CN106636364B - Multiplex PCR kit for rapidly identifying species of arowana and identification method thereof - Google Patents
Multiplex PCR kit for rapidly identifying species of arowana and identification method thereof Download PDFInfo
- Publication number
- CN106636364B CN106636364B CN201611043139.XA CN201611043139A CN106636364B CN 106636364 B CN106636364 B CN 106636364B CN 201611043139 A CN201611043139 A CN 201611043139A CN 106636364 B CN106636364 B CN 106636364B
- Authority
- CN
- China
- Prior art keywords
- species
- rapidly identifying
- arowana
- primers
- positive control
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Immunology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a PCR kit and a method for rapidly identifying the species of a dragon fish, wherein the kit comprises: 1. 3 upstream primers and 3 downstream primers; 2. a positive control; 3. PCR reaction solution; meanwhile, a method for rapidly identifying the species of the arowana is also provided, 1) 3 upstream primers and 3 downstream primers are selected; 2) preparing a genome DNA template; 3) adding the upstream primer and the downstream primer into a positive control DNA template and a genome DNA template prepared from the arowana to be detected respectively to carry out PCR amplification reaction; 4) taking 5 microliter of amplified product, spotting on 2.5% agarose gel, taking 50bp Marker (bands 50, 100, 150, 200, 250, 300, 350, 400, 450 and 500) as standard molecule reference, and carrying out electrophoresis; analyzing the electrophoresis result by using an ultraviolet gel imaging system; 5) and (6) judging the result. The invention not only improves the identification efficiency and saves time, but also saves the identification cost.
Description
Technical Field
The invention belongs to the technical field of molecular biology identification, and particularly relates to a PCR kit for rapidly identifying species of a dragon fish and an identification method thereof.
Background
The dragon fish is characterized in that the shape of the dragon fish is flat and long, the mouth is wide, the beard is long, the trunk part is covered with large scales which are arranged orderly and twinkling, the trend of the dragon fish is very steady and severe when the dragon fish moves, the dragon fish is greatly pursued by ornamental fish lovers, the dragon fish is the ornamental fish with the highest value in the ornamental fish market, and particularly in the Chinese area, the price of some dragon fishes is more than ten million yuan.
Asian dragons (Scleropages formosus), Pearl dragons (Scleropages jardinii) and silver dragons (Osteoglossum bicirrhosum) are currently the most internationally popular dragons. Asian and Pearl floaters belong to the genus Onchiostomus, and silver floaters belong to the genus Onchiostomus. The adult fish forms and ornamental values of the dragonfish are different greatly, so the economic value of the dragonfish is also different greatly, but the larval forms of the dragonfish are very similar and are difficult to identify by a morphological method. Therefore, there is an urgent need to establish a rapid and accurate molecular biological identification method. The fish mitochondrial gene has the advantages of high evolution rate, large species difference, small species difference and large copy number, and each cell contains 100-10000 copies of mitochondrial DNA. Therefore, species can be distinguished by using a shorter mitochondrial gene fragment, and the method is widely used for species identification. According to the mitochondrial gene sequences of the three dragons, specific primers are designed, so that the three dragons can be well identified.
Disclosure of Invention
The scope of the invention is to be determined solely by the appended claims, and not by the statements within this summary to any degree.
The invention aims to provide a multiplex PCR kit for rapidly identifying the species of the dragon fish and a method thereof; the invention is a rapid, accurate and sensitive method for detecting and identifying the Asian dragonfish, the silver dragonfish and the pearl dragonfish by multiplex PCR, and provides a choice for identifying the Asian dragonfish, the silver dragonfish and the pearl dragonfish by a molecular biological method. Not only improves the identification efficiency and saves time, but also saves the identification cost.
