CN114959049A - ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof - Google Patents

ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof Download PDF

Info

Publication number
CN114959049A
CN114959049A CN202111412514.4A CN202111412514A CN114959049A CN 114959049 A CN114959049 A CN 114959049A CN 202111412514 A CN202111412514 A CN 202111412514A CN 114959049 A CN114959049 A CN 114959049A
Authority
CN
China
Prior art keywords
arms
primer
pcr
nest
bird
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111412514.4A
Other languages
Chinese (zh)
Inventor
李耿
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Bainian Tongkang Pharmaceutical Group Co ltd
Original Assignee
Bainian Tongkang Pharmaceutical Group Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Bainian Tongkang Pharmaceutical Group Co ltd filed Critical Bainian Tongkang Pharmaceutical Group Co ltd
Priority to CN202111412514.4A priority Critical patent/CN114959049A/en
Priority to PCT/CN2022/074095 priority patent/WO2023092860A1/en
Publication of CN114959049A publication Critical patent/CN114959049A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/686—Polymerase chain reaction [PCR]

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biophysics (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention discloses an ARMS-PCR primer group for identifying an edible bird's nest primordium, a kit and a detection method and application thereof, belonging to the technical field of edible bird's nest primordium detection. Compared with the sensory identification and the physicochemical property identification which are commonly used in the prior art, the identification of ARMS-PCR on the gene sequence level is more accurate and sensitive, meanwhile, compared with other common molecular biology detection methods, the operation is simpler, excessive complex equipment, pretreatment and other processes are not needed, the accuracy and the sensitivity are both realized, the simple operability of ARMS-PCR is ensured, and the method is convenient to put into practical production and use in identification. The ARMS-PCR primers, the kit and the detection method are adopted to identify the cubilose, so that the cubilose detection efficiency in the prior art can be improved, effective and accurate traceability of cubilose products can be realized conveniently, and the labor intensity is reduced.

