WO2023092860A1 - Arms-pcr primer set, kit and detection method for identifying gene of cubilose, and use of arms-pcr primer set - Google Patents

Abstract

Disclosed in the present invention are an ARMS-PCR primer set, kit and detection method for identifying the gene of cubilose, and the use of the ARMS-PCR primer set, which belong to the technical field of detection of the gene of cubilose. By means of identifying cubilose using the ARMS-PCR primer, kit and detection method of the present invention, the traceability of a cubilose product can be realized.

Description

An ARMS-PCR primer set, kit, detection method and application for identifying bird's nest base technical field

The invention relates to the technical field of bird's nest base detection technology, in particular to an ARMS-PCR primer set, a kit, a detection method and application for identifying bird's nest base.

Background technique

Bird's nest refers to the nest made of the saliva secreted by some swifts of the Swift family Swift family and several swiftlets of the genus Swiftlet, mixed with other substances. It is mainly produced in Southeast Asian countries such as Malaysia, Indonesia, Thailand and Myanmar, as well as the coastal areas of Fujian and Guangdong in my country. Bird's nest is rich in sugars, organic acids, free amino acids and a characteristic substance - sialic acid, which has certain nutritional value. As far as bird’s nest bases are concerned, bird’s nests of different bases are different, especially in that bird’s nests of different bases have different composition ratios, shapes, tastes, etc., such as: different proportions of sialic acid. Bird's nests of different bird's nest bases have distinguishing characteristics, therefore, identification of bird's nest bases is necessary. The identification of bird's nest bases is not only beneficial to the scientific research of bird's nest, but also facilitates the identification of bird's nest products in the market, avoiding counterfeit and inferior products in the market, and has a good promotion effect on the entire production and sales environment of bird's nest.

However, there are still many deficiencies in the existing identification methods of bird's nest bases, and it is impossible to achieve a more accurate and rapid identification of bird's nest. For example, sensory identification and physical and chemical property identification are commonly used in the prior art. Although this type of method is relatively simple, it has insufficient accuracy, low sensitivity, and poor reproducibility. Therefore, the prior art urgently needs a high-accuracy, high-sensitivity, and reproducible identification method for bird's nest origin, so as to make up for the deficiencies in the common identification methods of the prior art.

Tetra-primer ARMS-PCR (Tetra-primer ARMS-PCR) technology is a single nucleotide polymorphism (SNP) typing technology developed on the basis of ordinary PCR. Invented by humans in 1989, the basic principle is that Taq DNA polymerase lacks 3′→5′ exonuclease activity, so it extends the 3′-end mismatched primer at a speed lower than that of normal paired primers; when the mismatched base When the number of bases reaches a certain number, the 3′ terminal base cannot continue to extend due to the difficulty in forming phosphodiester bonds, which leads to the termination of the reaction, that is, the amplification band of a specific length cannot be obtained, indicating that the template DNA and the 3′ end of the primer No corresponding mutation occurred. If the result of the polymerase chain reaction shows an amplified band of a specific length, it indicates that there is a mutation corresponding to the 3' end of the primer on the template DNA. Introduce a mismatch base to the penultimate or third position at the 3' end of the primer. If the strongest mismatch at the 3' end of the mismatch base is G/A and C/T, introduce a weak mismatch C/A into the primer, C/T; If the mismatched base 3'-end medium mismatch is (A/A, C/C, G/G, and T/T), introduce a medium mismatch in the primer. Tetra-primer ARMS-PCR technology needs to design 4 different primers according to the specific SNP site, design 2 inner primers on both sides of the SNP site and 2 outer primers at different distances upstream and downstream of the SNP site. In traditional Tetra-primer ARMS-PCR, the amplified product is generally detected directly by electrophoresis. Tetra-primer ARMS PCR reaction Due to the difference in the distance from the upstream primer and downstream primer to the mutation point in the Tetra-primer ARMS PCR reaction, the specific band sizes obtained in the electropherogram are also different. The genotype of an individual can be directly judged according to the blocking type of the 3' end-specific primer and the size and presence or absence of bands in the electrophoretic pattern.

