CN112210524A

CN112210524A - Genetic engineering bacterium for co-production of 3-hydroxypropionic acid and 1, 3-propanediol and construction method and application thereof

Info

Publication number: CN112210524A
Application number: CN202011048794.0A
Authority: CN
Inventors: 齐向辉; 张宇飞; 员君华; 张国艳; 袁娇; 王洋
Original assignee: Jiangsu University
Current assignee: Zhenjiang Baitai Biotechnology Co.,Ltd.
Priority date: 2020-09-29
Filing date: 2020-09-29
Publication date: 2021-01-12
Anticipated expiration: 2040-09-29
Also published as: CN112210524B

Abstract

The invention provides a genetic engineering bacterium for co-producing 3-hydroxypropionic acid and 1, 3-propanediol, a construction method and application thereof, belonging to the technical field of biological engineering; in the present invention, genetic engineering means are used inE.coliOn the basis of BL21, a genetically engineered bacterium for jointly expressing succinic semialdehyde dehydrogenase (GabD 4) and 1, 3-propanediol oxidoreductase (PduQ) is constructed, and the balanced double-enzyme expression quantity is improved by UTR engineering technology; in addition, the constructed genetic engineering bacteria and the lactobacillus reuteri are subjected to multi-bacteria mixing transformation to glycerol, so that the high-efficiency co-production of the 3-hydroxypropionic acid and the 1, 3-propylene glycol is realized.

Description

Genetic engineering bacterium for co-production of 3-hydroxypropionic acid and 1, 3-propanediol and construction method and application thereof

Technical Field

The invention belongs to the technical field of bioengineering, and particularly relates to a genetic engineering bacterium for co-producing 3-hydroxypropionic acid and 1, 3-propanediol, and a construction method and application thereof.

Background

3-hydroxypropionic acid and 1, 3-propanediol are two industrially important platform compounds, widely used as precursor materials of biodegradable polymers and food additives. The production of 3-hydroxypropionic acid and 1, 3-propanediol can be carried out by both chemical synthesis and biological methods. The chemical method mostly uses non-renewable resources as raw materials, the energy consumption of the production process is large, the byproducts of the products are mostly difficult to separate and purify, and the production process generates immeasurable environmental pollution. The biological method for synthesizing the 3-hydroxypropionic acid and/or the 1, 3-propanediol mostly uses glucose and glycerol as substrates, wherein the steps for producing the 3-hydroxypropionic acid and the 1, 3-propanediol by using the glycerol as the substrates are simple, the research is sufficient, the raw materials are cheap, and the problem of excess glycerol can be solved.

At present, NAD is consumed as a coenzyme due to the process for biosynthesis of 3-hydroxypropionic acid⁺Production of NADH, 1, 3-propanediol, in contrast, NADH is converted into NAD⁺The production of 3-hydroxypropionic acid and 1, 3-propanediol can only be carried out separately, otherwise, the coenzyme imbalance in the microorganism can be caused, the reaction is influenced to be continuously carried out, and the final yield is low.

Lactobacillus reuteri has strong glycerol metabolism potential, but 3-hydroxypropionaldehyde with cell and enzyme toxicity is generated in the process of producing 3-hydroxypropionic acid and 1, 3-propanediol by metabolizing glycerol, and the generation rate of the 3-hydroxypropionaldehyde is far greater than that of the 1, 3-propanediol. The rapid accumulation of 3-hydroxypropanal poisons cells and enzyme systems and the reaction is stopped. Therefore, the problem of inhibiting the intermediate metabolite 3-hydroxypropionaldehyde in the process of converting the lactobacillus reuteri into the glycerol is solved, and the final yield of the 3-hydroxypropionic acid and the 1, 3-propanediol can be improved.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides a genetic engineering bacterium for co-producing 3-hydroxypropionic acid and 1, 3-propanediol and a construction method and application thereof. In the present invention, genetic engineering means are used inE. coliOn the basis of BL21, a genetically engineered bacterium for jointly expressing succinic semialdehyde dehydrogenase (GabD 4) and 1, 3-propanediol oxidoreductase (PduQ) is constructed, and the balanced double-enzyme expression level is improved by UTR engineering technology. The invention also carries out multi-bacterium mixing transformation on the constructed genetic engineering bacterium and the lactobacillus reuteri to glycerol, and realizes the high-efficiency co-production of the 3-hydroxypropionic acid and the 1, 3-propylene glycol.

The invention firstly provides a genetic engineering bacterium for efficiently co-producing 3-hydroxypropionic acid and 1, 3-propanediol, which is named asE. coliBL21/pANY-GabD4-PduQ, which is prepared by reacting atE. coliBL21 (purchased from Wuhan vast Ling Biotech Co., Ltd.) was constructed to express succinic semialdehyde dehydrogenase (GabD 4) and 1, 3-propanediol oxidoreductase (PduQ).

Wherein, the nucleotide sequence of the GabD4 is shown as SEQ ID No. 1, and the amino acid sequence is shown as SEQ ID No. 2.

The nucleotide sequence of the PduQ is shown as SEQ ID No. 3, and the amino acid sequence is shown as SEQ ID No. 4.

The invention also provides a construction method of the genetic engineering bacteria, which specifically comprises the following steps:

(1) construction of succinic semialdehyde dehydrogenase (GabD 4) engineering bacteria:

PCR amplification is carried out on succinic semialdehyde dehydrogenase gene (GabD 4) derived from cuprum hookeri (Cupriavidus necator), and the gene is cloned into an expression vector pANY1 by using a seamless cloning technology, and E.coli BL21 is transformed, positive cloning is screened, and sequencing is successfully carried out to obtain the succinic semialdehyde dehydrogenase (GabD 4) engineering bacterium E.coli BL21/pANY-GabD 4.