In order to achieve the above purpose, the solution of the invention is:
a multiplex PCR kit for rapidly identifying species of the arowana comprises: 1. 3 upstream primers and 3 downstream primers; 2. a positive control; 3. PCR reaction solution;
a multiplex PCR identification method for rapidly identifying the species of the arowana comprises the following steps:
1) selecting 3 upstream primers and 3 downstream primers;
2) taking a positive reference substance and a sample to be detected to respectively prepare genome DNA templates;
3) adding the upstream primer and the downstream primer into a DNA template of a positive control and a genome DNA template prepared from the arowana to be detected respectively to carry out PCR amplification reaction;
4) taking 5 mu L of amplified product to be spotted on 2.5% agarose gel, wherein the amplified product contains 0.1-0.5 mu g/mL ethidium bromide, and carrying out electrophoresis by taking 50bp Marker ( bands 50, 100, 150, 200, 250, 300, 350, 400, 450 and 500) as a standard molecular reference; analyzing the electrophoresis result by using an ultraviolet gel imaging system;
5) judging a result, namely comparing the analysis results of the sample to be detected with the positive control, amplifying 468bp bands of the sample to be detected and the positive control at the same time, and judging the sample to be detected as the Asian longyu; amplifying a 325bp strip of the sample to be detected and the positive control at the same time, and judging the sample as the silver dragon fish; and amplifying a 283bp strip of the sample to be detected and the positive control at the same time, and judging the sample as the pearl longyu.
The primer sequences of the 3 upstream primers and the 3 downstream primers are respectively as follows:
an upstream primer SF-For: 5-CCTATGTACTCACCACCCTAATC-3;
the downstream primer SF-Rev: 5'-CTCCTAGGGTAGTGAGAAGGGC-3', respectively;
an upstream primer OB-For: 5'-CATATTTCTTAAGGTACTCTG-3', respectively;
the downstream primer OB-Rev: 5'-GAATAGCACACCGGTGTAGGAT-3', respectively;
an upstream primer SJ-For: 5'GCCTGCTACTGCAGTTGTAGTT 3';
the downstream primer is SJ-Rev-3: 5'-GAAAGTCAGGATTATGAAGAT-3' are provided.
The PCR reaction conditions were as follows:
pre-denaturation at 95 ℃ for 3min
Denaturation at 95 ℃ for 30s
Annealing at 58 ℃ for 30s
Extending the temperature of 72 ℃ for 30s, and performing 30 cycles of amplification;
final extension 72 ℃ extension 5 min.
The PCR reaction solution comprises the following components:
| composition (I) | Content (wt.) |
| 10 × amplification buffer | 5μl |
| 4 dNTP mixtures | Each 200 mu mol/L |
| Primer and method for producing the same | 0.5. mu. mol/L each |
| DNA template | 2μg |
| Taq DNA polymerase | 2ug |
| MgCl2 | 1.5mmol/L |
| ddH2O | 45μl |
Wherein the amplification buffer is 100mM Tris-HCl (pH 8.8,25 ℃),500mM KCl, 0.8% (v/v)
Nonidet P40
Wherein said 4 dNTP mixtures refer to: adenine deoxynucleotide triphosphate dATP, deoxythymidine triphosphate dTTP, deoxyguanosine triphosphate trisodium dGTP, deoxycytidine triphosphate dCTP. (BBI)
Wherein the positive control is: mitochondrial DNA plasmid standards of 3 species of longfish (Asian longfish, silver longfish and pearl longfish).
The preparation method of the DNA template of the arowana to be detected comprises the following steps:
a. adding 400 μ l lysate into the tissue of the dragon fish, mixing, and placing in water bath at 37 ℃ for 1 h;
b. then adding 200 mul of 5mol/L sodium chloride solution, mixing uniformly, and centrifuging at 13000rpm for 15 min;
c. extracting the supernatant with phenol for 2 times and chloroform for 1 time;
d. adding anhydrous ethanol with twice volume, and 1/10 volume, 3mol/L potassium acetate with pH of 8.0, and storing at-20 deg.C for 1 h;
e. centrifuging the solution at 13000rpm for 15min, removing supernatant, and washing the precipitate with 70% ethanol for 2 times;
f. after drying at room temperature, the resulting solution was dissolved in 50. mu.l of TE solution (Shanghai Solibao Biotech Co., Ltd.) and stored at 4 ℃ for further use.
The formula of the lysis solution is as follows: 40mmol/L Tris-acetate, 20mmol/L sodium acetate, 1mmol/L EDTA, 1% Sodium Dodecyl Sulfate (SDS), pH 7.8.