Description

ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof
Technical Field
The invention relates to the technical field of bird's nest primordium detection, in particular to an ARMS-PCR primer group and a kit for identifying bird's nest primordium, and a detection method and application thereof.
Background
The nidus Collocaliae refers to a nidus Vespae formed by mixing saliva secreted by part of delphinium of delphinidaceae and several kinds of swiftlets of swiftlet genus of Delphiniales. Mainly produced in southeast Asia countries such as Malaysia, Indonesia, Thailand, Burma and the like, and Fujian and Guangdong coastal zones of China. The cubilose contains abundant saccharides, organic acids, free amino acids and a characteristic substance, namely sialic acid, and has certain nutritional value. Specifically, for the bird's nest primitive, different bird's nests have different, especially in different bird's nests have different composition ratios, forms, tastes, etc., as follows: the sialic acid ratio was different. The different bird's nest primordia have distinguishing characteristics, so the identification of the bird's nest primordia is necessary. The identification of the bird's nest primordium is not only beneficial to scientific research of the bird's nest, but also convenient to identify bird's nest products circulating in the market, avoids counterfeit and shoddy products circulating in the market, and has good promotion effect on the whole production and sale environment of the bird's nest.
However, the existing bird's nest primordial identification method still has a plurality of defects, and the accurate and rapid bird's nest identification cannot be realized. For example, sensory identification and physicochemical property identification are commonly adopted in the prior art, and although the method is simple, the accuracy is insufficient, the sensitivity is low and the reproducibility is poor. Therefore, the prior art needs a high-accuracy, high-sensitivity and reproducible method for identifying nidus Collocaliae primordium to make up for the disadvantages of the common identification methods in the prior art.
The four-primer amplification hindered mutation system PCR (Tetra-primer ARMS-PCR) technology is a Single Nucleotide Polymorphism (SNP) typing technology developed on the basis of common PCR, and the amplification hindered mutation system is invented by Newton et al in 1989, and the basic principle of the technology is that a primer with a 3' end mismatch is extended at a speed lower than that of a normal end pairing primer because Taq DNA polymerase lacks the activity of 3' → 5' exonuclease; when the number of mismatched bases reaches a certain number, the 3 'terminal base cannot continue to extend due to the difficulty in phosphodiester bond formation, thereby terminating the reaction, i.e., failing to obtain an amplified band of a specific length, indicating that there is no corresponding mutation between the template DNA and the 3' terminal of the primer. If the result of the polymerase chain reaction shows a specific length of an amplified band, it indicates that there is a mutation corresponding to the 3' -end of the primer on the template DNA. Introducing mismatched bases to the penultimate or third position of the 3 'end of the primer, and introducing a weak mismatched C/A and C/T in the primer if the strongest mismatch of the 3' end of the mismatched bases is G/A and C/T; if the medium mismatch at the 3' end of the mismatched base is (A/A, C/C, G/G and T/T), a medium mismatch is introduced in the primer. The Tetra-primer ARMS-PCR technology needs to design 4 different primers according to specific SNP sites, respectively design 2 inner primers at two sides of the SNP sites and respectively design 2 outer primers at different distances at the upstream and downstream of the SNP sites. In conventional Tetra-primer ARMS-PCR, the amplification product is generally detected directly by electrophoresis. The sizes of specific bands obtained in an electropherogram are different because the distances from the upstream primer and the downstream primer to mutation points in the Tetra-primer ARMS PCR reaction are different. The genotype of an individual can be directly judged according to the blocking type of the specific primer at the 3' end and the size and the existence of the band in the electropherogram.
The application aims to combine the ARMS-PCR characteristics, solve the defects of the common identification method in the technical field of bird's nest primordium identification in the prior art, and provide an accurate, rapid and sensitive identification method and related primers, reagents and the like.
Disclosure of Invention
The invention aims to overcome at least one defect of the prior art, provides an ARMS-PCR primer group for identifying the bird's nest primordium, a kit, a detection method and application thereof, realizes the identification of the bird's nest primordium by combining the ARMS-PCR technology, has simple operation, quick identification, high sensitivity and high accuracy, is convenient for quickly tracing the bird's nest product, and effectively reduces the labor intensity.
The invention aims to overcome the difficulty of the conventional morphological identification and provides a primer group for identifying the bird's nest primordium.