This application intends to combine the characteristics of ARMS-PCR to solve the shortcomings of the common identification methods in the technical field of bird's nest base identification technology in the prior art, and to provide an accurate, fast and sensitive identification method and related primers, reagents, etc.

Contents of the invention

The present invention aims at overcoming at least one deficiency of the above-mentioned prior art, and provides an ARMS-PCR primer set, kit, detection method and application thereof for identifying bird's nest bases, and realizes identification of bird's nest bases in combination with ARMS-PCR technology, The operation is simple, the identification is fast, the sensitivity is high, and the accuracy is high, which is convenient for rapid traceability of bird's nest products and effectively reduces labor intensity.

The primary purpose of the present invention is to overcome the existing difficulties in morphological identification and provide a primer set for identifying the bird's nest base.

Above-mentioned purpose of the present invention is achieved by following scheme:

A primer set for identifying bird's nest base, including a first primer set and/or a second primer set; the first primer set includes: upstream outer primer Af/1-553bp-F, downstream outer primer Af/1-553bp -R, upstream internal primer Af/1-A-201bp-F, downstream internal primer Af/1-G-402bp-R; the second primer set includes: upstream external primer Am-ND2-463bp-F, downstream external primer Am -ND2-463bp-R, upstream internal primer Am-ND2-A-317bp-F, downstream internal primer Am-ND2-G-201bp-R; the sequences are Af/1-553bp-F: TCTAGCAATCATTGAATAATAGCCTGAGC; Af/1- 553bp-R: AGAAGGTTAGTAGAGTCAGTTTGGGGTTG; Af/1-A-201bp-F: CACCATCCTCTTCATAACATCCCACA; Af/1-G-402bp-R: GGTGAGGAGGGTTGGGTCTAGTTAC; Am-ND2-463bp-F: CCCATTCCACTTCTGATTTCCAGAAGTCC; Am-ND2 -463bp-R: TTTAGGTAGGAAGCCTGTTAGGGGTGGG; Am-ND2-A-317bp-F: TATTTCTTCTACCACCTTAGGGGGCGGA; Am-ND2-G-201bp-R: CGGACCTGTGTTTGGTTTAGTCCCTCTC.

In one or more embodiments of the present invention, bird's nest samples from different sources are identified, the Java swiftlet nest can be effectively identified through the first primer set, and the swiftlet nest among them can be effectively identified through the second primer set Bird's nest, through the cooperation of the first primer set and the second primer set, even if the source of the bird's nest is different, the biological origin of the bird's nest can still be effectively identified. Through the primer set in this application, the biological origin of bird’s nest samples can be effectively identified, and the way of using the primer set to amplify and identify is more accurate than the existing manual identification, physical and chemical index identification, etc., and the operation is convenient and efficient. It is easy to use in actual production and research, including product traceability, bird's nest genome research, etc.

Preferably, the first primer set is used to identify the bird's nest of Java swiftlet, and the second primer set is used to identify the nest of swiftlet. In one embodiment of the present invention, by detecting whether the bird's nest sample DNA is successfully amplified under the first primer set and the second primer set and the characteristics of the amplified bands, it is possible to identify whether the bird's nest sample is the same as the first primer set or not. The corresponding Java swiftlet biological basis, or the corresponding second primer set the Greater swiftlet biological basis.

The above primer sets can also be understood as the independent or coordinated identification of the two primer sets. For example, a primer combination for identifying Java swiftlet nests includes four specific primers, and the four specific primers are the upstream outer primers Af/ 1-553bp-F, downstream outer primer Af/1-553bp-R, upstream inner primer Af/1-A-201bp-F, downstream inner primer Af/1-G-402bp-R, primer sequences of four specific primers They are: Af/1-553bp-F: TCTAGCAATCATTGAATAATAGCCTGAGC; Af/1-553bp-R: AGAAGGTTAGTAGAGTCAGTTTGGGGTTG; Af/1-A-201bp-F: CACCATCCTCTTCATAACATCCACA; Af/1-G-402bp-R: GGTGAGGAGGGTTGGGTCT AGTTAC; and/or , a combination of primers used to identify swiftlet nests, including four specific primers, the four specific primers are upstream outer primer Am-ND2-463bp-F, downstream outer primer Am-ND2-463bp-R, upstream Internal primer Am-ND2-A-317bp-F, downstream internal primer Am-ND2-G-201bp-R, the primer sequences of the four specific primers are: Am-ND2-463bp-F: CCCATTCCACTTCTGATTTCCAGAAGTCC; Am-ND2-463bp -R: TTTAGGTAGGAAGCCTGTTAGGGGTGGG; Am-ND2-A-317bp-F: TATTTTCTTCTACCACCTTAGGGGGCGGA; Am-ND2-G-201bp-R: CGGACCTGTGTTTGGTTTAGTCCCTC.