(2) Construction of 1, 3-propanediol oxidoreductase (PduQ) engineering bacteria:

PCR amplification is carried out on a 1, 3-propanediol oxidoreductase gene (PduQ) from Lactobacillus reuteri, the gene is cloned into an expression vector pANY1 by using a seamless cloning technology, and the 1, 3-propanediol oxidoreductase (PduQ) engineering bacterium E, coli BL21/pANY-PduQ is obtained after E, coli BL21 transformation, positive cloning screening and sequencing success.

(3) Constructing a gene engineering bacterium for jointly expressing GabD4 and PdiQ:

a T7 promoter and a PdiQ gene (PT 7-PdiQ) fragment on the vector pANY-PdiQ are amplified by PCR, cloned into the vector pANY-GabD4 by using a seamless cloning technology, and the recombinant engineering strain E, coli BL21/pANY-GabD 4-PdiQ is obtained by transforming Escherichia coli E, coli BL21, screening positive clone and sequencing;

in the above steps, the steps (1) and (2) are not sequentially performed.

Wherein, in steps (1) and (2), the expression vector pANY1 is constructed according to the method described in A univeral mini-vector and an connecting of PCR products (APP) -based cloning strategy for continuous molecular biological management, (LIU X, LI T, HART D J, et al.).

The PCR reaction parameters in the steps (1) to (3) are all as follows: pre-denaturation at 98 ℃ for 1 min; denaturation at 98 ℃ for 10 s; annealing at 60 ℃ for 10 s; extension at 72 ℃ for 25 s; the extension was stopped at 72 ℃ for 5min, 32 cycles; the obtained PCR product is detected by 1% agarose gel electrophoresis to obtain electrophoresis bands with the sizes of about 2000 bp and 1500 bp, and corresponding DNA bands are cut and purified by a gel purification kit to obtain pure gene fragments.

The invention also provides an application of the engineering bacteria, and the application is the efficient co-production of 3-hydroxypropionic acid and 1, 3-propanediol by metabolizing glycerol.

Compared with the prior art, the invention has the beneficial effects that:

the technology constructs a plurality of genetic engineering bacteria with production ways of producing 3-hydroxypropionic acid or/and 1, 3-propanediol by means of genetic engineering, and optimizes the engineering bacteria for jointly expressing double enzymes by UTR engineering, so that the double enzymes are both expressed better and in balance. The constructed engineering bacteria can be mixed with lactobacillus reuteri, and 3-hydroxypropionic acid and 1, 3-propylene glycol are efficiently co-produced by a multi-bacteria one-step method by taking glycerin which is a biological industrial waste as a substrate.

In the invention, UTR engineering is applied to balance of double enzymes, so that the method has important theoretical and practical significance, and the constructed genetic engineering bacteria E, coli BL21/pANY-GabD4, E, coli BL21/pANY-PduQ and E, coli BL21/pANYV3-GabD4-PduQ for efficiently co-producing 3-hydroxypropionic acid and 1, 3-propylene glycol have huge industrial production potential.

Moreover, the constructed multiple strains of genetic engineering bacteria efficiently express succinic semialdehyde dehydrogenase and 1, 3-propanediol oxidoreductase which can metabolize the intermediate product 3-hydroxypropionaldehyde to generate 3-hydroxypropionic acid and 1, 3-propanediol, so that the single or combined expression of the succinic semialdehyde dehydrogenase and the 1, 3-propanediol oxidoreductase is realized, the succinic semialdehyde dehydrogenase and the 1, 3-propanediol oxidoreductase are mixed and transformed with lactobacillus reuteri, the 3-hydroxypropionaldehyde can be efficiently metabolized, the toxicity of the intermediate product on cells is relieved, and the final yield is greatly improved. Therefore, the multi-strain engineering bacteria successfully constructed by the technology are mixed and transformed with the lactobacillus reuteri, the problem of intermediate product inhibition in the prior art is solved, and the method has wide application prospect and practical significance.

Drawings

FIG. 1 is an electrophoresis diagram of E.coli GabD4 according to the present invention.

FIG. 2 is the electrophoresis chart of E.coli PduQ of the genetic engineering of the invention.

FIG. 3 is the electrophoresis chart of E.coli GabD-PduQ of the genetic engineering of the invention.

FIG. 4 is an electrophoresis diagram of UTR genetically engineered bacteria of the present invention.

FIG. 5 is a diagram showing the productivity of glycerol conversion by two-strain and three-strain mixing.

FIG. 6 shows the results of the yield of UTR engineering bacteria for co-production of 3-hydroxypropionic acid and 1, 3-propanediol.

Detailed Description

The invention will be further described with reference to the following figures and specific examples, but the scope of the invention is not limited thereto.

Example 1: recombinationE.coliConstruction and expression of BL21/pANY-GabD4

(1) Gene encoding succinic semialdehyde dehydrogenase from cuppridinella hookeriGabD4Sequence and vector pANY1 upper groupFor element characteristics, primers were designed using Oligo7.0 software: 5'-atgtatatctccttcttaaagt-3' for PANY-F, 5'-cctccatgggagctcctg-3' for PANY-R, GabD 4-F1: 5'-taactttaagaaggagatatacatatgtaccaagatctggcactgt-3' and GabD 4-R1: 5'-tgcaggagctcccatggaggttacgcttgggtgatgaact-3' are provided.