The above object of the present invention is achieved by the following scheme:
a primer group for identifying the bird's nest primordium comprises a first primer group and/or a second primer group; the first primer set includes: an upstream outer primer Af/1-553bp-F, a downstream outer primer Af/1-553bp-R, an upstream inner primer Af/1-A-201bp-F and a downstream inner primer Af/1-G-402 bp-R; the second primer set includes: an upstream outer primer Am-ND2-463bp-F, a downstream outer primer Am-ND2-463bp-R, an upstream inner primer Am-ND2-A-317bp-F and a downstream inner primer Am-ND2-G-201 bp-R; the sequences are respectively Af/1-553 bp-F: TCTAGCAATCATTGAATAATAGCCTGAGC; af/1-553 bp-R: AGAAGGTTAGTAGAGTCAGTTTGGGGTTG; Af/1-A-201 bp-F: CACCATCCTCTTCATAACATCCACA, respectively; Af/1-G-402 bp-R: GGTGAGGAGGGTTGGGTCTAGTTAC, respectively; Am-ND2-463 bp-F: CCCATTCCACTTCTGATTTCCAGAAGTCC, respectively; Am-ND2-463 bp-R: TTTAGGTAGGAAGCCTGTTAGGGGTGGG, respectively; Am-ND2-A-317 bp-F: TATTTCTTCTACCACCTTAGGGGGCGGA, respectively; Am-ND2-G-201 bp-R: CGGACCTGTGTTTGGTTTAGTCCCCTC are provided.
In one or more embodiments of the invention, the bird's nest samples from different sources are identified, the first primer set can effectively identify the Java swiftlet nest therein, the second primer set can effectively identify the big swiftlet nest therein, and the first primer set and the second primer set are matched to effectively identify the biological primordium of the bird's nest even if the bird's nest sources are different. Through the primer group in the application, the biological primordium of the cubilose sample can be effectively identified, the primer group is applied to amplification, and the identification mode is more accurate than the existing modes such as manual identification, physicochemical index identification and the like, the operation is convenient, the efficiency is high, and the primer group can be conveniently put into practical production and used in research, including product traceability, cubilose genome research and the like.
Preferably, the first primer group is used for identifying the bird's nest of swiftlet swallow javanica, and the second primer group is used for identifying the bird's nest of swiftlet swallow macrostoma. In one embodiment of the invention, whether the bird's nest sample is the swiftlet bio-foundation corresponding to the first primer group or the swiftlet bio-foundation corresponding to the second primer group is respectively identified by detecting whether the bird's nest sample DNA is successfully amplified under the first primer group and the second primer group and the characteristics of the amplified strips.
The primer group can also be understood as the identification of two primer groups independently or cooperatively, for example, a primer combination for identifying the bird's nest of the swallow javanica comprises four specific primers, wherein the four specific primers are respectively an upstream outer primer Af/1-553bp-F, a downstream outer primer Af/1-553bp-R, an upstream inner primer Af/1-A-201bp-F and a downstream inner primer Af/1-G-402bp-R, and the primer sequences of the four specific primers are respectively: af/1-553 bp-F: TCTAGCAATCATTGAATAATAGCCTGAGC, respectively; af/1-553 bp-R: AGAAGGTTAGTAGAGTCAGTTTGGGGTTG; Af/1-A-201 bp-F: CACCATCCTCTTCATAACATCCACA; Af/1-G-402 bp-R: GGTGAGGAGGGTTGGGTCTAGTTAC, respectively; and/or, a primer combination for identifying swiftlet nest comprises four specific primers, wherein the four specific primers are respectively an upstream outer primer Am-ND2-463bp-F, a downstream outer primer Am-ND2-463bp-R, an upstream inner primer Am-ND2-A-317bp-F and a downstream inner primer Am-ND2-G-201bp-R, and the primer sequences of the four specific primers are respectively as follows: Am-ND2-463 bp-F: CCCATTCCACTTCTGATTTCCAGAAGTCC, respectively; Am-ND2-463 bp-R: TTTAGGTAGGAAGCCTGTTAGGGGTGGG, respectively; Am-ND2-A-317 bp-F: TATTTCTTCTACCACCTTAGGGGGCGGA, respectively; Am-ND2-G-201 bp-R: CGGACCTGTGTTTGGTTTAGTCCCCTC are provided.
The invention further aims to provide an ARMS-PCR kit for identifying the bird's nest primordium, which contains the primer group. The kit is convenient to combine common PCR equipment and reagents to realize the identification of the bird's nest primordium.
Preferably, the ARMS-PCR kit further comprises PCR reagents for amplification. In one or more embodiments of the present invention, the sample DNA is amplified by ARMS-PCR and the discrimination process is performed based on the amplification result of the primers. The kit contains corresponding PCR reagents for amplification, which is beneficial to preparing main required materials in one step, and the main reagents required by identification can be met through a single kit.
Preferably, the PCR reaction system comprises the following components of2 Xtsingke Master Mix, the primer group, the bird's nest DNA to be identified and MgCl 2 、dNTPs、Taq DNA polymerase。ARMS-PCR。
Preferably, the concentration of each primer in the primer set in the PCR reaction system is the same. In one or more embodiments of the present invention, the first primer set is applied to a PCR system in which the concentrations of the primers of the first primer set are the same, and the second primer set is applied to a PCR system in which the concentrations of the primers of the second primer set are the same.
