CN113755419B - Recombinant plasmid for producing hexamethylenediamine and application thereof - Google Patents

Abstract

The invention relates to the field of bioengineering, and particularly discloses a recombinant plasmid for producing hexamethylenediamine and application thereof. The invention constructs homologous or heterologous extension paths through reconstructing paths of alpha-keto acid, fatty acid, leucine and the like of microorganisms, and realizes superposition of "+n" groups of cheap renewable substrates. By integrating the alpha-keto acid pathway and the leucine synthesis pathway, acetyl coenzyme A is used as a superposition monomer, L-lysine is used as a raw material, and the controllable extension of a carbon chain is realized, so that the synthesis of a nylon material monomer hexamethylenediamine can be realized. By combining genome and metabonomics analysis and computer simulation calculation, the high yield of hexamethylenediamine is realized through the directed evolution of a leucine pathway, and the production of amine substances with other chain lengths can be directionally produced. And integrating lysine production strains, finally endowing cells with new anabolic capability, obtaining engineering cells capable of synthesizing polyamide material monomers from the head, and realizing the production of bio-based chemical materials.

Description

Recombinant plasmid for producing hexamethylenediamine and application thereof

Technical Field

The invention relates to the field of bioengineering, in particular to recombinant plasmid for producing hexamethylenediamine and application thereof.

Background

With the increasing demand for pharmaceutical chemicals, material monomers, synthetic polymers, the problems of raw material exhaustion, environmental pollution, high cost and the like caused by the increasing demand are increasing. The advent of microbial-mediated chemical production would provide an opportunity for development from mineral-dependent fuels to sustainable society.

In vivo carbon chain extension is a great potential approach, can be used for synthesizing similar acids and alcohols with different chain lengths, are important constituent substances of biofuels and materials, and have great value in producing bio-based products from renewable and cheap raw materials.

Nylon is one of the most common polyamide materials, whose synthesis of the material monomer hexamethylenediamine (Hexamethylene diamine) is a "neck" technique, and conventional production techniques from hexamethylenenitrile will produce a large amount of greenhouse gases and render the production non-renewable due to the dependence on fossil oils. Therefore, microbial production of chemicals and materials from renewable carbon sources is becoming critical to establishing a sustainable chemical industry. In the last decades, biological and chemical combination methods have been used to produce more and more chemicals, L-lysine being an important commercial amino acid, with a capacity of millions of tons worldwide, produced by microbial fermentation from genetically engineered Corynebacterium glutamicum or recombinant Escherichia coli.

At present, the biosynthesis method based on hexamethylenediamine only teaches Alexander F.Yakunin to use adipic acid as a substrate, and the production of hexamethylenediamine is realized through decarboxylation and ammonia conversion. However, the path is still low in yield and is limited by the ability of the substrate to produce adipic acid. In addition, patent CN112079725a discloses a process for producing hexamethylenediamine: mixing and gasifying ammonia, hydrogen and caprolactam to obtain mixed gas; adding a catalyst into the obtained mixed gas to perform catalytic ammonification reaction and catalytic hydrogenation reaction; then, condensing and separating the material obtained by the reaction to obtain a reaction liquid, and distilling the obtained reaction liquid to obtain hexamethylenediamine. Although the method simplifies the production steps to a certain extent, the process is complicated, more materials are added, and the process has high requirements on temperature.

In conclusion, a high-yield biosynthesis method of hexamethylenediamine is lacking, the cost is reduced, and the production of bio-based chemical materials is realized.

Disclosure of Invention

In order to solve the problems, the invention provides two groups of recombinant plasmids for producing hexamethylenediamine and two genetic engineering bacteria for producing hexamethylenediamine, simultaneously provides two groups of recombinant plasmid compositions and construction methods of corresponding genetic engineering bacteria, and provides the two groups of recombinant plasmids and the application of the genetic engineering bacteria in cell fermentation, cell catalysis and enzyme catalysis for producing hexamethylenediamine.

The invention aims at providing a recombinant plasmid capable of assisting in producing hexamethylenediamine engineering bacteria, wherein the recombinant plasmid is pRLABCD recombinant plasmid, and the recombinant plasmid comprises a raip gene, a leuA gene, a leuB gene, a leuC gene and a leuD gene.

Specifically, the nucleotide sequence of the raip gene is shown in SEQ ID NO: 1.

Specifically, the nucleotide sequences of the leuA gene, the leuB gene, the leuC gene and the leuD gene are shown in SEQ ID NO: 2.

The second purpose of the invention is to provide a preparation method of the pRLABCD recombinant plasmid, which comprises the following specific technical scheme:

the preparation method of the pRLABCD recombinant plasmid comprises the following specific steps:

(1) Designing a primer:

raip-F:cggaattcgatggagcacctggcagact；

raip-R:caactgcagttacagttcgtccttggtatgctcg；

leuABCD-F:cgagactccatatgagccagcaagtcattattttcg；

leuABCD-R:ccgctcgagttaattcataaacgcaggttg；

(2) Synthesizing a target gene raip, and carrying out PCR amplification by taking total DNA of escherichia coli as a template;

(3) And purifying the PCR product, and connecting the PCR product to the pet21a vector to obtain the pRLABCD recombinant plasmid.

The invention also aims to provide a recombinant plasmid composition for producing hexamethylenediamine engineering bacteria, which has the following specific technical scheme:

a recombinant plasmid composition for producing hexamethylenediamine engineering bacteria, which consists of any pRLABCD recombinant plasmid and pKV recombinant plasmid in the technical scheme, wherein the pKV recombinant plasmid comprises kivD gene and vfl gene.

In the construction process of the pKV recombinant plasmid, the designed primers are as follows:

kivD-BamHI-F:cgcggatccgatgtataccgtgggtgactatc，

kivD-SalI-R：acgcgtcgacttagctcttattttgttcggc，

vfl-NdeI-F：cgagactccatatgaataaaccccaatcatgggaagc，

vfl-XhoI-R：ccgctcgagttacgcgacctcggcgaaca。

specifically, the nucleotide sequence of the kivD gene is shown in SEQ ID NO: 3.

Specifically, the nucleotide sequence of the vfl gene is shown in SEQ ID NO: 4.

The fourth purpose of the invention is to protect the genetic engineering bacteria LRKV which can produce hexamethylenediamine and is prepared by the recombinant plasmid composition.

The fifth object of the present invention is to provide a method for preparing hexamethylenediamine using the recombinant plasmid composition according to the above scheme, comprising the following steps:

1) Transferring the recombinant plasmid composition into escherichia coli BL21 to obtain genetic engineering bacteria LRKV;

2) Culturing lysine serving as a fermentation substrate with the genetically engineered bacterium LRKV to obtain hexamethylenediamine.

Specifically, 2g/L alanine and 2g/L glutamine were added as amine donors in step 2).

Specifically, the lysine content is 5g/L.

Specifically, the content of the obtained hexamethylenediamine is 3.62-6.65 g/L.

The invention aims at providing another recombinant plasmid composition for producing hexamethylenediamine engineering bacteria, which has the following specific technical scheme:

a recombinant plasmid composition for producing hexamethylenediamine engineering bacteria, which consists of any pRLABCD recombinant plasmid and pAD recombinant plasmid in the technical scheme, wherein the pAD recombinant plasmid comprises kdcA gene and dat gene.

In the construction process of pAD recombinant plasmid, the designed primers are as follows:

kdcA-BamHI-F:cgcggatccgatgtatacagtaggagactacctattag，

kdcA-SalI-R:gcgcgtcgacttatttgttttgttcggca，

dat-NdeI-F:ccggcctccatatgaaagtattagttaatggaaggc，

dat-XhoI-R:ccgctcgagttaggaaatggacgcagcct。

specifically, the nucleotide sequence of the kdcA gene is shown in SEQ ID NO: shown at 6.

Specifically, the nucleotide sequence of the dat gene is shown in SEQ ID NO: shown at 7.

Specifically, the nucleotide sequence of the pAD recombinant plasmid is shown as SEQ ID NO: shown at 8.

The seventh object of the invention is to provide a method for preparing hexamethylenediamine, which comprises the following specific technical scheme:

a method for preparing hexamethylenediamine by using the recombinant plasmid composition in the scheme, which is characterized by comprising the following specific steps:

(1) Transferring the recombinant plasmid composition into escherichia coli BL21 to obtain genetically engineered bacterium LRAD;

(2) And culturing lysine serving as a fermentation substrate with the genetically engineered bacterium LRAD to obtain hexamethylenediamine.

Specifically, 2g/L alanine and 2g/L glutamine are added as amine donors in step (2).

Specifically, the lysine content is 5g/L to 100g/L.

Specifically, the content of the obtained hexamethylenediamine is 2.18-3.32 g/L.