(2) Amplifying pANY1 vector backbone (not containing 6 XHis tag and ccdB expression cassette) using the PANY-F and PANY-R primer pairs, PCR reaction parameters: pre-denaturation at 98 deg.C for 1 min; denaturation, 10s at 98 ℃; annealing at 55 ℃ for 10 s; extension, 30s at 72 ℃; terminating the extension, 5min at 72 ℃; after 32 cycles, the pANY1 vector backbone was obtained.

Amplification of homology arm containing primers GabD4-F1 and GabD4-R1GabD4Gene fragment, PCR reaction parameters: pre-denaturation at 98 deg.C for 1 min; denaturation, 10s at 98 ℃; annealing at 55 ℃ for 10 s; extension, 30s at 72 ℃; terminating the extension, 5min at 72 ℃; the gabD4 gene was obtained after 32 cycles.

(3) The two gene fragments are recombined and connected according to the method of the Seamless cloning kit, the pANY1 vector skeleton and the gabD4 gene are mixed according to the ratio of 1:3 (mol/mol), 2 XMultiF Seamless Assembly Mix with one volume is added, and the two gene fragments are connected for 30 min at 50 ℃; transformation of recombinant vectors by Heat shock transformationE.coliAdding the ligation product into competent cells in BL21 competent cells, uniformly mixing, placing on ice for 30 min, carrying out heat shock at 42 ℃ for 60 s, cooling on ice for 2 min, adding 900 mu L LB culture medium, incubating at 37 ℃ for 1 h, and coating a kanamycin flat plate containing 50 mu g/mL; extracting plasmids by using a plasmid miniprep kit to verify whether the sizes of the plasmids are correct; finally sending the plasmid to Suzhou Jinweizhi biology company for gene sequencing; successfully screening the result to obtain a recombinant engineering strain namedE.coliBL21/pANY-gabD4, abbreviated as E-coli GabD 4.

(4) Taking a recombinant bacterium which is not induced by IPTG as a blank control, and carrying out the step (3) to obtainE.coliBL21/pANY-gabD4 was inoculated into 50 μ g/mL kanamycin LB medium (yeast powder 5 g/L, tryptone 10 g/L and sodium chloride 10 g/L), and was cultured at 37 ℃ and 200 rpm with shaking to OD₆₀₀Between 0.4 and 0.6, isopropyl-beta-D-thiogalactoside (IPTG) was added to a final concentration of 1 mMThe inducer, 25 ℃, 120rpm low speed overnight induced GabD4 protein expression, using SDS-PAGE (gel concentration 12%) to detect the GabD4 protein expression.

The test result is shown in FIG. 1, and the gene fragment obtained in step (2) is detected by 1% agarose gel electrophoresis, and the detection result is shown in FIG. 1a, wherein the size of the pANY1 skeleton band is about 2000 bp, and the size of the gabD4 gene band is about 1500 bp, which are consistent with the expected size. The plasmid extraction results are shown in FIG. 1b, comparing with the plasmid standard band, the size of plasmid pANY-gabD4 is about 3500 bp, which is the same as the theoretical value.

FIG. 1c shows the expression of E.coli GabD4 protein, and it can be seen from the figure that IPTG-induced engineered bacteria have clear and bright protein bands at 53 kDa, and are consistent with the theoretical value, and it can be seen that GabD4 is correctly and efficiently expressed.

Example 2 construction and expression of recombinant E.coli BL21/pANY-PduQ

(1) According to the gene pduQ sequence of the lactobacillus reuteri coding for 1, 3-propanediol oxidoreductase and the gene element characteristics on the vector pANY1, the primer is designed by utilizing Oligo7.0 software: PduQ-F1: 5'-taactttaagaaggagatatacatatggaaaaatttagtatgccaac-3' and PduQ-R1: 5'-tgcaggagctcccatggaggttaacgaattattgcttcgtaaat-3' are provided.

The pduQ-F1 and PdiQ-R1 primer pair is used for amplifying the pduQ gene segment containing the homologous arm, and the PCR reaction parameters are as follows: PCR reaction parameters: pre-denaturation at 98 deg.C for 1 min; denaturation, 10s at 98 ℃; annealing at 55 ℃ for 10 s; extension, 30s at 72 ℃; terminating the extension, 5min at 72 ℃; the pduQ gene was obtained after 32 cycles.

(3) The two gene segments are recombined and connected according to the method of the seamless cloning kit; transformation of recombinant vectors by Heat shock transformationE.coliIn BL21 competent cells, a recombinant engineering strain is obtained by colony PCR primary verification, plasmid extraction verification and successful screening of gene sequencing results, and is named asE.coliBL21/pANY-pduQ, hereinafter E.coli GabD 4.

(4) Taking a recombinant bacterium which is not induced by IPTG as a blank control, and carrying out the step (3) to obtainE.coliBL21/pANY-PduQ was inoculated into LB medium (yeast powder 5 g/L, tryptone 10 g/L and sodium chloride 10 g/L), and cultured at 37 ℃ and 200 rpm with shaking to OD₆₀₀Adding isopropyl-beta-D-thiogalactoside (IPTG) inducer with the final concentration of 1 mM, inducing PduQ protein expression at 25 ℃ and 120rpm overnight, and detecting the expression of the PduQ protein by SDS-PAGE (12% separation gel).