Preferably, the PCR reaction system is 20 μ l, and comprises the following components:
Figure BDA0003374701310000041
in one or more embodiments of the present invention, the first primer set and the second primer set are used for amplification of template DNA by using the PCR system, and an effective amplification band for identification is obtained.
Preferably, the PCR working procedure is pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 65 ℃ for 30s, extension at 72 ℃ for 60s, and 40 cycles; finally, the extension is carried out for 10min at 72 ℃.
The invention also aims to provide an ARMS-PCR detection method for identifying the bird's nest primordium, which comprises the following steps:
a1, extracting DNA of cubilose to be identified;
a2, designing ARMS-PCR primers for amplifying specific primordial DNA, and configuring an ARMS-PCR reaction system by taking the DNA obtained from A1 as a template; if the DNA extracted in the step (1) is taken as a template, the primer group is adopted to prepare a PCR reaction system for PCR amplification;
a3, identifying the bird's nest primordium according to the PCR amplification result, namely comparing whether the ARMS-PCR amplification result corresponds to the expected amplification band of the ARMS-PCR primer so as to identify whether the bird's nest primordium to be identified is the bird's nest primordium represented by the ARMS-PCR primer.
The method for identification described in step a3 is: if the gel has a cubilose primordium specificity strip corresponding to the ARMS-PCR primer, the sample to be identified can be judged to be the cubilose primordium represented by the ARMS-PCR primer; in contrast, it is not the bird's nest primordium represented by ARMS-PCR primers.
Preferably, the ARMS-PCR primer in the step A2 is the primer group, and the specific primer is Java swiftlet nest and/or Dajinsil bird nest.
Preferably, DNA in the bird's nest sample is extracted by a guanidine isothiocyanate method in step A1.
Preferably, step a1 specifically includes the steps of:
a11, adding the ground cubilose into a 1.5ml centrifuge tube, adding 200 mul TE buffer solution, and mixing uniformly;
a12, adding 400 mu l of guanidinium isothiocyanate solution, vortex mixing uniformly, digesting in 55 ℃ water bath for 1h, and continuously and uniformly stirring until the solution is transparent;
a13, adding 300. mu.l Tris-saturated phenol (25:24:1) and 300. mu.l dichloromethane/isoamyl alcohol (24:1), shaking vigorously for 15S, and centrifuging at 13000r/min for 10 min;
a14, taking the supernatant, adding dichloromethane with the same volume, violently shaking for 15S, and centrifuging for 10min at 13000 r/min;
a15, taking the supernatant and the chloroform layer, adding 0.8-time volume of isopropanol, and centrifuging at 12000r/min for 10 min;
a16, discarding the supernatant, adding 1ml 70% ethanol to wash the precipitate; standing at room temperature to completely volatilize residual ethanol;
a17, adding 25uL TE buffer solution to dissolve the DNA precipitate, and storing the DNA sample at-20 ℃.
Preferably, the PCR product is subjected to electrophoresis by using 1-3% agarose gel in the step A3 to obtain the result of whether the band is amplified and the amplified length. More preferably, in the step of electrophoresis: the voltage is 100v, and electrophoresis is carried out for 50 min.
The invention further aims to provide application of the primer group in preparation of products for identifying the bird's nest primordium. Based on the primer group, the bird's nest biological primordium can be effectively identified, so that products containing the primer group or detected by the primer group can be prepared to be put into practical application, and the products comprise a kit, a sequencing platform containing the primer group information and the like.
Compared with the prior art, the invention has the following beneficial effects: compared with the common sensory identification and physicochemical property identification in the prior art, the identification of ARMS-PCR on the gene sequence level is more accurate and sensitive, meanwhile, compared with other common molecular biology detection methods, the method is simpler to operate, does not need too many complicated equipment, pretreatment and other processes, has both accuracy and sensitivity, ensures the simple operability of ARMS-PCR, and is convenient to put into practical production and identification. The ARMS-PCR primers, the kit and the detection method are adopted to identify the cubilose, so that the cubilose detection efficiency in the prior art can be improved, effective and accurate traceability of cubilose products can be realized conveniently, and the labor intensity is reduced.
Drawings
FIG. 1 shows the electrophoresis results of ARMS-PCR primers on P.javanicus. Wherein: m, DNA marker (2000bp), samples No. 1-9 are respectively: n5, N6, N7, N8, N9, N14, N11, N13, N19, sample nos. 10-18 are: d1, D2, D3, Z1, Z2, Z3, X1, X2, X3; specifically, 1 represents N5; 2 represents N6; 3 represents N7; 4 represents N8; 5 represents N9; 6 represents N14; 7 represents N11; 8 represents N13; 9 represents N19; 10 represents D1; 11 represents D2; 12 represents D3; 13 represents Z1; 14 represents Z2; 15 represents Z3; 16 represents X1; 17 represents X2; 18 represents X3. Wherein N9, N11, N13 and N19 are Thailand swallow large golden swallow.