The invention has the advantages that: the invention adopts metabolic engineering means to optimize the catalysis method so as to increase the cell yield, the directional mutation of enzyme so as to increase the product specificity, the construction of an amine donor regeneration system so as to increase the cell activity, and finally the high-yield strain of hexamethylenediamine is obtained, the LRAD strain can produce 2.18-3.32 g/L of hexamethylenediamine in fermentation, and the LRKV strain can produce 3.62-6.65 g/L of hexamethylenediamine in fermentation.

Drawings

FIG. 1 is a schematic diagram of a pRLABCD recombinant plasmid of the present invention;

FIG. 2 is a schematic diagram of a pKV recombinant plasmid of the invention;

FIG. 3 is a schematic diagram of the pAD recombinant plasmid of the present invention;

FIG. 4 is a diagram of a raip electrophoresis;

FIG. 5 is a drawing of a leuABCD electrophoresis;

FIG. 6 is a kivD electrophoretogram;

FIG. 7 is a vfl electrophoretogram;

FIG. 8 is a graph of kdcA electrophoresis;

FIG. 9 is a plot of dat electrophoresis;

FIG. 10 is a PCR identification map of LRAD strains;

FIG. 11 is an LRAD-LCMS spectrum;

FIG. 12 is a LRKV-LCMS spectrum;

FIG. 13 is a diagram of the primary identification of the fermentation performance of the engineering strain of the present invention;

FIG. 14 is a diagram of a two-stage shake flask fermentation of hexamethylenediamine according to the present invention;

FIG. 15 is a diagram of the reactor fermentation synthesis of hexamethylenediamine according to the present invention.

Detailed Description

The present invention will be further described in detail by the following examples, it being understood that the specific examples described herein are intended to be illustrative only and not to be limiting of the invention, and it will be understood by those skilled in the art that the details and forms of the technical solution of the present invention may be modified or substituted without departing from the structural spirit and scope of the invention, but that the modifications and substitutions fall within the scope of the invention.

The basic technical concept of the invention is as follows: by means of having-NH ₂ Functional group lysine derived alpha-keto acid is used as a substrate for leuABCD catalyzed carbon chain extension, and hexamethylenediamine-producing strains are screened by heterologously expressing different amine-converting decarboxylation combined enzymes. The cell yield is increased by optimizing the catalysis method through the metabolic engineering means, the product specificity is increased by the directional mutation of the enzyme, the cell activity is increased by the construction of an amine donor regeneration system, and finally the high-yield bacterial strain of hexamethylenediamine is obtained.

EXAMPLE 1pRLABCD recombinant plasmid and preparation method thereof

The embodiment provides a recombinant plasmid capable of assisting in producing hexamethylenediamine engineering bacteria, wherein the recombinant plasmid is pRLABCD recombinant plasmid, as shown in figure 1, and the recombinant plasmid comprises a raip gene, a leuA gene, a leuB gene, a leuC gene and a leuD gene, wherein the raip electrophoresis chart is shown in figure 4, and the leuABCD electrophoresis chart is shown in figure 5.

Specifically, the nucleotide sequence of the raip gene is shown in SEQ ID NO: 1.

Specifically, the nucleotide sequences of the leuA gene, the leuB gene, the leuC gene and the leuD gene are shown in SEQ ID NO: 2.

The preparation method of the pRLABCD recombinant plasmid comprises the following specific technical scheme that firstly, a primer is designed:

raip-F:cggaattcgatggagcacctggcagact；

raip-R:caactgcagttacagttcgtccttggtatgctcg；

leuABCD-F:cgagactccatatgagccagcaagtcattattttcg；

leuABCD-R:ccgctcgagttaattcataaacgcaggttg；

then, the raip gene is synthesized by a gene synthesis technology, such as SEQ ID NO:1, carrying out PCR amplification by taking total DNA of escherichia coli as a template; finally, purifying the PCR product, and connecting the PCR product to a pet21a vector to obtain a leuA gene, a leuB gene, a leuC gene and a leuD gene combination, wherein the nucleotide sequence of the combination is shown in SEQ ID NO: 2.

Example 2pKV recombinant plasmid and method for preparing same

The present example provides a pKV recombinant plasmid, as shown in fig. 2, comprising kivD gene (gene fragment sequence is 1647 bp) and vfl gene (gene fragment sequence is 1362 bp), the construction method is similar to that of example 1, and the primers designed are:

kivD-BamHI-F:cgcggatccgatgtataccgtgggtgactatc，

kivD-SalI-R：acgcgtcgacttagctcttattttgttcggc，

vfl-NdeI-F：cgagactccatatgaataaaccccaatcatgggaagc，

vfl-XhoI-R：ccgctcgagttacgcgacctcggcgaaca。

specifically, the nucleotide sequence of the kivD gene is shown in SEQ ID NO: 3.

Specifically, the nucleotide sequence of the vfl gene is shown in SEQ ID NO: 4.

Sequencing shows that the coding sequences of the kivD and vfl genes are correct (the electrophoresis patterns of the kivD and vfl genes are respectively shown in figures 6 and 7), and the kivD and vfl genes are connected to the pet21a vector; obtaining pKV recombinant plasmid.

Example 3pAD recombinant plasmid and method for preparing same

The present example provides a pAD recombinant plasmid as shown in FIG. 3, which comprises the kdcA gene and the dat gene (corresponding electrophoreses are shown in FIGS. 8 and 9). The pAD recombinant plasmid construction method is similar to the construction method in example 1, and specifically, the primers designed are:

kdcA-BamHI-F:cgcggatccgatgtatacagtaggagactacctattag，

kdcA-SalI-R:gcgcgtcgacttatttgttttgttcggca，

dat-NdeI-F:ccggcctccatatgaaagtattagttaatggaaggc，

dat-XhoI-R:ccgctcgagttaggaaatggacgcagcct。

specifically, the nucleotide sequence of the kdcA gene is shown in SEQ ID NO: shown at 6.

Specifically, the nucleotide sequence of the dat gene is shown in SEQ ID NO: shown at 7.

Specifically, the nucleotide sequence of the pAD recombinant plasmid is shown as SEQ ID NO: shown at 8.

EXAMPLE 4 Synthesis of hexamethylenediamine

The present example describes in detail the conditions of the parameters for the preparation of the recombinant plasmids described above, and the recombinant pRLABCD plasmids of example 1 were combined with the recombinant plasmid pKV of example 2 and the recombinant pAD plasmid of example 3 in pairs, respectively, to prepare the hexamethylenediamine-producing genetically engineered bacteria LRKV and LRAD. The experimental methods in which specific experimental conditions are not specified are generally performed according to conventional conditions or according to conditions recommended by manufacturers.

1. Preparing culture medium

The LB medium contains 5g/L yeast powder, 10g/L tryptone and 10g/L NaCl. The solid culture medium is liquid medium, and 1.5% of agar powder is added. To increase the selectivity of the medium, ampicillin (Amp) was used at a concentration of 0.1mg/m and Kara penicillin (Kan) was used at a concentration of 0.1mg/mL.

2. Extraction of E.coli DNA genome by using kit

1-5mL of culture of the escherichia coli DH5 alpha is taken, and the DNA group of the escherichia coli DH5 alpha is extracted according to the specification of a bacterial DNA extraction kit. The kit used was a bacterial genomic DNA extraction kit (6 packs) supplied by century corporation.

3. Construction of recombinant plasmids

1) The target gene is obtained by a PCR method, and the PCR reaction system is as follows:

2) Gel cutting, recovering and purifying target gene

3) The gene of interest was ligated into pet21a vector as follows:

pet21a (from TaKaRa)	0.8μL
		Target gene	2.2μL
Solution 1 (from TaKaRa)	3μL
		Total volume of	6μL

The reaction was carried out at 16℃for 180 minutes, and the whole amount (6. Mu.L) was added to 60. Mu.L of BL21 competent cells.

4) BL21 E.coli LRAD with recombinant plasmid pRLABCD and pAD were selected by plates with ampicillin resistance and plates with kara resistance. BL21 E.coli LRKV with recombinant plasmid pRLABCD and pKV were selected.

5) And (3) carrying out PCR verification on the screened engineering strains, and loading the engineering strains into a sample for electrophoresis detection after the PCR verification is finished, wherein the electrophoresis is shown in fig. 10.

4. Transformation reaction of plasmid and construction of engineering strain

Competent cells were purchased from the Optimago company. The conversion reaction was carried out by heat shock under the reaction condition of 42℃for 90 seconds. After heat-shock 800. Mu.L of LB medium was added, activated at 37℃for 45 minutes and plated on LB plates containing 100. Mu.L/mL of ampicillin and kara for overnight incubation at 37 ℃. And selecting a single colony to obtain the LRAD and LRKV engineering strain.

5. Preliminary fermentation of recombinant bacteria

Single colonies of LRAD and LRKV were selected, and cultured in a tube containing 2mL of LB, 50. Mu.g/mL of ampicillin, and 50. Mu.g/mL of calicheamicin for 8 hours to obtain seed solutions.