The test result is shown in FIG. 2, the gene fragment obtained in step (2) is detected by 1% agarose gel electrophoresis of the PCR product, and the detection result is shown in FIG. 2a, wherein the size of the pANY1 skeleton band is about 2000 bp, and the size of the gabD4 gene band is about 1100 bp, which are consistent with the expected size. The plasmid extraction results are shown in FIG. 2b, comparing with the plasmid standard band, the size of plasmid pANY-gabD4 is about 3100 bp, which is the same as the theoretical value.

Fig. 2c shows the expression of PduQ protein in e. coli, and it can be seen from the figure that, compared with the non-induced strain, the IPTG-induced engineered strain has a clear and bright protein band at 40 kDa, and is consistent with the theoretical value, which indicates that PduQ is expressed correctly and efficiently.

Example 3: construction and expression of recombinant E.coli BL21/pANY-GabD4-PduQ

(1) Primers were designed using Oligo7.0 software based on the sequences of the vectors pANY-gabD4 and pANY-pduQ successfully constructed in examples 1 and 2: GabD 4-F2: 5'-cctccatgggagctcctg-3', GabD 4-R2: 5'-ttacgcttgggtgatgaactt-3', PduQ-F2: 5'-agttcatcacccaagcgtaatggccttttgctgg-3' and PduQ-R2: 5'-tgcaggagctcccatggaggttaacgaattattgcttc-3' are provided.

(2) E. coli GabD4 and E. coli PduQ plasmids pANY-gabD4 and pANY-pduQ were extracted by using a small plasmid extraction kit, respectively. Plasmid pANY-gabD4 was used as a template, and pANY-gabD4 was linearized using the primer pairs GabD4-F2 and GabD4-R2, PCR reaction parameters: pre-denaturation at 98 deg.C for 1 min; denaturation, 10s at 98 ℃; annealing at 55 ℃ for 10 s; extension, 30s at 72 ℃; terminating the extension, 5min at 72 ℃; after 32 cycles, the pANY-gabD4 backbone was obtained.

Using plasmid pANY-pduQ as a template, amplifying a gene segment containing a T7 promoter and pduQ-R2 primer pair by using PdiQ-F2 and PdiQ-R2, and carrying out PCR reaction parameters: pre-denaturation at 98 deg.C for 1 min; denaturation, 10s at 98 ℃; annealing at 55 ℃ for 10 s; extension, 30s at 72 ℃; terminating the extension, 5min at 72 ℃; after 32 cycles, the PT7-pduQ gene fragment was obtained.

(3) Recombining and connecting the two gene fragments obtained in the step 1 according to the instruction method of the seamless cloning kit; the recombinant vector is transformed into E.coli BL21 competent cells by a heat shock transformation method, and a recombinant engineering strain is obtained by successfully screening colony PCR preliminary verification, plasmid extraction test and gene sequencing result, is named as E.coli BL21/pANY-gabD4-pduQ and is hereinafter referred to as E.coli GabD 4-pduQ.

(4) Recombinant bacteria E.coli BL21/pANY-gabD4 and E.coli BL21/pANY-pduQ induced by IPTG are used as a control, a recombinant E.coli BL21/pANY-gabD4-pduQ is inoculated in an LB culture medium (5 g/L yeast powder, 10 g/L tryptone and 10 g/L sodium chloride), shaking culture is carried out at 37 ℃ and 200 rpm until OD600 is 0.4-0.6, an IPTG inducer with the final concentration of 1 mM is added, GabD4 and PduQ protein expression is induced at 25 ℃ and 120rpm overnight, and the expression condition of PduQ protein is detected by SDS-PAGE.

The test result is shown in FIG. 3, the gene fragment obtained in step (2) is detected by 1% agarose gel electrophoresis of the PCR product, and the detection result is shown in FIG. 3a, wherein the size of the pANY-gabD4 skeleton band is about 3400 bp, and the size of the PT7-pduQ gene fragment is about 1200 bp, which are all consistent with the expected size. The plasmid extraction results are shown in FIG. 2b, comparing with the plasmid standard band, the size of plasmid pANY-gabD4 is about 4500 bp, which is the same as the theoretical value.

FIG. 3c shows the expression of E.coli GabD4-PduQ protein, and it can be seen from the figure that IPTG induced engineering bacteria have clear and bright protein bands at 53 and 40 kDa compared with E.coli GabD4 and E.coli PduQ strains, and are consistent with GabD4 and PduQ protein, and the combined expression of GabD4 and PduQ is successful.

Example 4: UTR engineering optimization recombination E.coli BL21/pANY-GabD 4-PdiQ protein expression quantity

(1) According to the sequence on the vector pANY-gabD4-pduQ, the 5' -UTR sequence before the gabD4 gene and the pduQ gene and the T7 promoter is: 5'-TTAACTTTAAGAAGGAGATATACAT-3', the front 35 bp sequence of the gabD4 gene N end is: 5'-atgtaccaagatctggcactgtatatcgacggcga-3', in the pANY-gabD4-pduQ vector, the 5 ' -UTR sequence between the T7 promoter and the pduQ gene is not changed, and the 5 ' -UTR principle specified by UTR Designer is observed, and the 5 ' -UTR sequence between the gabD4 gene and the T7 promoter is designed as follows: 5 '-NNNNNNNNNNGAAGGAGATNNNNNN-3', wherein "GAAGGAGAT" is the ribosome binding site of e. 5 '-UTR sequences of the gabD4 gene designed to achieve a desired expression level of GabD4 were designed to have an expression level of 30 to 200 million, and 5' -UTR sequences were designed as shown in Table 1.