Another object of the present invention is to provide an ARMS-PCR kit for identifying bird's nest bases, which contains the above primer set. Through the kit, it is convenient to combine with common PCR equipment and reagents to realize the identification of the bird's nest base.

Preferably, the ARMS-PCR kit also includes PCR reagents for amplification. In one or more embodiments of the present invention, the sample DNA is amplified by means of ARMS-PCR, and the identification process is realized according to the amplification result of the primers. The kit contains corresponding PCR reagents for amplification, which is conducive to the one-step preparation of the main required materials, and a single kit can meet the main reagents required for identification.

Preferably, the PCR reaction system includes the following components: 2×tsingke Master Mix, the above primer set, bird's nest DNA to be identified, MgCl ₂ , dNTPs, and Taq DNA polymerase. ARMS-PCR.

Preferably, the concentration of each primer in the primer set of the PCR reaction system is the same. In one or more embodiments of the present invention, the concentration of each primer in the first primer set in the PCR system applied to the first primer set is the same, and the concentration of each primer in the second primer set in the PCR system applied to the second primer set is the same.

Preferably, the PCR reaction system is 20 μl, including the following components:

or,

In one or more embodiments of the present invention, the first primer set and the second primer set use the above-mentioned PCR system to amplify the template DNA, and obtain effective amplified bands that can be used for identification.

Preferably, the PCR working program is pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 60 s, 40 cycles, and finally extension at 72°C for 10 min.

Another object of the present invention is to provide a kind of ARMS-PCR detection method of bird's nest base identification, comprising the following steps:

A1, extracting the DNA of the bird's nest to be identified;

A2. Design the ARMS-PCR primers for amplifying the specific gene DNA, and configure the ARMS-PCR reaction system with the DNA obtained in A1 as a template; as, use the DNA extracted in step (1) as a template, and use the above-mentioned primer set to prepare PCR reaction system for PCR amplification;

A3. Identify the bird’s nest base based on PCR amplification results, that is, compare whether the ARMS-PCR amplification result corresponds to the expected amplification band of the ARMS-PCR primer used to identify whether the base of the bird’s nest to be identified is the ARMS-PCR primer The representative bird's nest base.

The identification method described in step A3 is: if the bird’s nest base specific band corresponding to the ARMS-PCR primer appears on the gel, it can be judged that the sample to be identified is the bird’s nest base represented by the ARMS-PCR primer; otherwise, it is not ARMS - Bird's nest base represented by PCR primers.

Preferably, the primers for ARMS-PCR in step A2 are the above-mentioned primer set, and the specific motif is Java swiftlet nest and/or giant swiftlet nest.

Preferably, in step A1, the DNA in the bird's nest sample is extracted by the guanidine isothiocyanate method.

Preferably, step A1 specifically includes the steps of:

A11. Add the crushed bird's nest into a 1.5ml centrifuge tube, add 200μl TE buffer, and mix well;

A12. Add 400 μl guanidine isothiocyanate solution, vortex and mix in a 55°C water bath for 1 hour, keep inverting until the solution is transparent;

A13. Add 300 μl Tris-saturated phenol (25:24:1) and 300 μl dichloromethane/isoamyl alcohol (24:1), shake vigorously for 15 S, and centrifuge at 13000 r/min for 10 min;

A14. Take the supernatant, add an equal volume of dichloromethane, shake vigorously for 15S, and centrifuge at 13000r/min for 10min;

A15. Take the supernatant and chloroform layer, add 0.8 times the volume of isopropanol, and centrifuge at 12000r/min for 10min;

A16. Discard the supernatant, add 1ml 70% ethanol to wash the precipitate; place it at room temperature to completely evaporate the residual ethanol;

A17. Add 25uL TE buffer to dissolve the DNA precipitate, and store the DNA sample at -20°C.

