CN106636427B - Microsatellite marker primer and method for identifying inbred families of exopalaemon carinicauda - Google Patents

Abstract

The invention discloses a microsatellite marker primer and a method for identifying an inbred family of palaemon carinicauda, belonging to the field of molecular biology, wherein the microsatellite marker is named as ES034 and ES096, and the invention also provides a method for identifying the inbred family of palaemon carinicauda by using the primer. The method provides a basis for the judgment of inbred lines.

Description

Microsatellite marker primer and method for identifying inbred families of exopalaemon carinicauda

Technical Field

The invention belongs to the field of molecular biology, and particularly relates to a method for identifying an inbred family of exopalaemon carinicauda by using a microsatellite marker.

Background

The exopalaemon carinicauda belongs to the family brachialidae and genus Macrobrachium, and is commonly called white shrimp, small white shrimp and Yingchun shrimp. The shrimp feed is mainly distributed in shallow sea low-salt water areas along the coast of the mainland in China and on the west bank of the Korean peninsula, the yellow Bohai sea has the largest yield, and the shrimp feed is important small and medium-sized economic shrimps in China. The exopalaemon carinicauda has the advantages of wide environmental adaptability, poor feeding property, short breeding period, strong disease resistance and the like, greatly reduces the difficulty of the full-artificial indoor breeding of exopalaemon carinicauda, and simultaneously, the exopalaemon carinicauda is small in adult shrimp individuals, transparent in body color and easy to perform experimental operation. These characteristics of palaemon carinicauda make it possible to be a crustacean experimental animal.

According to the genetic control method and the gene homozygosity degree, experimental animals can be divided into four types of inbred lines, mutant lines, hybrid groups and closed groups. The inbred line animals have obvious advantages in repeatability and comparability of experiments due to homozygous consistency of genotypes of the inbred line animals, and therefore, research on the experimental animals is mostly concentrated on the inbred line animals. Inbreeding brings a population to a state of near complete homozygosity, i.e., the relative positions of all homologous chromosomes have the same genes. During the inbreeding process, the following changes are mainly made: firstly, increasing homozygosity to change gene loci into homozygotes and enable phenotype of the homozygotes to tend to be consistent, and secondly, inbreeding can separate groups into strains with different genotypes; third, inbreeding can cause inbreeding depression, and offspring produced by closely related matings often have reduced ability to grow, survive, reproduce, resist disease, adapt to the environment, and the like. How to overcome and solve the problem of inbreeding depression is the key point for breeding inbred line animals.

The obvious characteristics of the inbred line experimental animal are the gene homozygosity and the genetic stability, but in the processes of cultivation, seed preservation and reproduction production, genetic variation or genetic pollution is possible, so strict and timed genetic detection needs to be carried out on the inbred line. For exopalaemon carinicauda, the research on the high-degree inbred line aiming at breeding ideal experimental animals is still in the initial stage, so the genetic detection of the inbred line is also the need of the inbred line breeding work. The national standards relating to experimental animals stipulate that conventional tests are carried out using a skin transplantation method, an immune marker gene test method, a biochemical gene marker test method and the like. In recent years, molecular biology technology is rapidly developed, changes of animal genome nucleic acid can be directly detected, and a direct and objective way is provided for genetic detection of the palaemon carinicauda inbred line.

Microsatellites, which are DNA sequences that are repeated in tandem in a few nucleotides, are widely distributed in the genome of eukaryotes, with a microsatellite marker present approximately every 10-15 kb. The microsatellite marker has the following advantages in the process of breeding inbred lines: sampling is micro-quantized and convenient; the method is rapid, efficient and high in accuracy; can be used for a long time; the genotype of any individual can be directly identified, thereby eliminating gene variants which are not expected to exist in the population. Therefore, the polymorphic site with strain specificity is selected by the microsatellite marker technology, and the method can be accurately, quickly and sensitively applied to the aspects of identification, genetic quality monitoring and the like in the process of breeding inbred line experimental animals.

Disclosure of Invention

The invention aims to solve the technical problem of providing a microsatellite marker primer and a method for identifying the exogeneous family of palaemon carinicauda.

