CN112195270A

CN112195270A - Primer probe and kit for specific detection of cocoa plant-derived components

Info

Publication number: CN112195270A
Application number: CN202011289677.3A
Authority: CN
Inventors: 韩建勋; 李捷; 刘浩; 李婷; 张雅莉; 付萌
Original assignee: Beijing Research Institute Of Inspection And Certification Science Co ltd
Current assignee: Beijing Research Institute Of Inspection And Certification Science Co ltd
Priority date: 2020-11-17
Filing date: 2020-11-17
Publication date: 2021-01-08

Abstract

The patent belongs to the technical field of biology, and relates to a primer probe and a kit for specificity detection of cocoa plant derived components. The kit is characterized by comprising a centrifuge tube A (1), a centrifuge tube B (2), a centrifuge tube C (3), eight-row centrifuge tube covers (4), eight-row centrifuge tubes (5) and an instruction book (6). The method is simple and convenient to operate, strong in specificity and high in accuracy, and can be used for quickly detecting the plant-derived components of cocoa.

Description

Primer probe and kit for specific detection of cocoa plant-derived components

Technical Field

The patent belongs to the technical field of biology, relates to a primer probe and a kit for specificity detection of cocoa plant derived components, and particularly relates to a cocoa plant derived component detection kit which is simple and convenient to operate, strong in specificity, high in accuracy, stable and reliable.

Background

Cocoa powder is produced directly from cocoa beans and is often used as an important raw material for chocolate manufacture. Cocoa powder has a unique flavor and is rich in various functional components such as cocoa butter, polyphenols, carbohydrates, proteins, and the like. With the rapid development of cocoa industry, counterfeit or inferior cocoa powder and products thereof are ubiquitous in domestic and foreign markets, which on one hand affects the legitimate interest of consumers and on the other hand impairs the market order to a varying extent.

In order to judge the authenticity of the cocoa powder, a near infrared spectrum technology quick detection method for mixing the carob powder in the cocoa powder is reported to be established, and a near infrared hyperspectral visual detection method for mixing the peanut powder in the cocoa powder is also established in literature. The spectrum technology has simple pretreatment and high detection speed, but needs a large amount of representative experimental samples to construct a statistical model. The modern biotechnology analyzes the sources and characteristics of raw materials and products from the gene level by the characteristics of convenience, rapidness, accuracy and the like, has strong specificity and high sensitivity, and is widely applied to food identification research such as food type identification, origin tracing and the like. At present, a conventional PCR detection method for mixing exogenous plant sources such as soybean meal, sesame meal, peanut shells, chestnut shells and the like into cocoa powder is researched and established. However, the conventional PCR technique requires agarose gel electrophoresis, EB staining and other steps, and the operation is time-consuming and labor-consuming. In recent years, real-time fluorescent PCR is a gold-labeled method for identifying animal and plant derived components in food, and has strong specificity and high sensitivity. At present, specific detection primer probes and kits for cocoa plant derived components in cocoa powder are not available at home and abroad.

Therefore, there is a need in the art for a specific detection primer probe and a kit for cocoa plant-derived components, which are simple in operation, good in specificity and high in sensitivity, and are used for detecting cocoa-derived components in cocoa powder.

Disclosure of Invention

The kit has the beneficial effects that the primer probe and the kit for the specific detection of the cocoa plant derived components with simple operation, good specificity and high sensitivity can be provided, and are used for the detection of the cocoa derived components in the cocoa powder.

In order to realize the functions, the patent relates to a kit for detecting cocoa plant derived components, which is characterized by comprising a centrifuge tube A (1), a centrifuge tube B (2), a centrifuge tube C (3), eight-row centrifuge tube covers (4), eight-row centrifuge tubes (5) and an instruction book (6). Wherein, centrifugingTube A contains positive control lyophilized powder (cacao DNA), and 100 μ L sterile water is added before use for redissolving; the centrifugal tube B contains negative control freeze-dried powder (peanut DNA), and 100 mu L of sterile water is added for redissolving before use; the centrifuge tube C contains 2mL of sterile water; the eight-row centrifugal tube contains detection reagent freeze-dried powder comprising an upstream primer, a downstream primer, a probe, DNA polymerase, dNTP, KCl, Tris-HCl and MgCl₂Before use, 20 μ L of sterile water is added for redissolution.

Drawings

FIG. 1 is a schematic diagram of a kit for detecting plant-derived components of cocoa of the present patent.

Wherein: 1. centrifuging a tube A; 2. centrifuging a tube B; 3. centrifuging a tube C; 4. eight rows of centrifugal tube covers; 5. eight rows of centrifuge tubes; 6. and (6) instructions.

Detailed Description

For a detailed description of the technical content, the achieved objects and effects of the present patent, the following description is taken in conjunction with the accompanying drawings and embodiments:

example one

This example is an evaluation of a kit for detecting a plant-derived component of cocoa by the following test.

The detection main instruments used: micropipettes (10. mu.L, 100. mu.L, 1000. mu.L), fluorescent quantitative PCR instruments, high-speed bench centrifuges, and the like.