Preferably, in step A3, electrophoresis is performed on the PCR product with 1-3% agarose gel to obtain results such as whether the band is amplified and the length of the amplified band. More preferably, in the electrophoresis step: the voltage is 100v, and the electrophoresis is performed for 50 minutes.

Another object of the present invention is to provide the use of the above primer set in the preparation of products for identifying the origin of bird's nest. Based on the above primer set, the bird's nest biological base can be effectively identified, and accordingly, products containing the primer set or detected by the primer set can be prepared for practical application. sequencing platform, etc.

Compared with the prior art, the beneficial effects of the present invention are: compared with the sensory identification and physical and chemical property identification commonly used in the prior art, the identification at the gene sequence level using ARMS-PCR is more accurate and sensitive, and at the same time, compared with other Common molecular biology detection method, the operation is simpler, does not require too many complicated equipment, pretreatment and other processes, has both accuracy and sensitivity, and at the same time ensures the simple operability of ARMS-PCR, which is easy to put into actual production and identification used in . Moreover, using the ARMS-PCR primers, kits and detection methods of the present application to identify bird's nest can improve the detection efficiency of bird's nest in the prior art, facilitate effective and accurate traceability of bird's nest products, and reduce labor intensity.

Description of drawings

Figure 1 is the electrophoresis results of ARMS-PCR primers for Java swiftlets. Among them: M: DNA Maker (2000bp), samples 1-9 are: N5, N6, N7, N8, N9, N14, N11, N13, N19, samples 10-18 are: D1, D2, D3, Z1 , Z2, Z3, X1, X2, X3; specifically, 1 represents N5; 2 represents N6; 3 represents N7; 4 represents N8; 5 represents N9; 6 represents N14; 7 represents N11; 8 represents N13; 9 represents N19; 10 represents D1; 11 represents D2; 12 represents D3; 13 represents Z1; 14 represents Z2; 15 represents Z3; 16 represents X1; 17 represents X2; 18 represents X3. Among them, N9, N11, N13, and N19 are Thai cave swallows and giant swiftlets.

Figure 2 is the electrophoresis result of the ARMS-PCR primers for the swiftlet. Among them: M: DNA Maker (2000bp); No. 1 sample: N9; No. 2 sample: N11; No. 3 sample: N5; No. 4 sample: N13; 5 represents N19; No. 6 sample is N6. Among them, N5 and N6 are samples of Java swiftlet.

Detailed ways

It should be pointed out that the following detailed description is exemplary and intended to provide further explanation to the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

It should be noted that the terminology used here is only for describing specific implementations, and is not intended to limit the exemplary implementations according to the present application. As used herein, unless the context clearly dictates otherwise, the singular is intended to include the plural, and it should also be understood that when the terms "comprising" and/or "comprising" are used in this specification, they mean There are features, steps, operations, means, components and/or combinations thereof.

The present invention will now be further described in conjunction with specific examples. The following examples are only to explain the present invention, but not to limit the present invention. The test sample used in the following examples and the test process include the following (if the experimental specific conditions are not indicated in the examples, usually according to conventional conditions, or according to the conditions recommended by the reagent company; used in the following examples Reagents, consumables, etc., unless otherwise specified, can be obtained from commercial sources).

Example 1

(1) Experimental materials:

The bird's nest samples adopted in the present embodiment are shown in Table 1, wherein the bird's nest samples are identified samples.

Table 1: Selected nest samples from different Swiftlet species (Aerodramus)

(2) Experimental reagents:

