CN106636427A - Microsatellite marker primer and method for authenticating inbred family of palaemon carinicauda - Google Patents

Abstract

The invention discloses a microsatellite marker primer and method for authenticating an inbred family of palaemon carinicauda, and belongs to the field of molecular biology. Microsatellite marker names are ES034 and ES096. The invention further provides a method for authenticating the inbred family of the palaemon carinicauda by using the primer. According to the microsatellite marker primer and the method, the genetic relationship among individuals in a palaemon carinicauda group is authenticated by using two pairs of the microsatellite primers to judge the inbreeding level among the individuals in the group; when all the individuals have monomorphism segments at 146bp and 263bp, the authenticated group meets the requirement of inbred cultivation. The method supplies a basis for judgment of an inbred line.

Description

A kind of microsatellite marker primer and method of identification Exopalaemon carinicauda inbreeding family

Technical field

The invention belongs to biology field, Exopalaemon carinicauda inbreeding is identified more particularly to a kind of using microsatellite marker The method of family.

Background technology

Exopalaemon carinicauda belongs to Palaemonidae, Palaemon, is commonly called as white shrimp, little white shrimp and winter jasmine shrimp.It is distributed mainly on Chinese big Littoral and Korea peninsula west bank the shallow sea less salt waters in land, it is maximum with yellow Bohai Sea yield, it is the important middle-size and small-size economic shrimp of China Class.Exopalaemon carinicauda has the advantages that environmental suitability is wide, feeding habits are miscellaneous, the breeding cycle is short, premunition is strong, greatly reduces spine end white The difficulty of the full artificial room's breeding of shrimp, meanwhile, Exopalaemon carinicauda is little into shrimp individuality, and body colour is transparent to be easy to experimental implementation.Exopalaemon carinicauda These features make it possess the possibility for becoming shell-fish animal used as test.

By Genetic control method, according to gene pure degree, animal used as test can be divided into inbred strais, mutantion line, hybridization Group, the class of closed colony four.Wherein inbred strais animal because of the homozygosis uniformity of its genotype, in the repeatability and comparativity of experiment With obvious advantage, therefore, focus mostly in inbred strais animal in the research of animal used as test.It is close that inbreeding reaches a population Complete homozygosis degree, i.e., relative position all states with homologous genes of all homologues.It is main during inbreeding There is the change of following several respects：First, increase homozygosity, make gene loci be changed into homozygote so as to which phenotype tends to consistent Property, second, inbreeding can by separation of group for different genotype strain；3rd, inbreeding can cause inbreeding depression, what relationship was close to Offspring produced by mating usually occurs growth, survives, gives birth to, disease-resistant, the adaptation ability such as environment going down.How to overcome and Inbreeding depression is solved the problems, such as, is the key point for cultivating inbred strais animal.

The distinguishing feature of inbred strais animal used as test is its gene pure and genetic stability, but cultivating, conservation and numerous In growing production process, exist and the possibility of hereditary variation or genetic pollution occurs, so needing to carry out inbred strais strictly, regularly Genetic Detection.For Exopalaemon carinicauda, to cultivate preferable animal used as test for the purpose of height inbred strais research be still in Starting stage, therefore the Genetic Detection of inbred strais is also inbred cultivation requirements of one's work.About the national standard of animal used as test Define carries out conventional detection using epidermization, immune labeled DNA test and biochemical genetic marker detection method etc..Closely Protocols in Molecular Biology quickly grows over year, can be Exopalaemon carinicauda inbred strais with the change of Direct Test Animal genome nucleic acid Genetic Detection provide direct, objective approach.

Microsatellite, refers to the DNA sequence dna that a few nucleotides is the multiple tandem sequence repeats of unit, and it is distributed widely in eucaryon In biological genome, per every about 10-15kb a microsatellite marker is there is.Mistake of the microsatellite marker in inbred cultivation There is following advantage in journey：Sampling milligram ammonia, convenient purification；Quickly, efficiently, accuracy is high；Can Long-Time Service；Can Direct Recognition Go out the genotype of any individuality, so as to not expecting that the gene variant for existing is eliminated in colony.So, use microsatellite marker skill Art selects the polymorphic site of tool strain specificity, in being accurately, rapidly and sensitively applied to inbred strais animal used as test cultivating process The aspect such as discriminating, genetic quality monitoring.

