucked by a micro-syringe with the concentration of 10 mul and injected into the abdominal cavity of the locust from an internode membrane between a second abdominal node and a third abdominal node of the locust respectively, and a needle head of the syringe is parallel to the abdominal cavity, so that the internal organ tissues of the locust are prevented from being damaged. A blank control group (CK) injected with 3. Mu.L of nucleic free water was set, and each treatment was repeated 5 times, and 20 animals of 3-instar Asian locusts were treated repeatedly (male-female ratio: 1). Feeding the mixture in an intelligent artificial climate box after injection under the following feeding conditions: the temperature is 26 ℃, the humidity is 70%, the light-dark ratio is 16 h: 8h, the growth and development conditions of the locusts are observed every day, and the survival rate, the weight increment, the growth rate and the overall expressive force are sampled and counted after the adult stage is started. Counting days D, survival number S of each treatment group, survival rate = S/20; the average body length of each treatment group before the experiment is A1, the average body length of each treatment group after the adult stage is A2, and the body length increment = A2-A1; before the experiment, the average weight of each treatment group is B1, after the adult stage, the average weight of each treatment group is B2, and the weight increment = B2-B1; growth rate = (B2-B1)/D; total Performance = (S/20) × [ (B2-B1)/D ].

Wherein the control group isIrradiated is ddH ₂ O (double distilled water double distilled H) ₂ O); the experimental group was injected with Ras dsRNA.

Extracting total RNA of Asian locusts in experimental group and control group (dsGFP control group and blank control group) 72h after injection, synthesizing cDNA by Takara reverse transcription kit, and detecting Ras gene expression quantity. The actin gene was used as an internal reference gene. Ras gene primer sequences are as follows:

A-Ras-146-F：GGAAAGACGATAAAGGCACA；

A-Ras-121-R：TGTTCACTGGCAGCATTG；

the sequence of the actin gene primer is A-actin-119-F: CAGAAGGAAATCACCGCC, A-actin-119-R: TGGAAGGTGGACAGCGAA.

FIG. 1 shows the effect of small G protein Ras gene of Asian locusts on survival rate in the examples of this application; FIG. 2 shows the effect of Asian locusts small G protein Ras gene on body weight gain in the examples of this application; FIG. 3 shows the effect of Asian locusta small G protein Ras gene on growth rate in the examples of the present application; FIG. 4 shows the effect of Asian small locust G protein Ras gene on the overall expression in the examples of the present application.

As shown in fig. 1-4. The survival rate, weight increase, growth rate and overall expression of the Asian dolly locust after Ras gene RNAi are significantly different from those of a control group (a dsGFP control group and a blank control group) (P is less than 0.05, each index of the Asian dolly locust after Ras gene interference is significantly lower than that of the control group, and the results of the dsGFP control group and the blank control group have no significant difference.

FIG. 5 shows the effect of expression level of small G protein Ras gene of Asian locusta in the present example. The influence of the Asian locusts small G protein Ras gene expression quantity is specifically the influence of the Asian locusts Ras gene on the expression quantity of an insulin-serine threonine kinase signal pathway (ILP-MAPK) gene after the interference. After the Asian dolly locust is injected by dsRNA, the survival rate, the growth rate, the weight and the overall expression capacity are all obviously reduced, which indicates that the Asian dolly locust small G protein Ras gene plays an important role in the growth and development process of insects.

Claims (7)

1. A small G protein Ras of Asian locusta, which is any one of the following (a) or (b):

(a) A protein whose nucleotide sequence is the nucleic acid molecule with SEQ ID No. 1;

(b) And (b) a fusion protein obtained by connecting a tag to the N-terminal and/or C-terminal of the protein (a).

2. A small G protein Ras gene of Asian locusta migratoria is characterized in that the nucleotide sequence is shown by SEQ ID No. 1.

3. A biomaterial which is any one of the following (A1) to (A8):

(A1) A nucleic acid molecule encoding the protein of claim 1;

(A2) An expression cassette comprising the nucleic acid molecule of (A1);

(A3) A recombinant vector comprising the nucleic acid molecule of (A1);

(A4) A recombinant vector comprising the expression cassette of (A2);

(A5) A recombinant microorganism comprising the nucleic acid molecule of (A1);

(A6) A recombinant microorganism comprising the expression cassette of (A2);

(A7) A recombinant microorganism containing the recombinant vector of (A3);

(A8) A recombinant microorganism comprising the recombinant vector of (A4).

4. The biomaterial of claim 3, wherein (A1) said nucleic acid molecule comprises:

(1) Double-stranded RNA consisting of the nucleotide shown in SEQ ID No.1 and the nucleotide shown in a reverse complementary sequence thereof;

(2) A nucleic acid molecule consisting of sense and antisense strands of cDNA complementary to the RNA of (1).

5. Use of asian dolly acridida protein Ras according to claim 1 or biomaterial according to claim 3 or claim 4 as raw material for products and means of any one of the following (a 1) to (a 2):

(a1) A method for regulating and controlling the growth and development of Asian locusts;

(a2) Preparing a product for regulating and controlling the growth and development of the acridid locusts in Asia.

6. Use of asian dolly locusta small G protein Ras according to claim 1 or the biomaterial according to claim 3 or claim 4 as a raw material for products and means of any one of the following (a 3) to (a 4):

(a3) A method for controlling Asiatic locusts;

(a4) Preparing a product for controlling Asian locusts.

7. A method for regulating and controlling the growth and development of Asian locusts is characterized by comprising the following steps:

introducing a substance for regulating and controlling the expression of a small G protein Ras coding gene in the Asian locusts into the Asian locusts so as to regulate and control the growth and development of the Asian locusts;

the substance for regulating and controlling the expression of the coding gene of the small G protein Ras in the Asian small-car locust is dsRNA for regulating and controlling the expression of the coding gene of the small G protein Ras in the Asian small-car locust;

the dsRNA is double-stranded RNA consisting of the nucleotide shown by SEQ ID No.1 in a sequence table and the nucleotide shown by a reverse complementary sequence thereof; the introduction mode is injection.

Images