Guanidine isothiocyanate (Solarbio, #Lot.No.330M043), Tris saturated phenol (LEAGENE company, #Lot.0729A19), sodium acetate solution (LEAGENE company, #Lot.1029A19), TS-GelRed nucleic acid gel stain ( Purchased from Beijing Qingke Xinye Biotechnology Co., Ltd.), 2×TSINGKE Master Mix (blue) (purchased from Beijing Qingke Xinye Biotechnology Co., Ltd.), DL2000 DNA Marker (purchased from Beijing Qingke Xinye Biotechnology Co., Ltd. ), Agarose (purchased from Invitrogen Company; #Lot.16500500), TAE buffer (purchased from Beyotime Company, #ST716), 1X TE pH8.0 solution (purchased from Biosharp Company, #Lot.69035520), DTT Solution (purchased from Beyotime Company, #Lot.20181020), dichloromethane (purchased from Tiandong Tianzheng Fine Chemical Reagent Factory), Tris-HCl buffer solution (purchased from Beijing Leigen Biotechnology Co., Ltd., #Lot.0114A20), Triton X-100 (purchased from Sigma Company, #Lot.0427C210), EDTA (purchased from Biosharp Company), PVP-40 (purchased from Jianyang Biotechnology Co., Ltd.), sodium hydroxide (purchased from Tianjin Damao Chemical Reagent plant), primers (Af/1-553bp-Foward, Af/1-553bp-Reverse, Af/1-A-201bp-Foward, Af/1-G-402bp-Reverse, Am-ND2-463bp-Foward, Am -ND2-463bp-Reverse, Am-ND2-A-317bp-Foward, Am-ND2-G-201bp-Reverse, prepared by Beijing Qingke Xinye Biotechnology Co., Ltd.).

(3) Experimental equipment:

H1850R high-speed refrigerated centrifuge (purchased from Hunan Changsha Xiangyi Instrument Co., Ltd.), Sartorius BSA224S analytical balance (purchased from Sartorius Scientific Instrument Co., Ltd.), ultrapure water system (purchased from Merck Millipore Laboratory Equipment ( Shanghai) Co., Ltd.), HH-S constant temperature water bath (purchased from Gongyi Yuhua Instrument Co., Ltd.), S1000TM Thermal Cycel PCR instrument was purchased from BIO-RAD China Company, Universal Hood II gel imager (purchased from BIO- RAD China Company), electrophoresis instrument (Power Pac ^TM Basic 041BR125814) (purchased from BIO-RAD China Company), microwave oven (PTOF23P-a5(so)) (purchased from Galanz Company), ultra-sensitive full white motion imaging analysis (purchased from Punuo Sen Biotechnology Co., Ltd.), SYNERGY H1 automatic multi-functional microplate reader (purchased from Biotek Company).

(4) Experimental process

A1. DNA extraction

Take 25 mg of the bird's nest samples in Table 1, and use the guanidine isothiocyanate method to extract DNA. Grind each bird's nest sample with liquid nitrogen and weigh 25-30 mg; the specific steps are as follows:

(1) Add the crushed bird’s nest to a 1.5mL centrifuge tube, add 200μL TE buffer (pH8.0, 1×TE buffer: 10mM pH 8.0 Tris-HCl, 0.1mM EDTA to 100mL), mix well ;

(2) Add 400 μL of guanidine isothiocyanate solution, vortex mix and digest in a water bath at 55°C for 1 hour, keep inverting until the solution is transparent;

(3) Add 300 μL Tris-saturated phenol (purchased from Beijing Leigen Biotechnology Co., Ltd., the volume ratio of phenol: chloroform: isoamyl alcohol is 25:24:1) and 300 μL dichloromethane/isoamyl alcohol (dichloromethane/ Isoamyl alcohol is calculated according to the volume ratio of 24:1), vigorously shaken for 15s, and centrifuged at 13000r/min for 10min;

(4) Take the supernatant, add an equal volume of dichloromethane, shake vigorously for 15 s, and centrifuge at 13000 r/min for 10 min;

(5) Take the supernatant and the chloroform layer, add 0.8 times the volume of isopropanol, and centrifuge at 12000r/min for 10min;

(6) Discard the supernatant, add 1 mL of 70% (v/v) ethanol to wash the precipitate, and place it at room temperature to completely evaporate the residual ethanol;

(7) Add 25 μL TE buffer to dissolve the DNA precipitate, and store the DNA sample at -20°C.

A2, ARMS-PCR primer design

Download the ND2 sequences of Aerodramus fuciphagus (Java Swiftlet) and Aerodramus maximus (Great Swiftlet) from Nucteotide in NCBI, use Primer primer 5.0 software to design ARMS-PCR primers (as shown in Table 2), ARMS-PCR Primer Identification Table 1 bird's nest base.