TABLE 1 different UTRs and their predicted expression intensities

Gene	5 ' -UTR sequence (5 ' -3 ')^a	Predicted expression level
			gabD4	TTAACTTTAAGAAGGAGATATACAT	149 022.73
gabD4-V1	GTGTCTTTACGAAGGAGATTCTCCA	299 832.45
			gabD4-V2	ACTTAGGGAAGAAGGAGATACAAGC	510 075.53
gabD4-V3	ACATAGAGAAGAAGGAGATACGAGA	1 055 372.24
			gabD4-V4	ACTTAAGGACGAAGGAGATAAAAGA	1 561 120.05
gabD4-V5	ACTTAACGAAGAAGGAGATTAAAGA	1 952 525.26

Wherein the underlined part is the ribosome binding site

(2) In order to introduce 5 designed UTR sequences on a plasmid pANY-gabD4-pduQ, the plasmid is divided into two parts, different 5' -UTR sequences are added on primers respectively, then the two parts are assembled by a seamless cloning technology, a recombinant vector is transformed into an E.coli BL21 competent cell by a heat shock transformation method, and UTR engineering strains are successfully obtained and are named as E.coli V1, E.coli V2, E.coli V3, E.coli V4 and E.coli V5 respectively.

(3) The recombinant E.coli V1-V5 is inoculated in an LB culture medium (5 g/L of yeast powder, 10 g/L of tryptone and 10 g/L of sodium chloride), shaking culture is carried out at 37 ℃ and 200 rpm until OD600 is between 0.4 and 0.6, an IPTG inducer with the final concentration of 1 mM is added, GabD4 and PduQ protein expression are induced at 25 ℃ and 120rpm overnight, and the expression conditions of GabD4 and PduQ protein are detected by SDS-PAGE.

The test result is shown in FIG. 4, the gene fragment obtained in step (2) is detected by 1% agarose gel electrophoresis, and the detection result is shown in FIG. 4a, wherein the size of the gabD4-PT7-pduQ skeleton band is about 3000 bp, and the size of the pANY skeleton gene fragment containing different 5' -UTR sequences is about 1500 bp, which are consistent with the expected size.

FIG. 4b shows the expression of proteins of engineering bacteria containing different 5 '-UTR sequences, and it can be seen from the figure that IPTG-induced engineering bacteria have clear and bright protein bands at 53 and 40 kDa, and as the expression intensity of 5' -UTR before gabD4 gene increases, the protein expression level thereof gradually increases, and the protein PduQ expression level correspondingly decreases.

Example 5: efficient coproduction of 3-hydroxypropionic acid and 1, 3-propylene glycol by one-step multi-bacterium mixed conversion of glycerol

(1) Preparation of resting cells:

lactobacillus reuteri FXZ014 was activated by standing overnight at 37 ℃ in MRS medium (10 g/L tryptone, 10 g/L beef extract, 5 g/L yeast powder, 2 g/L dipotassium hydrogen phosphate, 5 g/L sodium acetate, 2 g/L diammonium hydrogen citrate, 0.1 g/L magnesium sulfate, 0.15 g/L manganese sulfate, 1 g/L Tween 80 and 20 g/L glucose), followed by 1% (v/v) inoculation amount in MRS medium containing 40 mM glycerol and standing culture at 37 ℃ under anaerobic condition for 12 h; then freezing and centrifuging the bacterial liquid for 5min at 8000 rpm and 4 ℃, collecting cells, and removing supernatant; finally, the cells were washed with 0.1M potassium phosphate buffer (pH 7.0) and centrifuged to obtain resting cells of Lactobacillus reuteri FXZ014 for further use.

Respectively carrying out overnight activation on E.coli GabD4, E.coli PduQ, E.coli GabD4-PduQ and UTR engineering optimized strains in Kan-LB culture medium (10 g/L tryptone, 10 g/L sodium chloride, 5 g/L yeast powder and 50 mg/L kanamycin), then carrying out volume expansion culture on the strains at the condition of 37 ℃ and 220 rpm by using 1% (v/v) inoculation amount, carrying out IPTG (isopropyl-beta-thiogalactoside) when OD600 is 0.6-0.8 so that the final concentration of the IPTG is 0.5 mM, and then carrying out overnight induction on protein expression at the condition of 25 ℃ and 160 rpm; then freezing and centrifuging the bacterial liquid for 5min at 8000 rpm and 4 ℃, collecting cells, and removing supernatant; and finally washing with 0.1M potassium phosphate buffer (pH 7.0), and centrifuging to obtain the E.coli GabD4 resting cells, the E.coli PduQ resting cells and the E.coli GabD4-PduQ resting cells for later use.

(2) And (3) converting glycerol by mixing multiple bacteria:

10 g/L of each of two bacteria L, reuteri FXZ 01410 g/L and E, coli GabD4 or E, coli V1-V5 and three bacteria L, reuteri FXZ 01410 g/L, E, coli GabD 45 g/L and E, coli PduQ 5 g/L transformation systems. Separately reacted with 60 g/L substrate glycerol at 30 ℃ and 180 rpm for 6 h, followed by measurement of the residual concentrations of 3-hydroxypropionic acid, 1, 3-propanediol and glycerol under the following conditions: aminex HPX-87H (300X 7.8 mm) column, differential refractometer, flow rate 0.6 mL/min, column temperature 65 ℃.