The invention is realized by the following technical scheme:

the microsatellite marker primers for identifying the inbred family of the palaemon carinicauda are named as ES034 and ES096, and the primers are respectively as follows:

ES034

a forward primer: 5'ACTTCATCCACAAGCAGAGGT 3' of the formula I,

reverse primer: 5'GAAGAAGAGGAAGGTGGGGC 3';

ES096；

a forward primer: 5'GCAATTTGCCTGTTCGGTCT 3' of the formula I,

reverse primer: 5'GGTAGGGGTAAGGGGGTGAT 3'.

The method for identifying the inbred families of the exopalaemon carinicauda by using the primers comprises the following specific steps:

randomly sampling from a group of the exopalaemon carinicauda to be detected to obtain a sample to be detected, carrying out PCR amplification by using the genomic DNA of the exopalaemon carinicauda to be detected as a template and using a pair of primers with each marker, and then detecting the fragment size of a PCR product of the sample to be detected, wherein if all the following standards (1) to (3) are met, the exopalaemon carinicauda to be detected is a candidate exopalaemon carinicauda inbred family:

(1) in the method, more than 30 samples to be detected are randomly sampled from the palaemon carinicauda population to be detected;

(2) the exopalaemon carinicauda sample to be detected belongs to F₈Or F₈The above generations;

(3) when the palaemon carinicauda population to be detected is detected by using each pair of primers marked ES034 and ES096, all samples in the population have the same genotype, and the fragment sizes are respectively 146bp and 263 bp.

Compared with the prior art, the invention has the beneficial effects that:

the invention utilizes two pairs of microsatellite primers to carry out genetic detection on the palaemon carinicauda population, can clearly distinguish the inbred line population of the palaemon carinicauda, maintains the homozygosity and isogeny of the inbred line of the palaemon carinicauda, and eliminates the population which generates genetic variation or genetic pollution in the process of establishing the inbred line of the palaemon carinicauda. The method of the invention not only can judge the homozygous locus, but also can analyze the variation condition of the gene, and provides a basis for genetic detection of inbred lines.

Drawings

FIG. 1 STR detection results of wild group of palaemon carinicauda at microsatellite locus ES 034;

FIG. 2 inbred of exopalaemon carinicauda F₁STR detection results of the microsatellite locus ES 034;

FIG. 3 inbred of exopalaemon carinicauda F₇STR detection results of the microsatellite locus ES 034;

FIG. 4 inbred of exopalaemon carinicauda F₈STR detection results of the microsatellite locus ES 034;

FIG. 5 inbred of exopalaemon carinicauda F₉STR detection results of the microsatellite locus ES 034;

FIG. 6 STR detection results of wild group of palaemon carinicauda at the microsatellite locus ES 096;

FIG. 7 inbred of exopalaemon carinicauda F₁STR detection results of ES096 microsatellite loci;

FIG. 8 inbred of exopalaemon carinicauda F₇STR detection results of ES096 microsatellite loci;

FIG. 9 inbred of exopalaemon carinicauda F₈STR detection results of ES096 microsatellite loci;

FIG. 10 inbred of exopalaemon carinicauda F₉STR detection results of ES096 microsatellite loci.

Detailed Description

The following examples facilitate a better understanding of the invention, but do not limit it. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were all available from conventional biochemical reagent stores unless otherwise specified.

Example 1

Material

Study subject exopalaemon carinicauda inbred family group F₇、F₈、F₉Generation is from Chinese aquatic scienceThe Lijian subject group of the institute of yellow sea aquatic products adopts a complete artificial indoor cultivation of the family of the exopalaemon carinicauda. Wild group of palaemon carinicauda is collected from Jiangsu sea area, F₁The generation population is the generation after the wild population, and each population is randomly sampled for 30 tails.

Primer and method for producing the same

In the experiment, 2 pairs of microsatellite markers are obtained by screening and are used for detecting and identifying the palaemon carinicauda family. The primers for amplifying the microsatellite loci ES034 and ES096 are synthesized by biological engineering (Shanghai) GmbH, and the sequences of the primers are as follows:

ES034

a forward primer: 5'ACTTCATCCACAAGCAGAGGT 3' of the formula I,

reverse primer: 5'GAAGAAGAGGAAGGTGGGGC 3'.