Transferring the seed solution into 50mL LB medium with 1% inoculation amount, culturing at 37deg.C and 200rpm, adding 0.5mM IPTG when the OD is 0.4-0.6, adding 2g/L alanine and 2g/L glutamine as amine donor, 0.5mM thiamine pyrophosphate, 1mM NAD ⁺ Fermenting and culturing at 30 deg.C and 180rpm for 72 hr, collecting supernatant, and performing LC-MS detection as shown in FIGS. 11-12, and comparing fermentation performance of two engineering strains as shown in FIG. 13.

6. Double-stage shake flask fermentation synthesis of hexamethylenediamine

Adding 10OD engineering strains LRAD and LRKV into 100mL of optimized catalytic medium, catalyzing at 150RPM and 30 ℃ for 12h, and introducing CO ₂ And (3) entering an anaerobic fermentation stage, taking a sample at the moment as a 0h sample, and selecting the yield within 24h for analysis according to a time yield graph, wherein the catalysis result is as follows. By the end of the fermentation, the yields of hexamethylenediamine reached 2.18 and 3.62g/L, respectively, as shown in FIG. 14.

7. Reactor fermentation synthesis of hexamethylenediamine

Adding 5OD engineering strain LRAD and LRKV seeds into optimized 5L catalytic culture medium, culturing in 10L reactor at 250RPM at 30deg.C for 8 hr, adding lactose to induce exogenous gene expression, introducing CO after 10 hr ₂ Entering anaerobic fermentation stage, taking sample at this time as 0h sample, selecting according to time yield mapThe yield over 24h was analyzed and the catalytic results were as follows. By the end of the fermentation, the yields of hexamethylenediamine reached 3.32 and 6.65g/L, respectively, as shown in FIG. 15.

The foregoing description of the preferred embodiments of the invention is not intended to limit the invention to the precise form disclosed, and any such modifications, equivalents, and alternatives falling within the spirit and scope of the invention are intended to be included within the scope of the invention.