Table 2: Primers for ARMS-PCR

A3, ARMS-PCR amplification, product electrophoresis identification

(1) ARMS-PCR amplification system and procedures

The PCR reaction system was 20 μL, including 7.5 μL of 2×tsingke Master Mix, 0.5 μL (10 μM) of each of the four primers, 7 μL of DNA template (100 ng/μL concentration), 1 μL of MgCl ₂ (3 mM), 2 μL of dNTPs (0.4 mM), 0.5 μL of Taq DNA polymerase (1.25U/25 μL), and ddH ₂ O as the balance.

PCR reaction conditions: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 65°C for 30 s, extension at 72°C for 60 s, 40 cycles; after the last cycle, extend at 72°C for 10 min. Agarose gel electrophoresis, 1.5% agarose TAE gel electrophoresis, 1 × TAE solution preparation, voltage 100V, 50min, observe the electrophoresis results under a gel imager. The technical PCR reaction time is 95 minutes, and then 1.5% agarose is used to detect electrophoresis bands, and the operation time of all steps is 145 minutes.

(2) Apply the above-mentioned ARMS-PCR amplification system and program to identify the ARMS-PCR primers of swiftlet (upstream outer primer Af/1-553bp-F, downstream outer primer Af/1-553bp-R, upstream inner primer Primer Af/1-A-201bp-F, downstream internal primer Af/1-G-402bp-R) and 18 samples in Table 1 were used for the identification process. Specifically, among the samples in Table 1, there are 9 samples in the south (N5-N9, N11, N13, N14, N19), 3 samples in the middle (Z1-Z3), 3 samples in the east (D1-D3), and 3 samples in the west ( X1-X3).

Complete the above ARMS-PCR amplification and product electrophoresis identification process, the results are shown in Figure 1, the length of the electrophoresis amplification bands of samples N5, N6, N7, N8, N14, D1-D3, Z1-Z3, X1-X3 is 533bp, 402bp, 201bp; N9, N11, N13, N19 samples had no bands. This result is consistent with the identified results in Table 1.

(3) Apply the above-mentioned ARMS-PCR amplification system and program to identify the ARMS-PCR primers of Swiftlet (upstream outer primer Am-ND2-463bp-F, downstream outer primer Am-ND2-463bp-R, upstream inner primer Am-ND2-463bp-R, upstream inner Primer Am-ND2-A-317bp-F, downstream internal primer Am-ND2-G-201bp-R) and 6 samples in Table 1 (including N9, N11, N5, N13, N19, N6), implement the identification process .

After completing the above-mentioned ARMS-PCR amplification and product electrophoresis identification process, the results are shown in Figure 2, where 1 represents N9, 2 represents N11, 3 represents N5, 4 represents N13, 5 represents N19, 6 represents N6, and the electrophoresis products N9, The lengths of the electrophoretic amplification bands of N11, N13, and N19 samples were 463bp, 317bp, and 201bp, respectively, and there were no bands in N5 and N6 samples. This result is consistent with the identified results in Table 1.

According to the above ARMS-PCR amplification results, the ARMS-PCR primer set and corresponding detection method provided by the present application can effectively identify the bird's nest base with high accuracy and reproducibility. As mentioned above, the results of the identification of Javanese Swiftlet and Greater Swiftlet are consistent with the identified results, indicating that the ARMS-PCR primers and detection methods provided by this application are practical, easy to use in the actual identification process, and realize bird’s nest Identification of the base. Moreover, the ARMS-PCR method is used for identification, which can significantly improve the detection efficiency compared with other methods, facilitate rapid amplification and trace the source of bird's nest products, and reduce labor intensity.

Example 2

This embodiment provides an ARMS-PCR kit for identifying bird's nest bases, including the primer set in Embodiment 1.

Specifically, it contains the first primer set and/or the second primer set; the first primer set includes: upstream outer primer Af/1-553bp-F, downstream outer primer Af/1-553bp-R, upstream inner primer Af /1-A-201bp-F, downstream inner primer Af/1-G-402bp-R; the second primer set includes: upstream outer primer Am-ND2-463bp-F, downstream outer primer Am-ND2-463bp-R, Upstream internal primer Am-ND2-A-317bp-F, downstream internal primer Am-ND2-G-201bp-R.