ES096

A forward primer: 5'GCAATTTGCCTGTTCGGTCT 3' of the formula I,

reverse primer: 5'GGTAGGGGTAAGGGGGTGAT 3'.

The genome DNA is extracted from the muscle tissue of the exopalaemon carinicauda to be detected, and the extraction method is improved by referring to the traditional phenol chloroform method. The extracted genomic DNA was used as a template, and PCR amplification was carried out under the guide of the above primers, respectively, in a reaction system of 20. mu.L. Wherein the template is 30-50ng, the upstream and downstream primers are 1 μ L each, 2 × TSINGKE Master Mix (from Beijing Ongki Biotech Co., Ltd.) is 10 μ L, and ddH₂O6. mu.L. The reaction conditions are as follows: firstly, 95 ℃ and 5 min; then 35 cycles of 95 ℃, 40s, 55 ℃, 40s, 72 ℃ and 50s are counted; stretching for 10min at 72 ℃. 10 μ L of amplified product was detected on a 3730XL sequencer. As shown in the figure, the position corresponding to the peak is the amplification size of the PCR product. The polymorphism information contents of ES034 and ES096 in each population are shown in Table 1.

Inbred family F₇、F₈、F₉Generation population, wild population and F₁The comparison result of STR typing of generation population shows that ES034 and ES096 are in inbred line population F₈、F₉Has the same specific allele with the size of 146bp and 263bp respectively. While 2 sites were shown to be polymorphic in the other population, with polymorphisms shown to be higher in the wild populationAnd (4) sex.

Therefore, the experimental scheme is used for testing the rapid genotyping of the palaemon carinicauda inbred line and can be used for genetic quality detection and strain identification in the culture process of the palaemon carinicauda inbred line.

TABLE 1 polymorphic information content of ES034, ES096 in the population

SEQUENCE LISTING

<110> research institute for aquatic products in yellow sea of China institute for aquatic science

<120> microsatellite marker primer and method for identifying palaemon carinicauda inbred families

<130> do not

<160>4

<170>PatentIn version 3.3

<210>1

<211>21

<212>DNA

<213>Artificial

<220>

<223> artificially designed primer ES034 forward primer

<400>1

acttcatcca caagcagagg t 21

<210>2

<211>20

<212>DNA

<213>Artificial

<220>

<223> artificially designed ES034 reverse primer

<400>2

gaagaagagg aaggtggggc 20

<210>3

<211>20

<212>DNA

<213>Artificial

<220>

<223> ES096 Forward primer

<400>3

gcaatttgcc tgttcggtct 20

<210>4

<211>20

<212>DNA

<213>Artificial

<220>

<223> ES096 reverse primer

<400>4

ggtaggggta agggggtgat 20

Claims (2)

1. A microsatellite marker primer for identifying an inbred family of palaemon carinicauda is characterized in that the microsatellite marker name isES034、ES096The primers are respectively as follows:

ES034

a forward primer: 5'ACTTCATCCACAAGCAGAGGT 3' of the formula I,

reverse primer: 5'GAAGAAGAGGAAGGTGGGGC 3';

ES096

a forward primer: 5'GCAATTTGCCTGTTCGGTCT 3' of the formula I,

reverse primer: 5'GGTAGGGGTAAGGGGGTGAT 3'.

2. The method for identifying the inbred family of palaemon carinicauda by using the primer of claim 1 is characterized by comprising the following specific steps of:

randomly sampling from a group of the exopalaemon carinicauda to be detected to obtain a sample to be detected, respectively carrying out PCR amplification by using the two pairs of primers of claim 1 by using the genomic DNA of the exopalaemon carinicauda to be detected as a template, and then detecting the PCR product of the sample to be detected, wherein if all the standards from (1) to (3) are met, the exopalaemon carinicauda to be detected is a candidate exopalaemon carinicauda inbred family;

(1) in the method, more than 30 samples to be detected are randomly sampled from the palaemon carinicauda population to be detected;

(2) the exopalaemon carinicauda sample to be detected belongs to F₈Or F₈The above generations;

(3) by means of marksES034、ES096When each pair of primers of the group of the exopalaemon carinicauda is used for detecting the exopalaemon carinicauda population to be detected, all samples in the population have the same genotype, and the sizes of the fragments are respectively 146bp and 263 bp.

Images