Sequence listing

<110> university of Chongqing

<120> recombinant plasmid for producing hexamethylenediamine and use thereof

<130> 20210831

<160> 8

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1491

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

atgatggagc acctggcaga ctgtctggag gacaaagact acgacacact gctgcaaacc 60

ctggataatg gcctgccgca catcaatacc agccaccacg tggttatcgt gggtgcaggc 120

atggcaggcc tgacagccgc aaagctgtta caagacgcag gccataccgt gaccattctg 180

gaagcaaatg atcgcgtggg cggccgcgtg gaaacctatc gcaacgagaa agagggctgg 240

tacgcagaaa tgggcgccat gcgcattccg agcagccacc gcatcgttca gtggtttgtg 300

aagaagctgg gcgttgagat gaacgagttt gtgatgaccg acgacaacac cttctatctg 360

gtgaatggcg tgcgtgagcg cacctatgtg gtgcaggaga accctgatgt gctgaaatac 420

aatgtgagcg aaagcgaaaa aggcattagt gccgacgacc tgctggaccg tgccttacaa 480

aaggtgaaag aagaggtgga agccaatggc tgcaaagcag ccctggagaa gtatgaccgc 540

tatagcgtta aagaatatct gaaagaagaa ggtggtctga gtccgggtgc cgtgcgtatg 600

atcggcgatc tgctgaacga acagagcctg atgtataccg cactgagcga aatgatctat 660

gatcaggcag atgtgaacga cagcgtgagt tatcacgaag tgaccggtgg tagtgacctg 720

ctgccggaag cctttctgag cgtgctggac gtgccgatcc tgctgaacag caaagtgaaa 780

catatccgcc agagcgataa gggtgtgatc gtgagctatc agacaggcaa cgaaagcagc 840

ctgatggatc tgagcgcaga tattgtgctg gtgaccacca ccgccaaagc cgccctgttt 900

atcgacttcg atcctccgct gagcatcagc aaaatggagg ccctgcgcag cgtgcactat 960

gatagcagca ccaagatcct gctgaccttc cgcgacaagt tctgggaaga tgacggtatc 1020

cgtggcggca aaagcattac agacggtccg agccgctaca tttactaccc gagccacagc 1080

tttcacacca acgaaaccat tggtgtgctg ctggccagtt atacctggag tgacgaaagt 1140

ctgctgttcc tgggtgccag cgatgaggag ctgaaagagc tggccctgcg tgatctggca 1200

aagattcatg gtgaacaggt gtgggacaag tgcaccggcg tgatcgtgaa aaagtggagt 1260

gcagacccgt atagcctggg cgcctttgcc ctgttcacac cgtaccagca tctggagtat 1320

gcccaggaac tgtttagcag tgagggtcgt gtgcactttg ccggtgaaca taccgccttt 1380

ccgcatgcct ggatcgagac cagcatgaaa agtgccatcc gcgccgccac caacattaac 1440

aaagtggcaa atgaagaaag caccatcgag cataccaagg acgaactgta a 1491

<210> 2

<211> 4682

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

atgagccagc aagtcattat tttcgatacc acattgcgcg acggtgaaca ggcgttacag 60

gcaagcttga gtgtgaaaga aaaactgcaa attgcgctgg cccttgagcg tatgggtgtt 120

gacgtgatgg aagtcggttt ccccgtctct tcgccgggcg attttgaatc ggtgcaaacc 180

atcgcccgcc aggttaaaaa cagccgcgta tgtgcgttag ctcgctgcgt ggaaaaagat 240

atcgacgtgg cggccgaatc cctgaaagtc gccgaagcct tccgtattca tacctttatt 300

gccacttcgc caatgcacat cgccaccaag ctgcgcagca cgctggacga ggtgatcgaa 360

cgcgctatct atatggtgaa acgcgcccgt aattacaccg atgatgttga attttcttgc 420

gaagatgccg ggcgtacacc cattgccgat ctggcgcgag tggtcgaagc ggcgattaat 480

gccggtgcca ccaccatcaa cattccggac accgtgggct acaccatgcc gtttgagttc 540

gccggaatca tcagcggcct gtatgaacgc gtgcctaaca tcgacaaagc cattatctcc 600

gtacataccc acgacgattt gggcctggcg gtcggaaact cactggcggc ggtacatgcc 660

ggtgcacgcc aggtggaagg cgcaatgaac gggatcggcg agcgtgccgg aaactgttcc 720

ctggaagaag tcatcatggc gatcaaagtt cgtaaggata ttctcaacgt ccacaccgcc 780

attaatcacc aggagatatg gcgcaccagc cagttagtta gccagatttg taatatgccg 840

atcccggcaa acaaagccat tgttggcagc ggcgcattcg cacactcctc cggtatacac 900

caggatggcg tgctgaaaaa ccgcgaaaac tacgaaatca tgacaccaga atctattggt 960

ctgaaccaaa tccagctgaa tctgacctct cgttcggggc gtgcggcggt gaaacatcgc 1020

atggatgaga tggggtataa agaaagtgaa tataatttag acaatttgta cgatgctttc 1080

ctgaagctgg cggacaaaaa aggtcaggtg tttgattacg atctggaggc gctggccttc 1140

atcggtaagc agcaagaaga gccggagcat ttccgtctgg attacttcag cgtgcagtct 1200

ggctctaacg atatcgccac cgccgccgtc aaactggcct gtggcgaaga agtcaaagca 1260

gaagccgcca acggtaacgg tccggtcgat gccgtctatc aggcaattaa ccgcatcact 1320

gaatataacg tcgaactggt gaaatacagc ctgaccgcca aaggccacgg taaagatgcg 1380

ctggatcagg tggatatcgt cgctaactac aacggtcgcc gcttccacgg cgtcggcctg 1440

gctaccgata ttgtcgagtc atctgccaaa gccatggtgc acgttctgaa caatatctgg 1500

cgtgccgcag aagtcgaaaa agagttgcaa cgcaaagctc aacacaacga aaacaacaag 1560

gaaaccgtgt gatgtcgaag aattaccata ttgccgtatt gccgggggac ggtattggtc 1620

cggaagtgat gacccaggcg ctgaaagtgc tggatgccgt gcgcaaccgc tttgcgatgc 1680

gcatcaccac cagccattac gatgtaggcg gcgcagccat tgataaccac gggcaaccac 1740

tgccgcctgc gacggttgaa ggttgtgagc aagccgatgc cgtgctgttt ggctcggtag 1800

gcggcccgaa gtgggaacat ttaccaccag accagcaacc agaacgcggc gcgctgctgc 1860

ctctgcgtaa gcacttcaaa ttattcagca acctgcgccc ggcaaaactg tatcaggggc 1920

tggaagcatt ctgtccgctg cgtgcagaca ttgccgcaaa cggcttcgac atcctgtgtg 1980

tgcgcgaact gaccggcggc atctatttcg gtcagccaaa aggccgcgaa ggtagcggac 2040

aatatgaaaa agcctttgat accgaggtgt atcaccgttt tgagatcgaa cgtatcgccc 2100

gcatcgcgtt tgaatctgct cgcaagcgtc gccacaaagt gacgtcgatc gataaagcca 2160

acgtgctgca atcctctatt ttatggcggg agatcgttaa cgagatcgcc acggaatacc 2220

cggatgtcga actggcgcat atgtacatcg acaacgccac catgcagctg attaaagatc 2280

catcacagtt tgacgttctg ctgtgctcca acctgtttgg cgacattctg tctgacgagt 2340

gcgcaatgat cactggctcg atggggatgt tgccttccgc cagcctgaac gagcaaggtt 2400

ttggactgta tgaaccggcg ggcggctcgg caccagatat cgcaggcaaa aacatcgcca 2460

acccgattgc acaaatcctt tcgctggcac tgctgctgcg ttacagcctg gatgccgatg 2520

atgcggcttg cgccattgaa cgcgccatta accgcgcatt agaagaaggc attcgcaccg 2580

gggatttagc ccgtggcgct gccgccgtta gtaccgatga aatgggcgat atcattgccc 2640

gctatgtagc agaaggggtg taatcatggc taagacgtta tacgaaaaat tgttcgacgc 2700

tcacgttgtg tacgaagccg aaaacgaaac cccactgtta tatatcgacc gccacctggt 2760

gcatgaagtg acctcaccgc aggcgttcga tggtctgcgc gcccacggtc gcccggtacg 2820

tcagccgggc aaaaccttcg ctaccatgga tcacaacgtc tctacccaga ccaaagacat 2880

taatgcctgc ggtgaaatgg cgcgtatcca gatgcaggaa ctgatcaaaa actgcaaaga 2940

atttggcgtc gaactgtatg acctgaatca cccgtatcag gggatcgtcc acgtaatggg 3000

gccggaacag ggcgtcacct tgccggggat gaccattgtc tgcggcgact cgcataccgc 3060

cacccacggc gcgtttggcg cactggcctt tggtatcggc acttccgaag ttgaacacgt 3120

actggcaacg caaaccctga aacagggccg cgcaaaaacc atgaaaattg aagtccaggg 3180

caaagccgcg ccgggcatta ccgcaaaaga tatcgtgctg gcaattatcg gtaaaaccgg 3240

tagcgcaggc ggcaccgggc atgtggtgga gttttgcggc gaagcaatcc gtgatttaag 3300

catggaaggt cgtatgaccc tgtgcaatat ggcaatcgaa atgggcgcaa aagccggtct 3360

ggttgcaccg gacgaaacca cctttaacta tgtcaaaggc cgtctgcatg cgccgaaagg 3420

caaagatttc gacgacgccg ttgcctactg gaaaaccctg caaaccgacg aaggcgcaac 3480

tttcgatacc gttgtcactc tgcaagcaga agaaatttca ccgcaggtca cctggggcac 3540

caatcccggc caggtgattt ccgtgaacga caatattccc gatccggctt cgtttgccga 3600

tccggttgaa cgcgcgtcgg cagaaaaagc gctggcctat atggggctga aaccgggtat 3660

tccgctgacc gaagtggcta tcgacaaagt gtttatcggt tcctgtacca actcgcgcat 3720

tgaagattta cgcgcggcag cggagatcgc caaagggcga aaagtcgcgc caggcgtgca 3780

ggcactggtg gttcccggct ctggcccggt aaaagcccag gcggaagcgg aaggtctgga 3840

taaaatcttt attgaagccg gttttgaatg gcgcttgcct ggctgctcaa tgtgtctggc 3900

gatgaacaac gaccgtctga atccgggcga acgttgtgcc tccaccagca accgtaactt 3960

tgaaggccgc caggggcgcg gcgggcgcac gcatctggtc agcccggcaa tggctgccgc 4020

tgctgctgtg accggacatt tcgccgacat tcgcaacatt aaataaggag cacaccatgg 4080

cagagaaatt tatcaaacac acaggcctgg tggttccgct ggatgccgcc aatgtcgata 4140

ccgatgcaat catcccgaaa cagtttttgc agaaagtgac ccgtacgggt tttggcgcgc 4200

atctgtttaa cgactggcgt tttctggatg aaaaaggcca acagccaaac ccggacttcg 4260

tgctgaactt cccgcagtat cagggcgctt ccattttgct ggcacgagaa aacttcggct 4320

gtggctcttc gcgtgagcac gcgccctggg cattgaccga ctacggtttt aaagtggtga 4380

ttgcgccgag ttttgctgac atcttctacg gcaatagctt taacaaccag ctgctgccgg 4440

tgaaattaag cgatgcagaa gtggacgaac tgtttgcgct ggtgaaagct aatccgggga 4500

tccatttcga cgtggatctg gaagcgcaag aggtgaaagc gggagagaaa acctatcgct 4560

ttaccatcga tgccttccgc cgccactgca tgatgaacgg tctggacagt attgggctta 4620

ccttgcagca cgacgacgcc attgccgctt atgaagcaaa acaacctgcg tttatgaatt 4680

aa 4682

<210> 3

<211> 1647

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgtataccg tgggtgacta tctgctggac cgcctgcacg agctgggtat cgaagaaatt 60