Test results show that the constructed genetically engineered bacterium and the lactobacillus reuteri FX014 can be mixed to produce 3-hydroxypropionic acid and 1, 3-propanediol by double-bacterium or three-bacterium combination, and as shown in FIG. 5, the double-bacterium combination transformation effect is better. FIG. 6 shows the results of UTR engineering bacteria for co-production of 3-hydroxypropionic acid and 1, 3-propanediol, and it can be seen from the figure that all UTR modified dual-bacteria systems exhibit higher yield, wherein the dual-bacteria system consisting of E.coli V3 performs best, which almost consumes 60 g/L of glycerol, and the final products 3-HP and 1,3-PD yield are as high as 32.37 and 22.64 g/L.

The present invention is not limited to the above-described embodiments, and any obvious improvements, substitutions or modifications can be made by those skilled in the art without departing from the spirit of the present invention.

Sequence listing

<110> university of Jiangsu

<120> genetic engineering bacteria for co-production of 3-hydroxypropionic acid and 1, 3-propanediol and construction method and application thereof

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1428

<212> DNA

<213> Cupriavidus necator

<400> 1

atgtaccaag atctggcact gtatatcgac ggcgaattca ttaaaggcgg tgatcgtcgt 60

gagcaggatg tgattaaccc ggctacccag gaagtgctgg gcaaactgcc gcacgcgtct 120

cgcgcggacc tggaccgtgc cctggctgct gcgcagcgtg cttttgaaac ttggaagaaa 180

acctctcctc tggaacgtgc gcgtattctg cgtcgcgttg gtgaactgac tcgtgaacgc 240

gcaaaggaaa ttggtcgtaa catcacgctg gaccagggca aaccgctggc ggaagctgtg 300

ggcgaagtta tggtttgcgc tgagcacgcg gactggcacg ctgaagagtg ccgtcgtatt 360

tatggccgtg ttatccctcc acgccagcct aacgtacgcc agatcgttgt tcgtgagccg 420

attggtgttt gcgctgcttt cactccgtgg aactttccgt ttaaccaagc gatccgtaaa 480

attgtcagcg cactgggcgc tggttgtacg ctgattctga aaggcccgga agactctcca 540

tccgcggttg tggcactggc tcagctgttc catgatgcag gcctgccgcc gggcgttctg 600

aacatcgtgt ggggcgtacc gtctgaggtg tctacctacc tgatcgaatc tccaatcgtt 660

cgcaagatct ccttcaccgg tagcgtaccg gtgggcaaac agctggccgc gctggcgggt 720

gcacatatga aacgtgtaac catggagctg ggtggtcata gcccggtgct ggtctttgat 780

gatgccgata tcgatccggc tgcggaaatg ctggcgcgtt tcaaactgcg taacgcgggt 840

caggtatgtg tgagcccgac ccgtttttat gtgcaggaaa aagcttacga ccgtttcctg 900

gcccgcttca ccgaagtgat tggcagcatc aaagttggta acggcctgga agacggtacg 960

cagatgggcc cgctggcaca tgaacgtcgt gtcctgtcta tggagcagtt cctggatgat 1020

gcgagccagc gcggtggtaa agtggtagct ggtggttccc gtctgggcga caaaggttac 1080

ttcttcgcac cgactgttgt aactgatctg ccagacgaca gccgtctgat gactgatgaa 1140

ccgttcggtc cggtggctcc tgtgacccgt tttaaagaca ccgcggaagt tctgcgtcgt 1200

gcgaattctc tgccatttgg tctggcgtct tatgttttca ccaactctct gaaaactgcc 1260

accgaggtat ccaatggcct ggaagctggc atggtgaaca ttaaccactt tggcatggct 1320

ctggccgaaa ctcctttcgg tggcatcaag gatagcggta tcggctccga aggtggtcag 1380

gaaaccttcg acggttatct ggttaccaag ttcatcaccc aagcgtaa 1428

<210> 2

<211> 475

<212> PRT

<213> Cupriavidus necator

<400> 2

Met Tyr Gln Asp Leu Ala Leu Tyr Ile Asp Gly Glu Phe Ile Lys Gly

1 5 10 15

Gly Asp Arg Arg Glu Gln Asp Val Ile Asn Pro Ala Thr Gln Glu Val

20 25 30

Leu Gly Lys Leu Pro His Ala Ser Arg Ala Asp Leu Asp Arg Ala Leu

35 40 45

Ala Ala Ala Gln Arg Ala Phe Glu Thr Trp Lys Lys Thr Ser Pro Leu

50 55 60

Glu Arg Ala Arg Ile Leu Arg Arg Val Gly Glu Leu Thr Arg Glu Arg

65 70 75 80

Ala Lys Glu Ile Gly Arg Asn Ile Thr Leu Asp Gln Gly Lys Pro Leu

85 90 95

Ala Glu Ala Val Gly Glu Val Met Val Cys Ala Glu His Ala Asp Trp

100 105 110

His Ala Glu Glu Cys Arg Arg Ile Tyr Gly Arg Val Ile Pro Pro Arg

115 120 125

Gln Pro Asn Val Arg Gln Ile Val Val Arg Glu Pro Ile Gly Val Cys

130 135 140

Ala Ala Phe Thr Pro Trp Asn Phe Pro Phe Asn Gln Ala Ile Arg Lys

145 150 155 160

Ile Val Ser Ala Leu Gly Ala Gly Cys Thr Leu Ile Leu Lys Gly Pro

165 170 175

Glu Asp Ser Pro Ser Ala Val Val Ala Leu Ala Gln Leu Phe His Asp

180 185 190

Ala Gly Leu Pro Pro Gly Val Leu Asn Ile Val Trp Gly Val Pro Ser