The invention has the beneficial effects that: the invention establishes a method for detecting and identifying 3 types of snakes by using a multiple PCR method of competitive annealing of a plurality of primers, and no false positive result is found through actual sample detection test, which indicates that the method is feasible. The method adopts PCR amplification technology, so that the sensitivity for detecting 3 kinds of snakes is greatly improved. The method can identify 3 kinds of the dragonfish by one-time PCR, and does not need to carry out confirmation identification on each kind of the dragonfish, thereby saving the experimental time and accelerating the detection speed. In summary, the following steps: the method for detecting and identifying the arowana has the advantages of high sensitivity, strong specificity, simple and convenient operation and the like, has higher repeatability compared with the traditional morphological identification method, is quicker and simpler than the common PCR, and can realize the quick, accurate and specific detection and analysis of 3 arowana.
Drawings
FIG. 1 is an electrophoretogram of multiple PCR amplification products of a positive control of a plasmid standard and a dragon fish sample, wherein:
1: a silver dragon fish sample (OB); 2: pearl fish Sample (SJ); 3: an asian dragon fish Sample (SF); 4: a positive control of the silver dragon fish; 5: pearl dragonfish positive control; 6: an Asian dragonfish positive control; m: 50bp DNA Ladder Marker.
Detailed Description
The invention is explained in more detail below with reference to the figures and the examples, without thereby limiting the invention to the described examples.
Example 1
Materials and methods
1. Material
1.1 providing Asia dragonfish, silver dragonfish and pearl dragonfish samples by farmers;
1.2 Main Instrument reagents
2. Method of producing a composite material
2.1 mitochondrial DNA extraction
1. Mitochondrial DNA is extracted from the tissue, 100mg of sample is weighed, 400 mul of lysate is added to homogenate until no obvious tissue block is seen;
2. placing in water bath at 37 deg.C for 1 h;
3. adding 200 μ L of 5mol/L sodium chloride solution, mixing uniformly, and centrifuging at 13000rpm for 15 min;
4. extracting the supernatant with phenol for 2 times and chloroform for 1 time;
5. adding twice volume of anhydrous ethanol, 1/10 volume of 3mol/L potassium acetate with pH of 8.0, storing at-20 deg.C for 1h,
6.13000rpm for 15min, discarding the supernatant, washing the precipitate with 70% ethanol for 2 times; 7. after drying at room temperature, the resulting solution was dissolved in 50. mu.l of TE solution (Shanghai Solibao Biotech Co., Ltd.) and stored at 4 ℃ for further use.
2.2 PCR reaction
PCR amplification System:
and (3) PCR reaction conditions:
| Cycle | Cycle Point |
| Hold@95℃，3min | |
| Cycling(30repeats) | Step 1@95℃，hold 30s |
| Step 2@58℃，hold 30s | |
| Step 3@72℃，hold 30s | |
| Hold@72℃，5min |
detection by 2.32.5% agarose gel electrophoresis.
mu.L of the amplified product was spotted on 2.5% agarose gel (containing 0.5. mu.g/mL ethidium bromide) and subjected to electrophoresis using 50bpMarker as a standard molecular reference. Voltage 100v runs for 10 minutes followed by 50v for two hours. The electrophoresis results were analyzed with a UV gel imaging system.
3. Results of the experiment
The annealing temperature was set at 55 ℃ and the specific primers were amplified, and the results of the electrophoresis were found to be: 1: a silver dragon fish sample (OB); 2: pearl fish Sample (SJ); 3: an asian dragon fish Sample (SF); 4: a positive control of the silver dragon fish; 5: pearl dragonfish positive control; 6: an Asian dragonfish positive control; m: 50bp Marker.