ttcggcgtgc cgggcgacta taacctgcag ttcttagacc agatcatcag ccgcaaggat 120

atgaaatggg tgggtaacgc caatgaactg aacgcaagtt acatggccga tggctatgca 180

cgtacaaaga aggccgcagc cttcctgacc accttcggcg ttggcgaact gagcgccgtt 240

aacggcctgg ccggcagtta cgccgaaaat ctgccggttg tggaaatcgt gggcagtcct 300

accagtaaag tgcagaacga gggcaaattc gtgcaccata ccctggccga tggtgatttt 360

aaacacttta tgaaaatgca cgaacctgtt acagcagccc gtaccctgct gaccgcagaa 420

aacgccacag tggaaatcga tcgtgtgctg agtgccctgc tgaaggagcg caagccggtt 480

tacatcaacc tgccggttga cgtggcagcc gccaaagccg agaaaccgag cttaccgctg 540

aagaaagaaa acccgaccag caatacaagc gaccaggaga ttctgaataa aattcaggaa 600

agcctgaaaa acgccaaaaa accgatcgtg atcaccggtc acgagatcat cagctttggc 660

ctggagaata cagtgaccca atttattagc aaaaccaaac tgccgatcac caccctgaac 720

ttcggtaaaa gcagtgtgga cgagaccctg cctagttttt taggcattta caatggcaag 780

ctgagcgagc cgaatctgaa agaattcgtg gaaagcgccg attttatcct gatgctgggc 840

gtgaagctga ccgatagcag caccggcgcc tttacccatc atctgaatga gaacaaaatg 900

atcagcctga atattgatga aggtaaaatc tttaatgaaa gtattcagaa cttcgacttc 960

gagagcctga tcagtagtct gctggatctg agcggtatcg aatataaagg caaatacatt 1020

gataaaaaac aagaagattt tgttccgagc aatgccctgc tgagccaaga tcgtttatgg 1080

caggccgtgg aaaacctgac acagagcaat gaaaccatcg tggcagagca gggcaccagc 1140

gcattcggtg caagcagcat cttcctgaag cctaagagcc acttcattgg ccaacctctg 1200

tggggtagca tcggctatac cttcccggca gccctgggca gccagatcgc cgataaggag 1260

agtcgccatc tgctgttcat tggcgatggt agtctgcagc tgacagttca agaactgggc 1320

ctggccattc gtgaaaagat caatccgatc tgcttcatca tcaacaacga cggctatacc 1380

gcagaacgtg agattcacgg cccgaaccag agctataacg atatcccgat gtggaactac 1440

agcaagctgc ctgaaagctt tggcgccaca gaagagcgcg ttgtgagcaa aattgtgcgc 1500

accgaaaatg agttcgtgag cgttatgaaa gaagcccaag ccgacccgaa tcgcatgtac 1560

tggatcgagc tggtgttagc caaagaagat gccccgaaag tgctgaagaa ggccggcaag 1620

ctgttcgccg aacaaaataa gagctaa 1647

<210> 4

<211> 1362

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

atgaataaac cccaatcatg ggaagctagg gcggagacgt acagccttta tggtttcacc 60

gacatgccga gcctgcatca gcgtggcacc gtggtggtta cccatggcga gggcccttac 120

atcgtggatg ttaatggtcg ccgttatctg gatgcgaact ctggcctgtg gaatatggtt 180

gccggtttcg accacaaggg cttgatcgac gcggcaaaag ctcaatatga acgcttcccg 240

ggttaccatg cgtttttcgg ccgcatgagc gatcaaaccg ttatgctgtc tgagaagttg 300

gttgaagtgt ccccgtttga tagcggccgc gtgttttaca ccaattctgg tagcgaggca 360

aacgatacca tggttaaaat gctgtggttc ctgcacgctg cggagggtaa accgcagaaa 420

cgtaagatct tgacgcgttg gaatgcatat cacggcgtta ccgcggtctc ggctagcatg 480

accgggaaac cgtataactc ggtgtttggt ttaccgctgc cgggattcgt gcacctgacg 540

tgcccgcatt attggcgtta cggcgaagag ggtgagacgg aggagcaatt tgtggcccgt 600

ctcgcccgtg aactggaaga aaccatccag cgcgaaggtg cggatacgat cgctggcttc 660

ttcgcagaac cggtgatggg tgcgggcggt gtgatccctc cggcaaaagg ttacttccag 720

gcaattctcc cgatcttacg caaatacgat attccggtca tcagcgacga agttatctgc 780

ggtttcggtc gcaccggaaa cacctggggt tgcgttacgt acgacttcac tccggatgcg 840

atcatctcca gcaagaacct gaccgcgggt ttctttccga tgggcgcggt aatcctgggc 900

ccagaactga gcaaacgttt ggagactgcg atcgaagcga ttgaagaatt tccgcacggc 960

tttaccgcta gcggtcatcc ggtaggttgt gcaattgccc tgaaggcgat tgacgttgtg 1020

atgaatgaag gcttggctga gaacgtgcgt cgtctggcac cgcgttttga agagcgttta 1080

aagcacattg cggagcgtcc caacattggt gagtatagag gcattggttt catgtgggca 1140

ctggaagccg ttaaagacaa agcatccaag accccgtttg acggcaacct gagcgtctcc 1200

gagcggattg cgaacacctg caccgacctg ggtctgattt gccgtccgct gggccagtca 1260

gttgttctgt gtccgccatt tattttgact gaggcccaaa tggatgaaat gtttgacaag 1320

ctggagaagg ctttggacaa ggtgttcgcc gaggtcgcgt aa 1362

<210> 5

<211> 849

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 5

atgaaagtat tagttaatgg aaggctaata ggccgtagcg aagcgtccat cgatttggaa 60

gaccgtggtt atcagttcgg tgatggcatt tatgaagtga ttcgtgttta caagggtgtt 120

ttgtttggtc tgcgtgaaca cgccgaacgt ttcttccgct ctgcagctga gatcggcatt 180

tctctgccat tcagcatcga ggacctggag tgggatctgc aaaagctggt tcaggagaac 240

gcggtttctg agggagcggt gtacatccaa accactcgcg gtgtggcccc tcgtaaacac 300

cagtatgagg cgggtcttga accgcagacc acggcgtata cctttaccgt gaaaaagccg 360

gaacaagagc aggcgtacgg cgtcgcggcg attaccgatg aggacctacg ctggctgcgc 420

tgcgacatca agagcctgaa tctgttgtac aacgtaatga ccaagcaacg cgcatacgag 480

gcgggtgcgt ttgaagccat cctgttgcgt gatggtgtag tgacggaagg cactagcagt 540

aatgtctacg ctgttatcaa cggtacggtc agaacacatc cggcaaatcg tctgattctt 600

aacggcatca cccgtatgaa catcctgggt ctgatcgaaa aaaacggcat taagctggac 660

gaaaccccgg tgagcgagga agagctgaaa caagcggaag agatctttat cagcagcacc 720

accgctgaga ttatcccggt tgttacgctg gacggccaaa gcattggcag cggtaaaccg 780

ggtccggtga ccaagcaact gcaggcagcc ttccaggaga gcattcagca ggctgcgtcc 840

atttcctaa 849

<210> 6

<211> 1584

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 6

atgtatacag taggagacta cctattagat cgcctgcatg agctgggtat cgaagaaatt 60

ttcggcgttc cgggtgacta taacctgcaa tttctggatc agattattag tcgcgaggac 120

atgaagtgga tcggtaatgc aaatgagttg aatgcgtcct acatggcaga cggttacgcc 180

cgtaccaaga aagcagcggc gtttctcacc accttcggtg tcggtgagtt gtcagcgatt 240

aatggtttgg ctggtagcta cgctgagaac ctgccggtgg ttgaaattgt tggcagcccg 300

acgtcgaagg tgcagaatga tggtaaattc gtgcaccaca ccctggccga cggcgatttc 360

aaacacttca tgaaaatgca tcgtgtgctg agccaattgc ttaaggaacg caaaccggtc 420

tatatcaacc tgccggtcga tgtagcggcg gctaaagcgg aaaagccggc tctgtcattg 480

gagaaggagt ctagcacgac gaacaccact gaacaggtta tcctgtctaa gatcgaggaa 540

tccctgaaaa acgcccagaa accggtggtc atcgcgggcc atgaagttat cagcttcggt 600

ctggagaaga ctgttaccca gttcgtgagc gaaaccaaac tgccgatcac cactctgaac 660

ttcggcaagt ctgcggtgga tgagagcttg ccttcgttcc tggggattta taacggtaaa 720

ttgagcgaga tttccctcaa gaacttcgtg gagtcagcgg acttcatcct gatgctgggc 780

gtgaaattga ccgacagctc caccggtgct tttacccatc acctggacga gaacaagatg 840

atcagcctga acattgacga gggcattatc tttaacaaag tggtggagga cttcgatttc 900

cgtgcagttg tttctagctt atctgagctc aagggaatcg agtatgaagg tcagtacatc 960

gataaacagt acgaagaatt tattccgagc tccgcgccac tgtcgcaaga tcgtctgtgg 1020

caggcagtcg aaagcctcac ccaatctaac gaaacgatcg tagcggagca gggcaccagc 1080

ttttttggcg cgagcaccat tttcttaaag agcaattctc gttttatcgg ccagccgctg 1140

tggggtagca tcggctacac ctttccggct gctctgggca gccaaattgc ggataaagag 1200

tcgcgccacc tgctgttcat tggtgatggt agccttcagc tgaccgttca agaattaggt 1260

ctgagcattc gtgaaaagtt aaatccgatt tgctttatca tcaacaacga cggttacacc 1320

gtggaacgtg agatccacgg cccaacgcag tcctacaacg acatcccgat gtggaattat 1380

agcaagctgc cggaaacgtt tggcgcaacc gaagatcgtg ttgtttccaa aattgttaga 1440

actgaaaacg agttcgtctc cgtgatgaag gaggcccaag cggacgttaa tcgtatgtat 1500

tggattgagc tggttttgga gaaagaggac gccccgaagt tgctgaagaa gatgggtaaa 1560

ctatttgccg aacaaaacaa ataa 1584

<210> 7

<211> 6672

