CN112159865A - Indel mark related to red rose petals and molecular method for identifying red rose petals - Google Patents
Indel mark related to red rose petals and molecular method for identifying red rose petals Download PDFInfo
- Publication number
- CN112159865A CN112159865A CN202011101270.3A CN202011101270A CN112159865A CN 112159865 A CN112159865 A CN 112159865A CN 202011101270 A CN202011101270 A CN 202011101270A CN 112159865 A CN112159865 A CN 112159865A
- Authority
- CN
- China
- Prior art keywords
- red
- rose
- indel
- seq
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides Indel markers related to red rose petals and a molecular method for identifying the red rose petals. The nucleotide sequence of the Indel marker is shown as SEQ ID No. 1. The molecular method for identifying the red petals of the Chinese rose comprises the steps of separating and extracting genome DNA of Chinese rose materials to be identified; PCR was performed using Indel-labeled specific primers, followed by electrophoresis to determine whether an Indel band was present. When an Indel strip exists, the variety is red Chinese rose; without Indel bands, the variety is not a red rose, and may be a white, green or yellow rose. According to the method, red and non-red Chinese rose varieties before the flowering phase can be rapidly distinguished through unique Indel marks of the red Chinese rose petals, so that technical support is provided for molecular assisted breeding of Chinese rose flower colors, and particularly for rapid selection of the Chinese rose flower colors at the seedling phase.
Description
Technical Field
The invention belongs to the field of agricultural breeding, relates to a mark and a method for identifying red rose petals, and particularly relates to an Indel mark related to the red rose petals and a molecular method for identifying the red rose petals.
Background
China rose (Rosa L.) belongs to the genus Rosa of the family Rosaceae, and is one of important woody ornamental flowers. Is also one of the most prominent cut flowers and pot flowers in the world. The Chinese rose is rich in flower color, such as red, white, green, yellow, orange, pink, blue, compound color and the like, the flower color is mainly determined by anthocyanin, carotenoid and chlorophyll, and the anthocyanin is mainly determined by red Chinese rose petals. It is a water-soluble pigment, which is present in specific tissues and cells in plants, such as the vacuole of plant cells, and is a secondary metabolite produced by plants. Anthocyanin is used by regulatory and structural genes together to regulate The synthesis and accumulation of anthocyanin on The molecular level (Hichri I., Barrieu F., Bogs J., Kappel C., Delrot S., and Lauvergeat V.Recent Advances in The transgenic regulation of The mutant biochemical pathway. Journal of Experimental Botany,2011,62(8): 2465-type 2483; Jin W., Wang H., Li.M., Wang J., Yang Y., Zhang X., Yan G., Zhang H., Liu J., and Zhang K.R 2R3MYB transfer vector P.10.1. antibiotic J., J.S.J., J., J.R.J., and J.J., J.Biocement, J.H., J., J.S.J., and J.J.Biocement, J.J., J.12. cement, J.H., J.S.J. ,2020,18,1169-1184). Anthocyanins determine the color of fruits and also the color of ornamental petals (Allan et al, MYB transcription factors at color outer from trees in Plant Science,2008,13: 99-102). The color of the petals of the rose is an important ornamental feature, and is the result of long-term natural selection and artificial selection (Raymond O., Gouzy J., Just J., Badouin H., et al, the Rosa genome provides new insights into the society of model roses Nature genetics,2018,50:772 & 777; Hibrand S L., Ruttink T., Hamama L., Kirov I., et al, A high-quality genome sequence of Rosa chinensis to extract colours, 2018.4:473 & 484). The Chinese rose flower color is very rich, and genetically determines the color of Chinese rose petals. At the DNA level, no relevant report is found on how to distinguish the roses with red petals.
Disclosure of Invention
In order to solve the above problems, it is an object of the present invention to provide an Indel marker associated with red petals of a rose, a sequence having the Indel marker, and a primer, wherein the red rose is obtained when the Indel marker is included in the rose.
The second object of the present invention is to provide the use of the above Indel marker related to red petals of a rose and primers for screening a rose having red petals, and to screen whether a seedling-stage rose is a red rose by identifying whether the rose has the Indel marker.
The third purpose of the invention is to provide a molecular method for identifying the red petals of the Chinese rose, which provides a method for distinguishing the red Chinese rose through Indel marks related to the red petals of the Chinese rose, and particularly provides technical support for the auxiliary selection of the Chinese rose in the seedling stage.
In order to achieve the aim, the invention provides an Indel marker related to red petals of Chinese rose, and the nucleotide sequence of the Indel marker is shown as SEQ ID No. 1.
The invention also provides a sequence with Indel marks related to red petals of Chinese roses, and the sequence is shown as SEQ ID No. 2.