Claims (8)
1. A multiplex PCR kit for rapidly identifying species of the arowana comprises: (1) 3 upstream primers and 3 downstream primers; (2) a positive control; (3) and PCR reaction solution; wherein, the sequences of the 3 upstream primers and the 3 downstream primers are respectively as follows:
an upstream primer SF-For: 5-CCTATGTACTCACCACCCTAATC-3;
the downstream primer SF-Rev: 5'-CTCCTAGGGTAGTGAGAAGGGC-3', respectively;
an upstream primer OB-For: 5'-CATATTTCTTAAGGTACTCTG-3', respectively;
the downstream primer OB-Rev: 5'-GAATAGCACACCGGTGTAGGAT-3', respectively;
an upstream primer SJ-For: 5'GCCTGCTACTGCAGTTGTAGTT 3';
the downstream primer is SJ-Rev-3: 5'-GAAAGTCAGGATTATGAAGAT-3', respectively;
wherein the PCR reaction solution comprises the following components:
2. the multiplex PCR kit for rapidly identifying the species of the dragon fish according to claim 1, wherein the amplification buffer is 100mM Tris-HCl at pH 8.8 at 25 ℃; 500mM KCl, 0.8% by volume Nonidet P40.
3. The multiplex PCR kit for rapidly identifying the species of the dragon fish as claimed in claim 1, wherein the 4 dNTP mixtures are: adenine deoxynucleotide triphosphate dATP, deoxythymidine triphosphate dTTP, deoxyguanosine triphosphate trisodium dGTP, deoxycytidine triphosphate dCTP.
4. The multiplex PCR kit for rapidly identifying the species of the dragon fish as claimed in claim 1, wherein the positive control is: mitochondrial DNA plasmid standards of 3 kinds of dragonfish, namely Asia dragonfish, silver dragonfish and pearl dragonfish.
5. An identification method for rapidly identifying the species of the arowana, which is characterized by comprising the multiplex PCR kit for rapidly identifying the species of the arowana as claimed in any one of claims 1 to 4, wherein the method comprises the following steps:
1) selecting 3 upstream primers and 3 downstream primers;
2) respectively preparing genome DNA templates from a positive control and a sample of the longfish to be detected;
3) adding the upstream primer and the downstream primer into a positive control DNA template and a genome DNA template prepared from the arowana to be detected respectively to carry out PCR amplification reaction;
4) taking 5 mu L of amplified product to sample in 2.5% agarose gel, wherein the sample contains 0.1-0.5 mu g/mL ethidium bromide, and carrying out electrophoresis by taking 50bp Marker as a standard molecular reference; analyzing the electrophoresis result by using an ultraviolet gel imaging system;
5) and (5) judging a result, comparing the sample to be detected with the positive control electrophoresis result, and determining the species of the dragon fish.
6. The method according to claim 5, wherein the PCR amplification reaction is performed under the following conditions:
7. the method for rapidly identifying the species of the dragon fish as claimed in claim 5, wherein the preparation method of the DNA template of the dragon fish to be detected comprises the following steps:
a. adding 400 μ l lysate into the tissue of the dragon fish, mixing, and placing in water bath at 37 ℃ for 1 h;
b. then adding 200 mul of 5mol/L sodium chloride solution, mixing uniformly, and centrifuging at 13000rpm for 15 min;
c. extracting the supernatant with phenol for 2 times and chloroform for 1 time;
d. adding anhydrous ethanol with twice volume, and 1/10 volume, 3mol/L potassium acetate with pH of 8.0, and storing at-20 deg.C for 1 h;
e. centrifuging the solution, discarding supernatant under the centrifugation condition of 13000rpm for 15min, and washing precipitate with 70% ethanol for 2 times;
f. after drying at room temperature, the mixture was dissolved in 50. mu.l of TE solution and stored at 4 ℃ for further use.