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 7

tttgcaaacg ctcgcatgtc accgaaggcg caacagctcc gattttgaaa tttccaacac 60

ggccctcaag ttgaaagttt tccaaaaaaa tttaaacacc tccgcccatg tgaatgtgaa 120

gtgaaattcg ggtttggcat tcggcattgg ttgtgtggag cttttttcta agttttctgg 180

atatttttca aaagtctcaa ggattattta acaatggatt ggagcaacta catgatttga 240

gcttgatatt tataaggtaa gtaagcatat aaaccagttt ttaggtatgc attcaaataa 300

ctgcgatggg aattataaaa tcgaatgagg agaataactg aataatttaa agcgagcaac 360

aaataaacaa cataatatct ttaagaacct agttttcaag tgcagctggc ttaaagagat 420

caaaaattaa atattcatta gctgaatcat gttgggcatg gtgttaaaaa atcgctgtaa 480

aatgcaaaaa tttaaaatgt taatgattac agatggaaat actgataggt gataacttca 540

aaatgtgttg tatgtttgat aagaaagcaa taaagaaaga atgtaaaatt taaacactaa 600

tttaaagttg ttaatttaaa caccacacca aatttttaat attctttaat attactgtaa 660

tactttgtaa actggccaac taagattgcc atcgaatctg gaacaaaaag atggattcta 720

gtcataaatt aacccagcgc agctccgagt actttaagca ctcaatctgc atttcgctta 780

attgatcgca actcagggca attaaagtca gcggggagga attaagtaga tcagattaat 840

tgtttgacgt gtttgtggtt tcattacacg caaagatgcc cgagagttgg gcacatacat 900

atagacggat atatgtacat atgtatgtat gttcttgttc tgtggtgtgg atggtcaagt 960

gtttgctgcc cagtgtgttt gaacatgcca cctgtcgtat gcgtaatgtg ccaacgagct 1020

cttcaagggc tgggtaagca catgtcgttg ccaaacaggt ttcaagtgcc ctggacacac 1080

acttattgaa gcccattgat tggtgaaggg ttttggattt tgcgtggggt actgggattt 1140

aaatcattga atatggttct tatttctggc atatctgcgc aactgaccca ttttgagtgc 1200

tgcgattttc acagatttca aagtgcggcg gcgggatctc cacattttgg gtcaaggaca 1260

cgacgggtta tatagtcgca gatgtcacca accggacata tatccaaatc aaagacgccc 1320

acgccacacg ataacgataa caatagcatc agcgacgagc gcgaaacatg gagcggcaaa 1380

gtggattttt tattatcggt tattggattc gccgtcgatt tagcaaacgt ctggagattt 1440

ccctatttgt gctacaaaaa tggcggtggt aagtagattc ttttagatcc tacactatta 1500

tacagaagaa gatcactatt aaattggata cataaataaa aaaaaggtgt ctaaaggcgc 1560

tctaatgtta ttagactgtt ttatgataat cttaaaacca tatcatacct ttaagatact 1620

ttctttatac ttcatttaag atactttcag ccaatgttgg tgatttttct ccgtgtgaac 1680

tggccaatta ggggataaag acatttcgtc aatcgctctg gctgagtgaa tataatttat 1740

atggctttac acatcattgg gctcgccacg gaacccgtcg ctttcctctt tccgctttct 1800

gaatttccct ttcggccttg ttaacacttt gtcaaagtgg tgcgaagtgc tgtcggtggg 1860

gtggtgcggg aatggttcct ttgtcaaatt gcagggcttt tccccgctaa aagagcggca 1920

aaggacacac agtcgaacac ttacttcgct tcctgatcct catcgccgac gccatcattc 1980

aaaacaattc caaaagttaa gtgcttctgt atgacaacta aatctggcag tcataatcgc 2040

atttggcctg cttaccctct gtcacacttt ttcaccccat tttcttggca atatgtcagc 2100

ctgcttatgt ggagttctct aggcttttgt tgctggagca ctttccacca tcgcattgtg 2160

ggaaattcat gtgcgaaaca tgtctccatg tctccacctc cccattttcc ctctgattgc 2220

ggcactttcc cgctgatgcg tcgtgaatgg atgtggcaca cagggccttc gatatagtta 2280

ttactatttt atgagttttc tttttttcct cctgctaacc cccggtcgct gctgctgctg 2340

ctgctttaaa atcataataa taaattgtta tatttatacg cttcattgcg ttcaatcagt 2400

ggttccagct ccatcttcag cttaagttcc attttatgtc cgttgccagg ggcagcaact 2460

cgctcaggtt gcgattatta ccacagctta gtcggtatta tttattctgt ttcccatttt 2520

cctgctgcct gcaactcgga agtggaagct ttggtggcag caacaggctg tgccatccac 2580

attgttctgg attagggcta aaactcaagg agctgcctgg ctttttttca aactaagatc 2640

gcgcatacgc acttgattgt acttgggtta actatgtatt tcaataaatt atattcttta 2700

ttcttaaatt tgtctaaaag tttagatttc tatttggaac tgaaggactt aatggtgaga 2760

ctttgcacct cagcttaaac cagaatagtc ctacacaaat acatgtaaaa agttattcac 2820

aagcatttaa gtaggcataa ctttcaataa ttcaatagaa tatcaatttg ctagtcaagc 2880

aataaccaac acttggccgt ttaaaattgg acaagttttg accgaattac gggatgggaa 2940

tcgaattaga ggcacatatt tccacagtgt ctccgacgag ctgctggaaa atggtggaaa 3000

tgcacttgaa gcaacggaaa ttatggcttc aacaacagag acgagcgtca tggatgcccc 3060

cgacttcagt ttagacggtt ttgttttaaa tttccgacat aattgacacg acagaaggaa 3120

gcaccgtagc tggcagaccc tttgtagata tactttgcac cgaacgccct tgcatacagt 3180

tgggtgtatg tgggttttgg ccctagacga ctttgtcgtc ggccactttg cctgctaata 3240

gacataatca aatcatagaa catcatcccc tgccactcga caaagtatcg atggcactct 3300

aaccaattgt ctggcccaaa aggggcgtgt aactttggct cggctgcttt tccggaggtg 3360

acggagatga cggcgatgac tgcaggagac agccgagttg ggtttttccc cgcatattcc 3420

gcctctcacc cgccagcttg ctgctgctgt taatgttttt aaaatgtcct tagagtggca 3480

cttgtaaaac aatttgattt tgtgtgccat cgaacatata cataaaggtc gagtgtgtct 3540

atatagaaac tgtgtgtgta attatgtttg tcgatgaggg ggcagcgcga acaatgcaca 3600

gattgtgaca cgggtcagtc tcaatatgtg atggttatga tgcaatcatt atcatagaaa 3660

acatattgat tgtttctaca gctcgaaaat aagttggtta aaaattaccg gatgtaatgc 3720

ggagaatatc tacgattgtg atttggaatc gtagcttcca gttcattgaa atataatcaa 3780

attttattga atccgtatgt tctcttagac tagatttaat ttaaaaatat gtgaaatttt 3840

aggcgctttt cttgtgccct acggcattat gttggtggtc ggtggcattc ctctgttcta 3900

tatggaattg gccctgggtc agcacaatcg taagggtgcc ataacctgct ggggtcgctt 3960

ggtgcccctc ttcaaaggta attactaact actaactaat taatcacaag aacttcatgg 4020

ataagacact ttaacttaca ggaattggat atgccgtggt gctgatagcc ttctatgtgg 4080

acttctatta caatgtgatt attgcctggt cgttgcgttt cttttttgca tccttcacca 4140

actcgctgcc ttggacgtcg tgtaataata tttggaacac accaaattgt agaccggtaa 4200

ctagatacat aaccatttaa tataaatgaa tccttattaa ttctaacttc ttatcagttt 4260

gagagccaaa atgcatctcg tgttccggtt attggtaact atagtgactt gtatgccatg 4320

ggaaatcaaa gcctgctcta caatgagaca tatatgaatg gttcgagctt ggatacgtca 4380

gcggttggcc atgtggaggg ttttcagtcc gcagcatcgg aatattttaa gtgagtttgc 4440

tgaaatattc actttataat tgtagttaaa tttaatttct cgtatagccg ctacattttg 4500

gagctgaacc gcagcgaggg aatccatgac ttgggcgcca tcaaatggga catggcgctg 4560

tgccttctga ttgtctactt aatttgttac ttctccctgt ggaagggtat cagcacttcg 4620

ggcaaggttg tgtggtttac tgccctcttt ccctatgcag tgctactgat tcttctaatc 4680

agagggctca cactgccggg atcttttctg ggcattcagt attatcttac gcccaacttt 4740

agtgccatct ataaggctga ggtctgggtg gatgctgcca cccaggtgtt tttctcattg 4800

ggtccaggat ttggagtgct gctggcctat gcatcctata ataaatacca taacaatgta 4860

tacaagtagg ttgcaagtct tatacttcaa taattcctca cttaaattat tacttaactt 4920

gattacaggg atgctttgtt aaccagtttc attaactcgg ctaccagctt tatagccggc 4980

tttgtgatat tctccgtgct gggttacatg gcccacacac tgggtgtaag aattgaagat 5040

gttgccaccg aaggacctgg tctggttttc gtggtctatc cagctgccat tgccaccatg 5100

ccggccagca ctttctgggc tctaatattc ttcatgatgc tgctaacttt gggcttggat 5160

agttcggtag atataaccta tactctatat cgaccttaaa ctaattgtac aactcttaca 5220

gtttggtggt tcagaggcta taatcacagc tttgagcgac gagtttccca agatcaaaag 5280

aaaccgagag ctgtttgtag ctggactgtt ttccctgtac ttcgtggtcg gtttggccag 5340

ttgcactcag ggtggcttct atttcttcca tctgctggat cgttacgctg ctggctactc 5400

gattttggtg gccgtgttct ttgaggcaat cgccgtgtcc tggatctacg gaaccaatcg 5460

atttagcgag gatatacggg acatgattgg ttttccaccg ggaagatact ggcaggtgtg 5520

ttggcgattt gtggcaccaa ttttcctgct cttcatcacg gtttacgggc tgattggcta 5580