FIG. 2 shows the electrophoresis results of ARMS-PCR primers for swiftlet. Wherein: m: DNA Maker (2000 bp); sample No. 1 is: n9; sample No. 2 is: n11; sample No.3 is: n5; sample No. 4 was N13; 5 represents N19; sample No. 6 was N6. Wherein N5 and N6 are samples of Potiria javanica.
Detailed Description
It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments according to the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.
The present invention will now be further described with reference to specific examples, which are provided for the purpose of illustration only and are not to be construed as limiting the invention. The test samples and test procedures used in the following examples include the following (generally, according to the conventional conditions or according to the conditions recommended by the reagent company if the specific conditions of the experiment are not specified in the examples; and reagents, consumables and the like used in the following examples are commercially available unless otherwise specified).
Example 1
Experimental materials (one):
the bird's nest samples used in this example are shown in table 1, wherein the bird's nest samples are all identified samples.
Table 1: selecting bird's nest samples from different swiftlet genera (Aerodramus)
Figure BDA0003374701310000071
(II) experimental reagents:
guanidine isothiocyanate (Solarbio, # Lot.No.330M043), Tris-saturated phenol (LEAGENE, Inc. # Lot.0729A19), sodium acetate solution (LEAGENE, Inc. # Lot.1029A19), TS-GelRed nucleic acid gel dye (available from Beijing Ongkexin Biotech, Inc.), 2 XTSinkKEK Mix (blk, Beijing Okexin Biotech, Inc.), DL2000 DNA Marker (available from Beijing Okexin Biotech, Inc.), Agarose Agarose (available from Invitrogen, Lot.16500500), TAE buffer (available from Beyone, ST716), 1 XTE pH8.0 solution (available from Biosharp, Lot.69035520), DTT solution (available from Beyoton, Lot.81020), Tris-Bioshy reagent (available from northern blotting, Inc. # Lot.0420), Tris-GelRed reagent (available from northern blotting, Inc. # Lot.100, Inc. # Tris-GelRed reagent, Tris-GelRed reagent (available from Beijing, Inc. # Lot.048.0, Tris-Biotechnology, Inc.;, Inc. # Tris-Lot, Inc. # 2, Inc. # Lot.500, Tris-Lot, Inc. # III, Tris-Lot.500, Tris-Lot, Tris-Lot.500, Tris-A buffer, Tris-K.500, Tris-L, Tris-K.3, Tris-L, Tris-L, L-L, PVP-40 (purchased from Jianyang Biotechnology Co., Ltd.), sodium hydroxide (purchased from Tianjin Maoji chemical reagent factory), primers (Af/1-553bp-Foward, Af/1-553bp-Reverse, Af/1-A-201bp-Foward, Af/1-G-402bp-Reverse, Am-ND2-463bp-Foward, Am-ND2-463bp-Reverse, Am-ND2-A-317bp-Foward, Am-ND2-G-201bp-Reverse, manufactured by Beijing Pongson Biotechnology Co., Ltd.).
(III) experimental apparatus:
model H1850R high speed refrigerated centrifuge (available from Hunan Changshan instruments Ltd.), Sartorius BSA224S analytical balance (available from Sadoris science instruments Ltd.), ultrapure water system (available from Mercury Ribobo laboratory facilities, Shanghai, Ltd.), thermostat Water bath model HH-S (available from Steud instruments Ltd.), and model S1000TM Thermal Cycel PCR instrument available from Yuehan instruments LtdBIO-RAD, Universal Hood II gel imager (available from BIO-RAD, China Co.), and electrophoresis apparatus (Power Pac) TM Basic 041BR125814) (available from BIO-RAD, China), microwave oven (PTOF23P-a5(so)) (available from Galanz), ultrasensitive full white motion imaging (available from Punson Biotech, Inc.), SYNERGY H1 full-automatic multifunctional microplate reader (available from Biotek, Inc.).
(IV) procedure of experiment
A1, DNA extraction
25mg of each bird's nest sample shown in Table 1 was sampled and DNA was extracted by the guanidine isothiocyanate method. Grinding each bird's nest sample by liquid nitrogen, and weighing 25-30 mg; the method comprises the following specific steps:
(1) adding ground nidus Collocaliae into 1.5mL centrifuge tube, adding 200 μ L TE buffer (pH8.0, 1 × TE buffer: 10mM pH8.0 Tris-HCl, 0.1mM EDTA to 100mL), and mixing;
(2) adding 400 mu L of guanidinium isothiocyanate solution, vortex mixing, digesting in 55 ℃ water bath for 1h, and continuously and uniformly stirring until the solution is transparent;
(3) adding 300. mu.L of Tris-saturated phenol (purchased from Beijing Rayleigh Biotech Co., Ltd., volume ratio of phenol to chloroform to isoamyl alcohol is 25:24:1) and 300. mu.L of dichloromethane/isoamyl alcohol (calculated by volume ratio of dichloromethane/isoamyl alcohol is 24:1), violently shaking for 15s, and centrifuging at 13000r/min for 10 min;
(4) taking the supernatant, adding dichloromethane with the same volume, violently shaking for 15s, and centrifuging for 10min at 13000 r/min;
(5) taking the supernatant and the chloroform layer, adding isopropanol with the volume of 0.8 time, and centrifuging at 12000r/min for 10 min;
(6) discarding the supernatant, adding 1mL of 70% (v/v) ethanol, washing the precipitate, and standing at room temperature to completely volatilize the residual ethanol;
(7) the DNA precipitate was dissolved by adding 25. mu.L of TE buffer, and the DNA sample was stored at-20 ℃.