DNA extraction main reagents: chloroform, isopropanol, CTAB lysate (20g/L CTAB, 1.4mol/L NaCl, 0.1mol/L Tris, 0.02mol/L Na)₂EDTA), CTAB precipitation solution (5g/L CTAB, 0.04mol/L NaCl).

When the kit is used for the first time,

(1) redissolving positive control freeze-dried powder

Centrifuging the centrifuge tube A at 5000g for 1min before use, adding 100 μ L sterile water for redissolving, storing at 4 deg.C for use, and freezing and storing at-20 deg.C after use.

(2) Redissolving negative control freeze-dried powder

Centrifuging the centrifuge tube B for 1min at 5000g before use, adding 100 μ L sterile water for redissolving, storing at 4 deg.C for use, and freezing and storing at-20 deg.C after use.

A detection step:

(1) sample DNA extraction

Weighing 0.1g of sample powder into a clean 2.0mL centrifuge tube, adding 1.5mL CTAB lysate, inverting at 65 ℃ for 1h, and mixing for several times; 8000rpm for 15min, taking 1mL of supernatant into 1 clean 2.0mL centrifuge tube, adding 700 μ L of chloroform, violently mixing for 30s, 14500rpm for 10min, respectively taking 650 μ L of supernatant into a clean 2.0mL centrifuge tube, adding 1300 μ L of CTAB precipitation, violently mixing for 30s, and standing at room temperature for 1 h; 14500rpm for 10min, discarding the supernatant, adding 350 μ L1.2M NaCl, shaking vigorously for 30s, adding 350 μ L chloroform, mixing vigorously for 30s, 14500rpm for 10 min; respectively taking 320 mu L of supernatant, adding 0.8 times volume of isopropanol, mixing uniformly, then removing the supernatant at minus 20 ℃ for 1h, 14500rpm for 20min, adding 500 mu L of 70% ethanol, mixing uniformly, then 14500rpm for 20min, removing the supernatant, airing to air dry, adding 100 mu L of sterile water for dissolving, and storing at 4 ℃ for later use.

(2) Reaction system configuration and PCR amplification

Real-time fluorescent PCR reaction system:

taking eight-row centrifugal tubes (covered with eight-row centrifugal tube covers) according to the requirement of the sample detection quantity, quickly centrifuging for 15-30s, taking the eight-row centrifugal tube covers in the tubes, respectively adding 20 mu L of sterile water into each tube, slightly shaking for redissolving, respectively taking 5 mu L of positive control, negative control, sample and blank control (sterile water), adding into each centrifugal tube, covering the eight-row centrifugal tube covers, and marking to prevent confusion.

Real-time fluorescent PCR amplification procedure:

95℃ 10min

95℃ 15s

60℃ 1min

40 cycles.

(3) Quality control

Blank control and negative control have no amplification curve or Ct is more than 40; the positive control has an S-shaped amplification curve in the corresponding detection channel;

detecting, and if Ct is less than or equal to 35.0, judging that the detected sample is positive; if Ct is 40.0, judging that the detected sample is negative; if the Ct value is more than 35.0 and less than 40.0, the operation is repeated once. If the Ct value after the secondary amplification is still less than 40.0, judging that the detected sample is positive; if the Ct value after the re-amplification is 40.0, the test sample is judged to be negative.

The foregoing examples are provided for the purpose of illustration only and are not intended to be limiting; it should be noted that various changes and modifications can be made by those skilled in the art without departing from the scope of the patent concept, and these changes and modifications are all within the scope of the patent; therefore, all equivalent changes and modifications made within the scope of the claims of the present patent are intended to be covered by the claims of the present patent.

Claims

1. A primer probe and a kit for specific detection of cocoa plant derived components are characterized by comprising a centrifuge tube A (1), a centrifuge tube B (2), a centrifuge tube C (3), eight-row centrifuge tube covers (4), eight-row centrifuge tubes (5) and an instruction book (6). Wherein, the centrifuge tube A contains positive control lyophilized powder (cacao DNA), and 100 μ L sterile water is added before use for redissolving; the centrifugal tube B contains negative control freeze-dried powder (peanut DNA), and 100 mu L of sterile water is added for redissolving before use; the centrifuge tube C contains 2mL of sterile water; the eight-row centrifugal tube contains detection reagent freeze-dried powder comprising an upstream primer, a downstream primer, a probe, DNA polymerase, dNTP, KCl, Tris-HCl and MgCl₂Before use, 20 μ L of sterile water is added for redissolution.

2. The primers and the probes are arranged in the eight-row centrifuge tube, wherein the upstream primer is a primer consisting of Cocoa-F: CAACTGGTTGTCAAGTTCTGC, the downstream primer is Cocoa-R: AGCTTTCAGTCCTTTGCTT, respectively; the probe is Cocoa-P: GGTCAGTGACATGGACATGC are provided.

3. The probe according to claim 2, wherein a fluorescence quencher TAMRA is linked to the 3 'end and a fluorescence reporter FAM is linked to the 5' end.