cgagccactg acatatgcgg actatgtgta tcccagttgg gccaatgcgc tgggttggtg 5640

catagctggt tcctcggttg tgatgattcc tgccgtggcg atatttaaac tactttccac 5700

gccgggaagt ctgcgtcagc ggttcacaat tttgaccaca ccatggcgag atcagcaatc 5760

gatggcaatg gtgctgaacg gggtcaccac cgaggtcacc gtggtgcgat taaccgacac 5820

ggagaccgcc aaggaacccg tcgatgtctg agttcgacca gtggcccgtt ttcaaattta 5880

ctacgtttag atttggaaat ttaccaacaa ccgatgttca cgtatgtaga ttgtggcttt 5940

gcaggagagt ttgtgttttt ggttcgacat ttggcgcaga tccgcagaag gatcggcagc 6000

aatttcgcaa acaacgtact taggtttcgg caccaaagaa aaaaaagaag aaaacccaca 6060

agcaaacgca gcttcaaacc ataagttcta agttaagatt agcttgtagt tcgtatggtt 6120

aatgcccagt tatagcatac tcatatatat acgatgctgt gtagataata tcaagtccga 6180

aagtgcgaaa cacttgtcag ttaatctatc gagaactcct tgaaagaatg tttgcatatg 6240

ccaatggaat taacgacacg atcgaggctc aaaattattg ggcacataat ctgtacatac 6300

acaagtcgat gatgtaaaag ctttaaaaca cgttatagga tatctcatgg aactgaagca 6360

aaagctgcca gagttgaact acaaaatccg ctcaaacagc catgagggga ttttgtcata 6420

tgcaaaggtt tgttctagac taattaaccc cgtccaaaaa aaaaaaacta cgattgtttg 6480

cttaaagcag ccattttaag caaacaattg agagttatcg aaataataca ttccctttta 6540

taaactcatt tctgtacata gatgtatgat attttagcat tgttttaaga gtttctttca 6600

cgctgaagcg gaactaacag ccatgagttc tgtttcaatt tgttgaaata aattattata 6660

ctttgagtta ct 6672

<210> 8

<211> 8256

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 8

atgtatacag taggagacta cctattagat cgcctgcatg agctgggtat cgaagaaatt 60

ttcggcgttc cgggtgacta taacctgcaa tttctggatc agattattag tcgcgaggac 120

atgaagtgga tcggtaatgc aaatgagttg aatgcgtcct acatggcaga cggttacgcc 180

cgtaccaaga aagcagcggc gtttctcacc accttcggtg tcggtgagtt gtcagcgatt 240

aatggtttgg ctggtagcta cgctgagaac ctgccggtgg ttgaaattgt tggcagcccg 300

acgtcgaagg tgcagaatga tggtaaattc gtgcaccaca ccctggccga cggcgatttc 360

aaacacttca tgaaaatgca tcgtgtgctg agccaattgc ttaaggaacg caaaccggtc 420

tatatcaacc tgccggtcga tgtagcggcg gctaaagcgg aaaagccggc tctgtcattg 480

gagaaggagt ctagcacgac gaacaccact gaacaggtta tcctgtctaa gatcgaggaa 540

tccctgaaaa acgcccagaa accggtggtc atcgcgggcc atgaagttat cagcttcggt 600

ctggagaaga ctgttaccca gttcgtgagc gaaaccaaac tgccgatcac cactctgaac 660

ttcggcaagt ctgcggtgga tgagagcttg ccttcgttcc tggggattta taacggtaaa 720

ttgagcgaga tttccctcaa gaacttcgtg gagtcagcgg acttcatcct gatgctgggc 780

gtgaaattga ccgacagctc caccggtgct tttacccatc acctggacga gaacaagatg 840

atcagcctga acattgacga gggcattatc tttaacaaag tggtggagga cttcgatttc 900

cgtgcagttg tttctagctt atctgagctc aagggaatcg agtatgaagg tcagtacatc 960

gataaacagt acgaagaatt tattccgagc tccgcgccac tgtcgcaaga tcgtctgtgg 1020

caggcagtcg aaagcctcac ccaatctaac gaaacgatcg tagcggagca gggcaccagc 1080

ttttttggcg cgagcaccat tttcttaaag agcaattctc gttttatcgg ccagccgctg 1140

tggggtagca tcggctacac ctttccggct gctctgggca gccaaattgc ggataaagag 1200

tcgcgccacc tgctgttcat tggtgatggt agccttcagc tgaccgttca agaattaggt 1260

ctgagcattc gtgaaaagtt aaatccgatt tgctttatca tcaacaacga cggttacacc 1320

gtggaacgtg agatccacgg cccaacgcag tcctacaacg acatcccgat gtggaattat 1380

agcaagctgc cggaaacgtt tggcgcaacc gaagatcgtg ttgtttccaa aattgttaga 1440

actgaaaacg agttcgtctc cgtgatgaag gaggcccaag cggacgttaa tcgtatgtat 1500

tggattgagc tggttttgga gaaagaggac gccccgaagt tgctgaagaa gatgggtaaa 1560

ctatttgccg aacaaaacaa ataatttgca aacgctcgca tgtcaccgaa ggcgcaacag 1620

ctccgatttt gaaatttcca acacggccct caagttgaaa gttttccaaa aaaatttaaa 1680

cacctccgcc catgtgaatg tgaagtgaaa ttcgggtttg gcattcggca ttggttgtgt 1740

ggagcttttt tctaagtttt ctggatattt ttcaaaagtc tcaaggatta tttaacaatg 1800

gattggagca actacatgat ttgagcttga tatttataag gtaagtaagc atataaacca 1860

gtttttaggt atgcattcaa ataactgcga tgggaattat aaaatcgaat gaggagaata 1920

actgaataat ttaaagcgag caacaaataa acaacataat atctttaaga acctagtttt 1980

caagtgcagc tggcttaaag agatcaaaaa ttaaatattc attagctgaa tcatgttggg 2040

catggtgtta aaaaatcgct gtaaaatgca aaaatttaaa atgttaatga ttacagatgg 2100

aaatactgat aggtgataac ttcaaaatgt gttgtatgtt tgataagaaa gcaataaaga 2160

aagaatgtaa aatttaaaca ctaatttaaa gttgttaatt taaacaccac accaaatttt 2220

taatattctt taatattact gtaatacttt gtaaactggc caactaagat tgccatcgaa 2280

tctggaacaa aaagatggat tctagtcata aattaaccca gcgcagctcc gagtacttta 2340

agcactcaat ctgcatttcg cttaattgat cgcaactcag ggcaattaaa gtcagcgggg 2400

aggaattaag tagatcagat taattgtttg acgtgtttgt ggtttcatta cacgcaaaga 2460

tgcccgagag ttgggcacat acatatagac ggatatatgt acatatgtat gtatgttctt 2520

gttctgtggt gtggatggtc aagtgtttgc tgcccagtgt gtttgaacat gccacctgtc 2580

gtatgcgtaa tgtgccaacg agctcttcaa gggctgggta agcacatgtc gttgccaaac 2640

aggtttcaag tgccctggac acacacttat tgaagcccat tgattggtga agggttttgg 2700

attttgcgtg gggtactggg atttaaatca ttgaatatgg ttcttatttc tggcatatct 2760

gcgcaactga cccattttga gtgctgcgat tttcacagat ttcaaagtgc ggcggcggga 2820

tctccacatt ttgggtcaag gacacgacgg gttatatagt cgcagatgtc accaaccgga 2880

catatatcca aatcaaagac gcccacgcca cacgataacg ataacaatag catcagcgac 2940

gagcgcgaaa catggagcgg caaagtggat tttttattat cggttattgg attcgccgtc 3000

gatttagcaa acgtctggag atttccctat ttgtgctaca aaaatggcgg tggtaagtag 3060

attcttttag atcctacact attatacaga agaagatcac tattaaattg gatacataaa 3120

taaaaaaaag gtgtctaaag gcgctctaat gttattagac tgttttatga taatcttaaa 3180

accatatcat acctttaaga tactttcttt atacttcatt taagatactt tcagccaatg 3240

ttggtgattt ttctccgtgt gaactggcca attaggggat aaagacattt cgtcaatcgc 3300

tctggctgag tgaatataat ttatatggct ttacacatca ttgggctcgc cacggaaccc 3360

gtcgctttcc tctttccgct ttctgaattt ccctttcggc cttgttaaca ctttgtcaaa 3420

gtggtgcgaa gtgctgtcgg tggggtggtg cgggaatggt tcctttgtca aattgcaggg 3480

cttttccccg ctaaaagagc ggcaaaggac acacagtcga acacttactt cgcttcctga 3540

tcctcatcgc cgacgccatc attcaaaaca attccaaaag ttaagtgctt ctgtatgaca 3600

actaaatctg gcagtcataa tcgcatttgg cctgcttacc ctctgtcaca ctttttcacc 3660

ccattttctt ggcaatatgt cagcctgctt atgtggagtt ctctaggctt ttgttgctgg 3720

agcactttcc accatcgcat tgtgggaaat tcatgtgcga aacatgtctc catgtctcca 3780

cctccccatt ttccctctga ttgcggcact ttcccgctga tgcgtcgtga atggatgtgg 3840

cacacagggc cttcgatata gttattacta ttttatgagt tttctttttt tcctcctgct 3900

aacccccggt cgctgctgct gctgctgctt taaaatcata ataataaatt gttatattta 3960

tacgcttcat tgcgttcaat cagtggttcc agctccatct tcagcttaag ttccatttta 4020

tgtccgttgc caggggcagc aactcgctca ggttgcgatt attaccacag cttagtcggt 4080

attatttatt ctgtttccca ttttcctgct gcctgcaact cggaagtgga agctttggtg 4140

gcagcaacag gctgtgccat ccacattgtt ctggattagg gctaaaactc aaggagctgc 4200

ctggcttttt ttcaaactaa gatcgcgcat acgcacttga ttgtacttgg gttaactatg 4260

tatttcaata aattatattc tttattctta aatttgtcta aaagtttaga tttctatttg 4320

gaactgaagg acttaatggt gagactttgc acctcagctt aaaccagaat agtcctacac 4380