A2, ARMS-PCR primer design
Nucteotide downloads the ND2 sequences of Aerodramus fucifogus (swiftlet javanicus) and Aerodramus maximus (swiftlet grand) in NCBI, and ARMS-PCR primers (as shown in Table 2) were designed using Primer preimer 5.0 software, which identified the bird's nest primordium in Table 1.
Table 2: ARMS-PCR primers
Figure BDA0003374701310000091
A3, ARMS-PCR amplification and product electrophoresis identification
(1) ARMS-PCR amplification system and program
The PCR reaction system was 20. mu.L, 2 XTsinge Master Mix 7.5. mu.L, four primers each 0.5. mu.L (10. mu.M), 7. mu.L of DNA template (concentration 100 ng/. mu.L), MgCl 2 mu.L (3mM), 2. mu.L dNTPs (0.4mM), 0.5. mu.L Taq DNA polymerase (1.25U/25. mu.L), and the balance ddH 2 O。
And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 5 min; denaturation at 95 ℃ for 30s, annealing at 65 ℃ for 30s, and extension at 72 ℃ for 60s for 40 cycles; extension for 10min at 72 ℃ after the last cycle. Agarose gel electrophoresis, 1.5% agarose TAE gel electrophoresis, 1 × TAE solution preparation, voltage 100V, 50min, in gel imaging instrument under the observation of electrophoresis results. This technique PCR reaction was performed for 95 minutes, and then 1.5% agarose was used to detect the bands, and the total procedure was performed for 145 minutes.
(2) The ARMS-PCR amplification system and the program are applied to ARMS-PCR primers (an upstream outer primer Af/1-553bp-F, a downstream outer primer Af/1-553bp-R, an upstream inner primer Af/1-A-201bp-F and a downstream inner primer Af/1-G-402bp-R) for identifying the swiftlet javanica and 18 samples in the table 1 to implement the identification process. Specifically, the samples in Table 1 include 9 samples in the south (N5-N9, N11, N13, N14, N19), 3 samples in the middle (Z1-Z3), 3 samples in the east (D1-D3), and 3 samples in the west (X1-X3).
The ARMS-PCR amplification and product electrophoresis identification processes are completed, the results are shown in figure 1, and the lengths of the sample electrophoresis amplification bands of N5, N6, N7, N8, N14, D1-D3, Z1-Z3 and X1-X3 are 533bp, 402bp and 201 bp; the N9, N11, N13, N19 samples had no bands. The results are consistent with the identified results in table 1.
(3) The ARMS-PCR amplification system and the program are applied to ARMS-PCR primers (an upstream outer primer Am-ND2-463bp-F, a downstream outer primer Am-ND2-463bp-R, an upstream inner primer Am-ND2-A-317bp-F and a downstream inner primer Am-ND2-G-201bp-R) for identifying the swiftlet and 6 samples (comprising N9, N11, N5, N13, N19 and N6) in the table 1 to implement the identification process.
The ARMS-PCR amplification and product electrophoresis identification processes are completed, and the results are shown in FIG. 2, wherein 1 represents N9, 2 represents N11, 3 represents N5, 4 represents N13, 5 represents N19, 6 represents N6, the electrophoresis product N9, N11, N13 and N19 samples respectively have the lengths of electrophoresis amplification bands of 463bp, 317bp and 201bp, and the N5 and N6 samples have no bands. The results are consistent with the identified results in table 1.
The ARMS-PCR primer set and the corresponding detection method can effectively identify the bird's nest primordium, and have high accuracy and reproducibility. The results of the identification of the javanica and the swiftlet are consistent with the identified results, which shows that the ARMS-PCR primers and the detection method provided by the application have practicability, are convenient to use in the actual identification process, and realize the identification of the bird's nest primordium. And the ARMS-PCR method is adopted for identification, so that the detection efficiency can be obviously improved compared with other methods, rapid amplification and bird's nest product tracing are facilitated, and the labor intensity is reduced.
Example 2
This example provides an ARMS-PCR kit for identifying nidus Collocaliae primordia, comprising the primer set of example 1.
Specifically, the kit comprises a first primer group and/or a second primer group; the first primer set includes: an upstream outer primer Af/1-553bp-F, a downstream outer primer Af/1-553bp-R, an upstream inner primer Af/1-A-201bp-F and a downstream inner primer Af/1-G-402 bp-R; the second primer set includes: an upstream outer primer Am-ND2-463bp-F, a downstream outer primer Am-ND2-463bp-R, an upstream inner primer Am-ND2-A-317bp-F and a downstream inner primer Am-ND2-G-201 bp-R.
The ARMS-PCR reaction system is 20 mu l, and comprises the following components:
Figure BDA0003374701310000101
Figure BDA0003374701310000111
in the using process of the ARMS-PCR kit, the ARMS-PCR working procedure comprises pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 65 ℃ for 30s, extension at 72 ℃ for 60s and 40 cycles; finally, extension is carried out for 10min at 72 ℃.
It should be understood that the above-mentioned embodiments of the present invention are only examples for clearly illustrating the technical solutions of the present invention, and are not intended to limit the specific embodiments of the present invention. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present invention claims should be included in the protection scope of the present invention claims.