195 200 205

Glu Val Ser Thr Tyr Leu Ile Glu Ser Pro Ile Val Arg Lys Ile Ser

210 215 220

Phe Thr Gly Ser Val Pro Val Gly Lys Gln Leu Ala Ala Leu Ala Gly

225 230 235 240

Ala His Met Lys Arg Val Thr Met Glu Leu Gly Gly His Ser Pro Val

245 250 255

Leu Val Phe Asp Asp Ala Asp Ile Asp Pro Ala Ala Glu Met Leu Ala

260 265 270

Arg Phe Lys Leu Arg Asn Ala Gly Gln Val Cys Val Ser Pro Thr Arg

275 280 285

Phe Tyr Val Gln Glu Lys Ala Tyr Asp Arg Phe Leu Ala Arg Phe Thr

290 295 300

Glu Val Ile Gly Ser Ile Lys Val Gly Asn Gly Leu Glu Asp Gly Thr

305 310 315 320

Gln Met Gly Pro Leu Ala His Glu Arg Arg Val Leu Ser Met Glu Gln

325 330 335

Phe Leu Asp Asp Ala Ser Gln Arg Gly Gly Lys Val Val Ala Gly Gly

340 345 350

Ser Arg Leu Gly Asp Lys Gly Tyr Phe Phe Ala Pro Thr Val Val Thr

355 360 365

Asp Leu Pro Asp Asp Ser Arg Leu Met Thr Asp Glu Pro Phe Gly Pro

370 375 380

Val Ala Pro Val Thr Arg Phe Lys Asp Thr Ala Glu Val Leu Arg Arg

385 390 395 400

Ala Asn Ser Leu Pro Phe Gly Leu Ala Ser Tyr Val Phe Thr Asn Ser

405 410 415

Leu Lys Thr Ala Thr Glu Val Ser Asn Gly Leu Glu Ala Gly Met Val

420 425 430

Asn Ile Asn His Phe Gly Met Ala Leu Ala Glu Thr Pro Phe Gly Gly

435 440 445

Ile Lys Asp Ser Gly Ile Gly Ser Glu Gly Gly Gln Glu Thr Phe Asp

450 455 460

Gly Tyr Leu Val Thr Lys Phe Ile Thr Gln Ala

465 470 475

<210> 3

<211> 1122

<212> DNA

<213> Lactobacillus reuteri

<400> 3

atggaaaaat ttagtatgcc aacccgaatt tattcgggaa cagatagttt gaaggaatta 60

gaaacccttc ataatgaacg aattttgtta gtttgtgact cattcttacc tggtagtgac 120

acattaaagg aaattgagag tcatattaac gacagtaata aatgtgaaat tttctctgat 180

gttgtccctg atccaccact agataaaatt atggaagggg ttcaacagtt cttaaagctg 240

aaaccaacaa ttgtaattgg tatcggtggt ggttctgcaa tggacaccgg taagggaatt 300

cgtttcttcg gtgaaaagct tggcaagtgc aaaattaatg aatatattgc aattccaaca 360

accagcggaa ccggttcaga agttactaat actgcggtta tttctgatac taaggaacac 420

cggaagattc cgattcttga agattactta acaccagatt gtgcattgct tgatcctaag 480

ttagtaatga cagcaccaaa gagtgttact gcctactcag gaatggatgt attaactcat 540

gctcttgaat cattggttgc taaggacgct aatttgttta ccgttgcatt atcagaagaa 600

gccattgatg cggtaactaa gtatcttgtt gaatgttatc gtcatggcga taatgtcgat 660

gcacgaaaga tcgttcacga agcatcaaat attgccggaa cagcctttaa cattgctgga 720

ctaggtattt gccactcaat tgcccaccaa ttaggtgcta acttccatgt tcctcatggt 780

ttagcaaaca caatgttatt gccatatgtt gttgcataca atgctgaaca ctgtgaagaa 840

gccttacaca agtttgcaat tgccgctaag aaagccggaa ttgctgcacc tggcgttggt 900

gaccgtttgg ctgttaagcg gctgattgca aagattcgtg aaatggcacg gcaaatgaat 960

tgtccaatga ctctccaagc atttggagtt gaccacgcaa aagcagaagc agctgctgat 1020

acggttgttg ctaatgcgaa gaaggatgca acattcccag gcaatccagt tgttccttca 1080

gatgatgatc tgaagatgat ttacgaagca ataattcgtt aa 1122

<210> 4

<211> 373

<212> PRT

<213> Lactobacillus reuteri

<400> 4

Met Glu Lys Phe Ser Met Pro Thr Arg Ile Tyr Ser Gly Thr Asp Ser

1 5 10 15

Leu Lys Glu Leu Glu Thr Leu His Asn Glu Arg Ile Leu Leu Val Cys

20 25 30

Asp Ser Phe Leu Pro Gly Ser Asp Thr Leu Lys Glu Ile Glu Ser His

35 40 45

Ile Asn Asp Ser Asn Lys Cys Glu Ile Phe Ser Asp Val Val Pro Asp

50 55 60

Pro Pro Leu Asp Lys Ile Met Glu Gly Val Gln Gln Phe Leu Lys Leu

65 70 75 80

Lys Pro Thr Ile Val Ile Gly Ile Gly Gly Gly Ser Ala Met Asp Thr

85 90 95

Gly Lys Gly Ile Arg Phe Phe Gly Glu Lys Leu Gly Lys Cys Lys Ile

100 105 110

Asn Glu Tyr Ile Ala Ile Pro Thr Thr Ser Gly Thr Gly Ser Glu Val

115 120 125

Thr Asn Thr Ala Val Ile Ser Asp Thr Lys Glu His Arg Lys Ile Pro

130 135 140

Ile Leu Glu Asp Tyr Leu Thr Pro Asp Cys Ala Leu Leu Asp Pro Lys

145 150 155 160

Leu Val Met Thr Ala Pro Lys Ser Val Thr Ala Tyr Ser Gly Met Asp

165 170 175

Val Leu Thr His Ala Leu Glu Ser Leu Val Ala Lys Asp Ala Asn Leu

180 185 190

Phe Thr Val Ala Leu Ser Glu Glu Ala Ile Asp Ala Val Thr Lys Tyr

195 200 205

Leu Val Glu Cys Tyr Arg His Gly Asp Asn Val Asp Ala Arg Lys Ile

210 215 220

Val His Glu Ala Ser Asn Ile Ala Gly Thr Ala Phe Asn Ile Ala Gly

225 230 235 240

Leu Gly Ile Cys His Ser Ile Ala His Gln Leu Gly Ala Asn Phe His