aaatacatgt aaaaagttat tcacaagcat ttaagtaggc ataactttca ataattcaat 4440

agaatatcaa tttgctagtc aagcaataac caacacttgg ccgtttaaaa ttggacaagt 4500

tttgaccgaa ttacgggatg ggaatcgaat tagaggcaca tatttccaca gtgtctccga 4560

cgagctgctg gaaaatggtg gaaatgcact tgaagcaacg gaaattatgg cttcaacaac 4620

agagacgagc gtcatggatg cccccgactt cagtttagac ggttttgttt taaatttccg 4680

acataattga cacgacagaa ggaagcaccg tagctggcag accctttgta gatatacttt 4740

gcaccgaacg cccttgcata cagttgggtg tatgtgggtt ttggccctag acgactttgt 4800

cgtcggccac tttgcctgct aatagacata atcaaatcat agaacatcat cccctgccac 4860

tcgacaaagt atcgatggca ctctaaccaa ttgtctggcc caaaaggggc gtgtaacttt 4920

ggctcggctg cttttccgga ggtgacggag atgacggcga tgactgcagg agacagccga 4980

gttgggtttt tccccgcata ttccgcctct cacccgccag cttgctgctg ctgttaatgt 5040

ttttaaaatg tccttagagt ggcacttgta aaacaatttg attttgtgtg ccatcgaaca 5100

tatacataaa ggtcgagtgt gtctatatag aaactgtgtg tgtaattatg tttgtcgatg 5160

agggggcagc gcgaacaatg cacagattgt gacacgggtc agtctcaata tgtgatggtt 5220

atgatgcaat cattatcata gaaaacatat tgattgtttc tacagctcga aaataagttg 5280

gttaaaaatt accggatgta atgcggagaa tatctacgat tgtgatttgg aatcgtagct 5340

tccagttcat tgaaatataa tcaaatttta ttgaatccgt atgttctctt agactagatt 5400

taatttaaaa atatgtgaaa ttttaggcgc ttttcttgtg ccctacggca ttatgttggt 5460

ggtcggtggc attcctctgt tctatatgga attggccctg ggtcagcaca atcgtaaggg 5520

tgccataacc tgctggggtc gcttggtgcc cctcttcaaa ggtaattact aactactaac 5580

taattaatca caagaacttc atggataaga cactttaact tacaggaatt ggatatgccg 5640

tggtgctgat agccttctat gtggacttct attacaatgt gattattgcc tggtcgttgc 5700

gtttcttttt tgcatccttc accaactcgc tgccttggac gtcgtgtaat aatatttgga 5760

acacaccaaa ttgtagaccg gtaactagat acataaccat ttaatataaa tgaatcctta 5820

ttaattctaa cttcttatca gtttgagagc caaaatgcat ctcgtgttcc ggttattggt 5880

aactatagtg acttgtatgc catgggaaat caaagcctgc tctacaatga gacatatatg 5940

aatggttcga gcttggatac gtcagcggtt ggccatgtgg agggttttca gtccgcagca 6000

tcggaatatt ttaagtgagt ttgctgaaat attcacttta taattgtagt taaatttaat 6060

ttctcgtata gccgctacat tttggagctg aaccgcagcg agggaatcca tgacttgggc 6120

gccatcaaat gggacatggc gctgtgcctt ctgattgtct acttaatttg ttacttctcc 6180

ctgtggaagg gtatcagcac ttcgggcaag gttgtgtggt ttactgccct ctttccctat 6240

gcagtgctac tgattcttct aatcagaggg ctcacactgc cgggatcttt tctgggcatt 6300

cagtattatc ttacgcccaa ctttagtgcc atctataagg ctgaggtctg ggtggatgct 6360

gccacccagg tgtttttctc attgggtcca ggatttggag tgctgctggc ctatgcatcc 6420

tataataaat accataacaa tgtatacaag taggttgcaa gtcttatact tcaataattc 6480

ctcacttaaa ttattactta acttgattac agggatgctt tgttaaccag tttcattaac 6540

tcggctacca gctttatagc cggctttgtg atattctccg tgctgggtta catggcccac 6600

acactgggtg taagaattga agatgttgcc accgaaggac ctggtctggt tttcgtggtc 6660

tatccagctg ccattgccac catgccggcc agcactttct gggctctaat attcttcatg 6720

atgctgctaa ctttgggctt ggatagttcg gtagatataa cctatactct atatcgacct 6780

taaactaatt gtacaactct tacagtttgg tggttcagag gctataatca cagctttgag 6840

cgacgagttt cccaagatca aaagaaaccg agagctgttt gtagctggac tgttttccct 6900

gtacttcgtg gtcggtttgg ccagttgcac tcagggtggc ttctatttct tccatctgct 6960

ggatcgttac gctgctggct actcgatttt ggtggccgtg ttctttgagg caatcgccgt 7020

gtcctggatc tacggaacca atcgatttag cgaggatata cgggacatga ttggttttcc 7080

accgggaaga tactggcagg tgtgttggcg atttgtggca ccaattttcc tgctcttcat 7140

cacggtttac gggctgattg gctacgagcc actgacatat gcggactatg tgtatcccag 7200

ttgggccaat gcgctgggtt ggtgcatagc tggttcctcg gttgtgatga ttcctgccgt 7260

ggcgatattt aaactacttt ccacgccggg aagtctgcgt cagcggttca caattttgac 7320

cacaccatgg cgagatcagc aatcgatggc aatggtgctg aacggggtca ccaccgaggt 7380

caccgtggtg cgattaaccg acacggagac cgccaaggaa cccgtcgatg tctgagttcg 7440

accagtggcc cgttttcaaa tttactacgt ttagatttgg aaatttacca acaaccgatg 7500

ttcacgtatg tagattgtgg ctttgcagga gagtttgtgt ttttggttcg acatttggcg 7560

cagatccgca gaaggatcgg cagcaatttc gcaaacaacg tacttaggtt tcggcaccaa 7620

agaaaaaaaa gaagaaaacc cacaagcaaa cgcagcttca aaccataagt tctaagttaa 7680

gattagcttg tagttcgtat ggttaatgcc cagttatagc atactcatat atatacgatg 7740

ctgtgtagat aatatcaagt ccgaaagtgc gaaacacttg tcagttaatc tatcgagaac 7800

tccttgaaag aatgtttgca tatgccaatg gaattaacga cacgatcgag gctcaaaatt 7860

attgggcaca taatctgtac atacacaagt cgatgatgta aaagctttaa aacacgttat 7920

aggatatctc atggaactga agcaaaagct gccagagttg aactacaaaa tccgctcaaa 7980

cagccatgag gggattttgt catatgcaaa ggtttgttct agactaatta accccgtcca 8040

aaaaaaaaaa actacgattg tttgcttaaa gcagccattt taagcaaaca attgagagtt 8100

atcgaaataa tacattccct tttataaact catttctgta catagatgta tgatatttta 8160

gcattgtttt aagagtttct ttcacgctga agcggaacta acagccatga gttctgtttc 8220

aatttgttga aataaattat tatactttga gttact 8256

Claims (4)

1. A recombinant plasmid composition for producing hexamethylenediamine engineering bacteria, which is characterized by consisting of pRLABCD recombinant plasmid and pKV recombinant plasmid, wherein the pKV recombinant plasmid comprises kivD gene and vfl gene; the nucleotide sequence of the kivD gene is shown as SEQ ID NO:3, the nucleotide sequence of the vfl gene is shown as SEQ ID NO:4 is shown in the figure; the pRLABCD recombinant plasmid comprises a leuA gene, a leuB gene, a leuC gene, a leuD gene and a target gene raip gene; the nucleotide sequence of the target gene raip gene is shown in SEQ ID NO:1, the nucleotide sequence of the combination of the leuA gene, the leuB gene, the leuC gene and the leuD gene is shown as SEQ ID NO: 2.

2. A recombinant plasmid composition for producing hexamethylenediamine engineering bacteria, characterized in that the recombinant plasmid composition consists of a pRLABCD recombinant plasmid and a pAD recombinant plasmid, wherein the pAD recombinant plasmid comprises a kdcA gene and a dat gene; the nucleotide sequence of the kdcA gene is shown in SEQ ID NO:6, the nucleotide sequence of the dat gene is shown as SEQ ID NO: shown in figure 7; the pRLABCD recombinant plasmid comprises a leuA gene, a leuB gene, a leuC gene, a leuD gene and a target gene raip gene; the nucleotide sequence of the target gene raip gene is shown in SEQ ID NO:1, the nucleotide sequence of the combination of the leuA gene, the leuB gene, the leuC gene and the leuD gene is shown as SEQ ID NO: 2.

3. A method for preparing hexamethylenediamine using the recombinant plasmid composition according to claim 2, characterized by comprising the specific steps of:

(1) Transferring the recombinant plasmid composition into escherichia coli BL21 to obtain genetically engineered bacterium LRAD;

(2) And culturing lysine serving as a fermentation substrate with the genetically engineered bacterium LRAD to obtain hexamethylenediamine.

4. A method according to claim 3, wherein the lysine content is 5g/L to 100g/L.