The content of the invention

The technical problem to be solved in the present invention is to provide a kind of microsatellite marker of identification Exopalaemon carinicauda inbreeding family to draw Thing and method, 2 microsatellite markers of the inventive method application identify Exopalaemon carinicauda inbreeding family.

The present invention is achieved by the following technical solution：

A kind of microsatellite marker primer of identification Exopalaemon carinicauda inbreeding family, the entitled ES034 of the microsatellite marker, ES096, its primer is as follows respectively：

ES034

Forward primer：5'ACTTCATCCACAAGCAGAGGT 3',

Reverse primer：5'GAAGAAGAGGAAGGTGGGGC3'；

ES096；

Forward primer：5'GCAATTTGCCTGTTCGGTCT 3',

Reverse primer：5'GGTAGGGGTAAGGGGGTGAT 3'.

The method for carrying out Exopalaemon carinicauda inbreeding Parentage determination using above-mentioned primer, comprises the following steps that：

Sample to be tested is obtained from random sampling in Exopalaemon carinicauda colony to be measured, the genomic DNA with Exopalaemon carinicauda to be measured is Template, using with by the pair of primers of each mark performing PCR amplification is entered, and then detects the PCR primer of sample to be tested Clip size, if meeting all standards of following (1) to (3), Exopalaemon carinicauda to be measured is the Exopalaemon carinicauda inbreeding family of candidate：

(1) in methods described, 30 tail above samples to be tested are obtained from random sampling in Exopalaemon carinicauda colony to be measured；

(2) the Exopalaemon carinicauda sample to be tested belongs to F₈Or F₈Generation above；

(3) when with the Exopalaemon carinicauda colony to be measured of each pair primer detection of mark ES034, ES096, intragroup all samples Product have identical genotype, and clip size is respectively 146bp, 263bp.

Present invention beneficial effect compared with prior art：

The present invention carries out Genetic Detection using two pairs of micro-satellite primers to Exopalaemon carinicauda colony, can clearly distinguish ridge The inbred strais colony of tail white shrimp, maintains the homozygosity and isogenicity of Exopalaemon carinicauda inbred strais, eliminates in Exopalaemon carinicauda inbred strais There is the colony of hereditary variation or genetic pollution during foundation.The inventive method not only can carry out the judgement in homozygosis site, And the variation situation of gene can be analyzed, the Genetic Detection for inbred strais provides foundation.

Description of the drawings

STR testing result of Fig. 1 Exopalaemon carinicaudas wild population in microsatellite seat ES034；

Fig. 2 Exopalaemon carinicauda inbreeding F₁STR testing result of the generation in microsatellite seat ES034；

Fig. 3 Exopalaemon carinicauda inbreeding F₇STR testing result of the generation in microsatellite seat ES034；

Fig. 4 Exopalaemon carinicauda inbreeding F₈STR testing result of the generation in microsatellite seat ES034；

Fig. 5 Exopalaemon carinicauda inbreeding F₉STR testing result of the generation in microsatellite seat ES034；

STR testing result of Fig. 6 Exopalaemon carinicaudas wild population in microsatellite seat ES096；

Fig. 7 Exopalaemon carinicauda inbreeding F₁STR testing result of the generation in microsatellite seat ES096；

Fig. 8 Exopalaemon carinicauda inbreeding F₇STR testing result of the generation in microsatellite seat ES096；

Fig. 9 Exopalaemon carinicauda inbreeding F₈STR testing result of the generation in microsatellite seat ES096；

Figure 10 Exopalaemon carinicauda inbreeding F₉STR testing result of the generation in microsatellite seat ES096.

Specific embodiment

Below example facilitates a better understanding of the present invention, but does not limit the present invention.Experiment side in following embodiments Method if no special instructions, is conventional method.Test material used if no special instructions, is conventional life in following embodiments Change what reagent shop can be commercially available.

Embodiment 1

Material

Research object Exopalaemon carinicauda inbreeding family colony F₇、F₈、F₉It is from generation to generation by China Aquatic Science Research Institute's Huanghai Sea aquatic products The Exopalaemon carinicauda family that Li Jian seminars of research institute are cultivated using full artificial room.Exopalaemon carinicauda wild population is picked up from Jiang Suhai Domain, F₁For colony be wild population offspring, each tail of colony's random sampling 30.

Primer

This experiment obtains 2 pairs of microsatellite markers by screening is used for Testing and appraisal Exopalaemon carinicauda family.Amplification microsatellite seat The primer of position ES034, ES096 is synthesized by Sangon Biotech (Shanghai) Co., Ltd., and its sequence is：

ES034

Forward primer：5'ACTTCATCCACAAGCAGAGGT 3',

Reverse primer：5'GAAGAAGAGGAAGGTGGGGC3'.