Claims (10)

1. A primer group for identifying the bird's nest primordium is characterized by comprising a first primer group and/or a second primer group; the first primer set includes: an upstream outer primer Af/1-553bp-F, a downstream outer primer Af/1-553bp-R, an upstream inner primer Af/1-A-201bp-F and a downstream inner primer Af/1-G-402 bp-R; the second primer set includes: an upstream outer primer Am-ND2-463bp-F, a downstream outer primer Am-ND2-463bp-R, an upstream inner primer Am-ND2-A-317bp-F and a downstream inner primer Am-ND2-G-201 bp-R; the sequences are respectively Af/1-553 bp-F: TCTAGCAATCATTGAATAATAGCCTGAGC; af/1-553 bp-R: AGAAGGTTAGTAGAGTCAGTTTGGGGTTG, respectively; Af/1-A-201 bp-F: CACCATCCTCTTCATAACATCCACA, respectively; Af/1-G-402 bp-R: GGTGAGGAGGGTTGGGTCTAGTTAC; Am-ND2-463 bp-F: CCCATTCCACTTCTGATTTCCAGAAGTCC, respectively; Am-ND2-463 bp-R: TTTAGGTAGGAAGCCTGTTAGGGGTGGG, respectively; Am-ND2-A-317 bp-F: TATTTCTTCTACCACCTTAGGGGGCGGA, respectively; Am-ND2-G-201 bp-R: CGGACCTGTGTTTGGTTTAGTCCCCTC are provided.
2. The primer set of claim 1, wherein the first primer set is used for identifying the javanica bird nest and the second primer set is used for identifying the swiftlet bird nest.
3. An ARMS-PCR kit for identifying bird's nest primordium, characterized by comprising the primer set of claim 1.
4. The ARMS-PCR kit according to claim 3, further comprising PCR reagents for amplification, wherein the PCR reaction system comprises the following components 2 Xtsingke Master Mix, the primer set according to claim 1, nidus Collocaliae DNA to be identified, MgCl 2 、dNTPs、Taq DNA polymerase。
5. The ARMS-PCR kit according to claim 3, wherein the ARMS-PCR reaction system is 20 μ l, and comprises the following components:
Figure FDA0003374701300000011
or the like, or, alternatively,
Figure FDA0003374701300000021
6. the ARMS-PCR kit according to claim 5, wherein the ARMS-PCR working procedure is pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 65 ℃ for 30s, extension at 72 ℃ for 60s, and 40 cycles; finally, the extension is carried out for 10min at 72 ℃.
7. An ARMS-PCR detection method for identifying bird's nest primordium is characterized by comprising the following steps:
a1, extracting DNA of cubilose to be identified;
a2, designing ARMS-PCR primers for amplifying specific primordial DNA, and configuring an ARMS-PCR reaction system by taking the DNA obtained from A1 as a template;
a3, comparing whether the ARMS-PCR amplification result corresponds to the expected amplification band of the ARMS-PCR primer to identify whether the bird nest primordium to be identified is the bird nest primordium represented by the ARMS-PCR primer.
8. The ARMS-PCR detection method according to claim 7, wherein the ARMS-PCR primer in the step A2 is the primer set according to claim 1, and the specific primers are bird nest of Jack horse and bird nest and/or bird nest of Dasychia.
9. The ARMS-PCR detection method of claim 7, wherein DNA in the bird's nest sample is extracted by guanidinium isothiocyanate in step A1.
10. Use of the primer set of claim 1 for the preparation of a product for identifying an nidus Collocaliae origin.
CN202111412514.4A 2021-11-25 2021-11-25 ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof Pending CN114959049A (en)