The ARMS-PCR reaction system is 20 μl, including the following components:

or,

During the use of the ARMS-PCR kit, the ARMS-PCR working procedure is pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30 seconds, annealing at 65°C for 30 seconds, extension at 72°C for 60 seconds, 40 cycles, and finally extension at 72°C for 10 minutes.

Apparently, the above-mentioned embodiments of the present invention are only examples for clearly illustrating the technical solution of the present invention, rather than limiting the specific implementation manner of the present invention. Any modification, equivalent replacement and improvement made within the spirit and principle of the claims of the present invention shall be included in the protection scope of the claims of the present invention.

Claims (10)

1. A primer set for identifying bird's nest base, characterized in that it includes a first primer set and/or a second primer set; the first primer set includes: upstream outer primer Af/1-553bp-F, downstream outer primer Af /1-553bp-R, upstream internal primer Af/1-A-201bp-F, downstream internal primer Af/1-G-402bp-R; the second primer set includes: upstream external primer Am-ND2-463bp-F, The downstream outer primer Am-ND2-463bp-R, the upstream inner primer Am-ND2-A-317bp-F, and the downstream inner primer Am-ND2-G-201bp-R; the sequences are respectively Af/1-553bp-F: TCTAGCAATCATTGAATAATAGCCTGAGC; Af/1-553bp-R: AGAAGGTTAGTAGAGTCAGTTTGGGGTTG; Af/1-A-201bp-F: CACCATCCTCTTCATAACATCCCACA; Af/1-G-402bp-R: GGTGAGGAGGGTTGGGTCTAGTTAC; Am-ND2-463bp-F: CCCATTCCACTTCTGATTTCCAGAAGTCC; Am-ND2-463bp- R: TTTAGGTAGGAAGCCTGTTAGGGGTGGG; Am-ND2-A-317bp-F: TATTTTCTTCTACCACCTTAGGGGGCGGA; Am-ND2-G-201bp-R: CGGACCTGTGTTTGGTTTAGTCCCTCTC.
2. The primer set according to claim 1, wherein the first primer set is used to identify the bird's nest of Java swiftlet, and the second primer set is used to identify the nest of swiftlet.
3. An ARMS-PCR kit for identifying bird's nest bases, characterized in that it contains the primer set according to claim 1.
4. ARMS-PCR kit according to claim 3, is characterized in that, also contains the PCR reagent that is used for amplification, and PCR reaction system comprises following component 2 * tsingke Master Mix, primer set described in claim 1, to be identified Bird's nest DNA, MgCl ₂ , dNTPs, Taq DNA polymerase.
5. ARMS-PCR kit according to claim 3, is characterized in that, its ARMS-PCR reaction system is 20 μ l, comprises following components:

   

   or,

   
6. The ARMS-PCR kit according to claim 5, wherein the ARMS-PCR working procedure is pre-denaturation at 95°C for 5 minutes, denaturation at 95°C for 30s, annealing at 65°C for 30s, extension at 72°C for 60s, and 40 cycles; Finally, extend at 72°C for 10 min.
7. An ARMS-PCR detection method for identifying bird's nest bases is characterized in that it comprises the following steps:

   A1, extracting the DNA of the bird's nest to be identified;

   A2. Design ARMS-PCR primers for amplifying the specific gene DNA, and use the DNA obtained in A1 as a template to configure the ARMS-PCR reaction system;

   A3. Compare whether the ARMS-PCR amplification result corresponds to the expected amplified band of the ARMS-PCR primer used to identify whether the bird's nest base to be identified is the bird's nest base represented by the ARMS-PCR primer.
8. ARMS-PCR detection method according to claim 7, is characterized in that, among the step A2, ARMS-PCR primer is the primer set described in claim 1, and described specific base is Java swiftlet bird's nest and/or big golden silk Bird's nest.
9. The ARMS-PCR detection method according to claim 7, characterized in that, in step A1, the DNA in the bird's nest sample is extracted by the guanidine isothiocyanate method.
10. The use of the primer set described in claim 1 in the preparation of products for identifying bird's nest bases.

Images