ES096

Forward primer：5'GCAATTTGCCTGTTCGGTCT 3',

Reverse primer：5'GGTAGGGGTAAGGGGGTGAT 3'.

Genomic DNA is extracted from the musculature of above-mentioned Exopalaemon carinicauda to be measured, the traditional phenol chloroform method of extracting method reference, Improved.Genomic DNA with extraction under the guiding of above-mentioned primer, enters respectively performing PCR amplification, reaction system as template For 20 μ L.Wherein template is 30-50ng, and each 1 μ L of upstream and downstream primer, 2 × TSINGKE Master Mix (come from Beijing and hold up section Xin Ye Bioisystech Co., Ltd) it is 10 μ L, ddH₂O 6μL.Reaction condition is：First 95 DEG C, 5min；Then 95 DEG C, 40s, 55 DEG C, 40s, 72 DEG C, 50s, 35 circulations altogether；Extend 10min after 72 DEG C.The product of amplification takes 10 μ L on 3730XL sequenators Detection.As a result as illustrated, position corresponding to peak value is the amplification size of PCR primer.ES034, ES096 are in each colony Polymorphism information content is shown in Table 1.

Inbreeding family F₇、F₈、F₉Generation population, wild population and F₁Show for the comparative result of the STR partings of colony ES034, ES096 are in inbred strais colony F₈、F₉In there is identical unique allele, size is respectively 146bp, 263bp.And 2 sites show as polymorphism in other colonies, wherein showing as higher polymorphism in wild population.

Therefore this experimental program has tested the quick Genotyping of Exopalaemon carinicauda inbreeding family, can be used for Exopalaemon carinicauda inbreeding It is the identification of Genetic monitoring in incubation and strain.

The polymorphism information content of table 1 ES034, ES096 in colony

SEQUENCE LISTING

<110>Inst of Huanghai Sea Marine Products, Chinese Academy of Aquatic Product Science

<120>A kind of microsatellite marker primer and method of identification Exopalaemon carinicauda inbreeding family

<130>Nothing

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 21

<212> DNA

<213> Artificial

<220>

<223>The primer ES034 forward primers of engineer

<400> 1

acttcatcca caagcagagg t 21

<210> 2

<211> 20

<212> DNA

<213> Artificial

<220>

<223>The ES034 reverse primers of engineer

<400> 2

gaagaagagg aaggtggggc 20

<210> 3

<211> 20

<212> DNA

<213> Artificial

<220>

<223>ES096 forward primers

<400> 3

gcaatttgcc tgttcggtct 20

<210> 4

<211> 20

<212> DNA

<213> Artificial

<220>

<223>ES096 reverse primers

<400> 4

ggtaggggta agggggtgat 20

Claims (2)

1. it is a kind of identification Exopalaemon carinicauda inbreeding family microsatellite marker primer, it is characterised in that the microsatellite marker is entitled ES034, ES096, its primer is as follows respectively：

ES034

Forward primer：5'ACTTCATCCACAAGCAGAGGT 3',

Reverse primer：5'GAAGAAGAGGAAGGTGGGGC3'；

ES096

Forward primer：5'GCAATTTGCCTGTTCGGTCT 3',

Reverse primer：5'GGTAGGGGTAAGGGGGTGAT 3'.

2. the method for carrying out Exopalaemon carinicauda inbreeding Parentage determination using primer described in claim 1, it is characterised in that it concrete Step is as follows：

Obtain sample to be tested from random sampling in Exopalaemon carinicauda colony to be measured, the genomic DNA with Exopalaemon carinicauda to be measured as template, Enter performing PCR amplification using with by the pair of primers of each mark, then using the PCR primer of detection sample to be tested, such as Fruit meets all standards of following (1) to (3), and Exopalaemon carinicauda to be measured is the Exopalaemon carinicauda inbreeding family of candidate；

(1) in methods described, 30 tail above samples to be tested are obtained from random sampling in Exopalaemon carinicauda colony to be measured；

(2) the Exopalaemon carinicauda sample to be tested belongs to F₈Or F₈Generation above；

(3) when with the Exopalaemon carinicauda colony to be measured of each pair primer detection of mark ES034, ES096, intragroup all samples tool There is identical genotype, and clip size is respectively 146bp, 263bp.