8. The method of claim 7, wherein the formula of the lysis solution is as follows: 40mmol/L Tris-acetic acid, 20mmol/L sodium acetate, 1mmol/L EDTA, 1% sodium dodecyl sulfate, pH 7.8.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611043139.XA CN106636364B (en) | 2016-11-11 | 2016-11-11 | Multiplex PCR kit for rapidly identifying species of arowana and identification method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201611043139.XA CN106636364B (en) | 2016-11-11 | 2016-11-11 | Multiplex PCR kit for rapidly identifying species of arowana and identification method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106636364A CN106636364A (en) | 2017-05-10 |
| CN106636364B true CN106636364B (en) | 2020-04-10 |
Family
ID=58811383
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201611043139.XA Expired - Fee Related CN106636364B (en) | 2016-11-11 | 2016-11-11 | Multiplex PCR kit for rapidly identifying species of arowana and identification method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106636364B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113005203A (en) * | 2021-03-27 | 2021-06-22 | 中国水产科学研究院珠江水产研究所 | Microsatellite marking method for identifying paternity of scleropages formosus |
| CN114164282B (en) * | 2021-11-29 | 2023-05-09 | 中国水产科学研究院珠江水产研究所 | Primer for identifying genetic sex of hynchus bifidus and PCR identification method |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286631B (en) * | 2011-09-14 | 2013-10-09 | 厦门出入境检验检疫局检验检疫技术中心 | Method for multiplex polymerase chain reaction (PCR) fast detection and five-Listeria-bacterium identification |
-
2016
- 2016-11-11 CN CN201611043139.XA patent/CN106636364B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN106636364A (en) | 2017-05-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111471756B (en) | Specific DNA fragment SSM1 for sturgeon gender identification and application | |
| CN114686597A (en) | SNP molecular marker for sex identification of salangid and application thereof | |
| CN113502333A (en) | Molecular marker C42257 for rapidly identifying genetic sex of penaeus japonicus and application thereof | |
| CN106636364B (en) | Multiplex PCR kit for rapidly identifying species of arowana and identification method thereof | |
| CN113637765A (en) | Molecular marker for identifying genetic sex of micropterus salmoides and application | |
| CN100415884C (en) | DNA molecular marking method for researching fish genetic relation | |
| CN107988385B (en) | Method for detecting marker of PLAG1 gene Indel of beef cattle and special kit thereof | |
| CN107254542B (en) | Watermelon flesh color character major gene locus and InDel molecular marker and application thereof | |
| CN111808994A (en) | RPA primer and detection method for detecting banana streak virus GF isolate | |
| CN114959056B (en) | SSR (simple sequence repeat) marker for identifying female procambarus clarkia and application thereof | |
| CN106834521A (en) | A kind of SNP marker of Odontobulis mpotamophila growth traits related gene and its amplimer and application | |
| CN111534603A (en) | Method for identifying aedes albopictus by using fluorescent RPA | |
| CN107988334B (en) | Method for SNP typing by direct PCR of oral swab | |
| CN112430675B (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288474.1-322717 | |
| CN113502334B (en) | Molecular marker C27449 for rapidly identifying genetic sex of Penaeus japonicus and application thereof | |
| CN104789650B (en) | Molecular detection method for brassica cultivar cytoplasm | |
| CN108070663A (en) | Differentiate the molecular labeling primer and method of the penaeus penicillatus young and During Larvae Rearing of Penaeus Merguiensis De Man | |
| CN104099423A (en) | Molecular marker for discriminating different ecotype populations of coilia ectenes | |
| CN109022610B (en) | Molecular specificity marker primer of anoectochilus formosanus and identification method thereof | |
| CN112410441A (en) | Method for identifying anti-cysticercosis trait of bee colony by using SNP marker KZ 288479.1-95621 | |
| CN106636427B (en) | Microsatellite marker primer and method for identifying inbred families of exopalaemon carinicauda | |
| CN106701927B (en) | Method and kit for rapidly detecting chrysophyceae through loop-mediated isothermal amplification | |
| CN108504762B (en) | Molecular marker primer and method for identifying big almond, Siberian apricot and fresh apricot | |
| CN108624587A (en) | The RACE methods of efficient quick obtaining Plant RNA viral end sequence | |
| AU2021103036A4 (en) | A method for detecting recessive albino mutation of Ictalures punctatus caused by gene HPS4 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| CB02 | Change of applicant information | ||
| CB02 | Change of applicant information |
Address after: 361000 2165, Jian Gang Road, Haicang District, Fujian, Xiamen Applicant after: Xiamen Customs Technical Center Address before: 361000 2165, Jian Gang Road, Haicang District, Fujian, Xiamen Applicant before: THE INSPECTION AND QUARANTINE TECHNOLOGY CENTER, XIAMEN ENTRY-EXIT INSPECTION AND QUARANTINE BUREAU |
|
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20200410 Termination date: 20201111 |