Priority Applications (2)

Application Number Priority Date Filing Date Title
CN202111412514.4A CN114959049A (en) 2021-11-25 2021-11-25 ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof
PCT/CN2022/074095 WO2023092860A1 (en) 2021-11-25 2022-01-26 Arms-pcr primer set, kit and detection method for identifying gene of cubilose, and use of arms-pcr primer set

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111412514.4A CN114959049A (en) 2021-11-25 2021-11-25 ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof

Publications (1)

Publication Number Publication Date
CN114959049A true CN114959049A (en) 2022-08-30

Family

ID=82975000

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111412514.4A Pending CN114959049A (en) 2021-11-25 2021-11-25 ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof

Country Status (2)

Country Link
CN (1) CN114959049A (en)
WO (1) WO2023092860A1 (en)

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101768635B (en) * 2009-01-05 2012-01-11 中南大学 ARMS-PCR method for mtDNA allelic gene typing and point mutation detecting
CN106636345A (en) * 2016-10-28 2017-05-10 肇庆学院 Real-time fluorescent quantitative PCR (polymerase chain reaction) identification reagent kit and identification method for bird's nest products
CN108103210A (en) * 2018-01-29 2018-06-01 山西中医药大学 A kind of triple real time fluorescent PCR methods for differentiating the bird's nest true and false

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
DONGYONG LV等: "Genetic Identification of Edible Bird\"s Nest in Thailand Based on ARMS-PCR", 《FRONTIERS IN GENETICS》 *

Also Published As

Publication number Publication date
WO2023092860A1 (en) 2023-06-01

Similar Documents

Publication Publication Date Title
CN106434949A (en) Acipenser dabryanus microsatellite marker as well as screening method and application of acipenser dabryanus microsatellite molecular marker
CN107868834A (en) The real-time quantitative PCR detection primer group and method of a kind of acipenser dabryanus sexual gland difference expression gene
CN105779611B (en) High-throughput method for detecting transgenic crop elements and strains by multiplex enrichment quantitative PCR (ME-qPCR)
CN112239794B (en) Primer pair, probe and kit for detecting novel coronavirus SARS-CoV-2 and application thereof
CN113881789A (en) Probe and primer pair composition for detecting cryptococcus as well as detection method and application
CN109486964B (en) Microsatellite rapid detection method for individual identification and paternity test of donkeys
CN111254204A (en) SNP (Single nucleotide polymorphism) marker related to growth speed of basha fish and application thereof
CN112575094B (en) InDel marker for identifying northern subspecies, florida subspecies and hybrids thereof of micropterus salmoides and application thereof
CN117070673B (en) LAMP detection primer group for pangolin alpha coronavirus and application thereof
CN111534603B (en) Method for identifying aedes albopictus by using fluorescent RPA
CN110878376B (en) SSR molecular marker primer for identifying dendrobium huoshanense and application thereof
CN110527743B (en) Polymorphic molecular marker for identifying Xinjiang color cotton variety and application
CN114959049A (en) ARMS-PCR primer group and kit for identifying bird's nest primordium, detection method and application thereof
JP2007037468A (en) Method for discriminating variety of rice by using microsatelite marker
CN110878380B (en) Primer composition, kit and method for detecting vesicular stomatitis virus Indiana type and new Jersey type
CN104342489A (en) Method for detecting genotype of chicken beard
CN110093429B (en) High-flux quantitative detection kit for diarrheal pathogenic bacteria
CN107245521B (en) Primer and probe sequence for LAMP-LFD detection of heterodera simplicissima/heterodera pekinensis
CN108796090A (en) The kit and detection method of sheep material in a kind of detection food
CN107435064B (en) qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting harmful golden algae in chlorella culture
CN106755392B (en) qPCR (quantitative polymerase chain reaction) method for rapidly and quantitatively detecting coelomacter in algae culture
JP6853523B2 (en) PCR using helicase
CN109852706A (en) The kit of duck derived components and its application in a kind of Rapid identification food
CN117230184B (en) Nucleic acid combination for detecting Alzheimer disease gene based on time-of-flight nucleic acid mass spectrometry technology and application
CN110894537B (en) PCR primer, kit and method for identifying cordyceps sinensis and commodity authenticity thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20220830