245 250 255

Val Pro His Gly Leu Ala Asn Thr Met Leu Leu Pro Tyr Val Val Ala

260 265 270

Tyr Asn Ala Glu His Cys Glu Glu Ala Leu His Lys Phe Ala Ile Ala

275 280 285

Ala Lys Lys Ala Gly Ile Ala Ala Pro Gly Val Gly Asp Arg Leu Ala

290 295 300

Val Lys Arg Leu Ile Ala Lys Ile Arg Glu Met Ala Arg Gln Met Asn

305 310 315 320

Cys Pro Met Thr Leu Gln Ala Phe Gly Val Asp His Ala Lys Ala Glu

325 330 335

Ala Ala Ala Asp Thr Val Val Ala Asn Ala Lys Lys Asp Ala Thr Phe

340 345 350

Pro Gly Asn Pro Val Val Pro Ser Asp Asp Asp Leu Lys Met Ile Tyr

355 360 365

Glu Ala Ile Ile Arg

370

Claims

1. A genetically engineered bacterium for co-production of 3-hydroxypropionic acid and 1, 3-propanediol is characterized in that the engineering bacterium is named asE. coliBL21/pANY-GabD4-PduQ, which is prepared by reacting atE. coliBL21 is obtained by constructing and expressing succinic semialdehyde dehydrogenase and 1, 3-propanediol oxidoreductase.

2. The genetically engineered bacterium for co-production of 3-hydroxypropionic acid and 1, 3-propanediol according to claim 1, wherein the nucleotide sequence of GabD4 is shown as SEQ ID No. 1, and the amino acid sequence is shown as SEQ ID No. 2.

3. The genetically engineered bacterium for co-production of 3-hydroxypropionic acid and 1, 3-propanediol as claimed in claim 1, wherein the nucleotide sequence of PduQ is shown as SEQ ID No. 3, and the amino acid sequence is shown as SEQ ID No. 4.

4. A construction method of a genetic engineering bacterium for co-production of 3-hydroxypropionic acid and 1, 3-propanediol is characterized by comprising the following steps:

(1) construction of succinic semialdehyde dehydrogenase engineering bacteria GabD 4:

PCR amplification is carried out on succinic semialdehyde dehydrogenase genes derived from cuprum hookeri, seamless cloning technology is used for cloning into an expression vector pANY1, and E. coli BL21 is converted, positive cloning is screened, and sequencing is successfully carried out to obtain succinic semialdehyde dehydrogenase engineering bacteria E. coli BL21/pANY-GabD 4;

(2) construction of 1, 3-propanediol oxidoreductase PduQ engineering bacteria:

PCR amplifying 1, 3-propylene glycol oxidoreductase gene from Lactobacillus reuteri, cloning to an expression vector pANY1 by using a seamless cloning technology, and successfully obtaining 1, 3-propylene glycol oxidoreductase engineering bacteria E, coli BL21/pANY-PduQ through E, coli BL21 conversion, positive cloning screening and sequencing;

the T7 promoter and the PduQ gene fragment on the vector pANY-PduQ are amplified by PCR, cloned into the vector pANY-GabD4 by using a seamless cloning technology, and the recombinant engineering strain E, coli BL21/pANY-GabD4-PduQ is obtained by transforming Escherichia coli E, coli BL21, screening positive clone and sequencing successfully;

in the above steps, the steps (1) and (2) are not sequentially performed.

5. The method for constructing the genetically engineered bacteria for co-production of 3-hydroxypropionic acid and 1, 3-propanediol according to claim 4, wherein the PCR parameters in the steps (1) to (3) are all as follows: pre-denaturation at 98 ℃ for 1 min; denaturation at 98 ℃ for 10 s; annealing at 60 ℃ for 10 s; extension at 72 ℃ for 25 s; the extension was terminated at 72 ℃ for 5 min.

6. The method for constructing a genetically engineered bacterium co-producing 3-hydroxypropionic acid and 1, 3-propanediol according to claim 4, wherein the PCR is performed 32 times in steps (1) to (3).

7. The use of the genetically engineered bacteria of claim 1 for the co-production of 3-hydroxypropionic acid and 1, 3-propanediol.

8. The use of claim 7, wherein the genetically engineered bacteria co-produce 3-hydroxypropionic acid and 1, 3-propanediol by metabolizing glycerol.

9. The use of claim 8, wherein the genetically engineered bacteria are mixed with Lactobacillus reuteri to convert glycerol for co-production of 3-hydroxypropionic acid and 1, 3-propanediol.