The invention also provides the primer with the sequence related to red petals of Chinese rose Indel, wherein the nucleotide sequence (5'→ 3') of the upstream sequence primer in the primer group is shown in SEQ ID No. 3: GTTGGTGCACCAGATCAAACAATTGGTGC, the nucleotide sequence of the downstream sequence primer (5'→ 3') is set forth in SEQ ID No. 4: GCCATACTAGAGCCCACATGTAAC, respectively.
The invention also provides a molecular method for identifying the red petals of the Chinese rose, which comprises the following steps:
1) taking leaves of the Chinese rose variety to be identified, and separating and extracting genome DNA;
2) taking the genomic DNA extracted in the step 1) as a template, and carrying out PCR amplification by adopting primers SEQ ID No.3 and SEQ ID No. 4;
3) and (3) gel electrophoresis detection: and (3) carrying out gel electrophoresis on the amplified product, taking out the gel, observing the amplified fragment under an ultraviolet lamp, wherein the variety with the strip of SEQ ID No.2 is the red petal Chinese rose variety.
Wherein, the amplification system of the PCR reaction in the step 2) is as follows: template genomic DNA 3.5. mu.L at a concentration of 20 ng/. mu.L, 10 XPCR buffer 2.5. mu.L, 25mM MgCl22.5 μ L, 1 μ L of 2.5mM dNTPs, 1 μ L of 10 μ M upstream primer, 1 μ L of 10 μ M downstream primer, 0.2 μ L of 1U Taq enzyme, and water to make up to 25 μ L;
the reaction conditions of the PCR reaction are as follows:
PCR reaction procedure: 5min at 95 ℃; 35 cycles of 95 ℃ for 20s, 55 ℃ for 30s, 72 ℃ for 30 s; 5min at 72 ℃.
The invention has the beneficial effects that:
the invention provides an Indel mark related to red rose petals and a molecular method for identifying the red rose petals by using the Indel mark. The method has simple operation technology and easy popularization, is beneficial to carrying out Chinese rose molecule assisted breeding, advances seedling breeding, saves land and improves breeding efficiency.
Drawings
FIG. 1 is a photograph of red rose variety lunar red and white rose variety Tiantan white.
FIG. 2 is a photograph of the DNA electrophoresis of the leaf genome of the extracted varieties of the monthly rose and the extracted varieties of the Tiantan white rose.
FIG. 3 is a diagram showing the results of electrophoresis of Indel sequences of PCR amplification products of a variety of Rosa chinensis and a variety of Rosa chinensis of Tiantan white.
FIG. 4 is an alignment of Indel-containing sequences from red rose moon red and white rose Tiantan white.
FIG. 5 alignment of sequences on both sides of the lunar Red Indel marker sequence with the sequence of the Tiantan white band
FIG. 6 is a diagram showing the results of electrophoresis in which Indel sequences were amplified from the filial generation of the rose cultivar of rosewood and the rose cultivar of Tiantan white rose for identification.
FIG. 7 is a diagram showing the results of electrophoresis in identifying by amplifying Indel sequences between rose varieties using the method of the present invention.
Detailed Description
The following detailed and complete description of the embodiments of the present invention is provided to enable those skilled in the art to more easily understand the advantages and features of the present invention, and to clearly and clearly define the scope of the present invention.
The Indel marker related to the red petals of the Chinese rose provided by the invention is positioned at the position of 60020335-60020482 of the chromosome 7 of the Chinese rose genome, and the nucleotide sequence is shown as SEQ ID No. 1: AAATGAATGCTTACTTTCGGAAGTCCTTGTTCTGACCTGTTGGTCTGACGTTATTAGTGGGTCAATTGTGGCTCCTGTTTGTATCGTTCATACCACTTGTAACACTTCCGTATGAATGAAATCATTTGATCAAAATGAATGCTTACTT are provided.
If the Indel marker is included, the rose variety is a red rose variety, and if the Indel marker is not included, the rose variety is a non-red rose variety, that is, a white rose variety, a green rose variety, a yellow rose variety, or the like may be included.
Because the amplified fragment of the Indel marker sequence shown in SEQ ID No.1 is too short to be distinguished from a primer dimer, a certain fragment length is extended upstream and downstream of the Indel marker sequence to obtain a nucleotide sequence shown in SEQ ID No.2, and the length is 452 bp.
Wherein, the underlined part is an Indel marker sequence shown in SEQ ID No.1, and the upper-case italic parts at the two ends of the sequence are respectively complementary sequences of an upstream primer sequence (SEQ ID No.3) and a downstream primer sequence (SEQ ID No. 4).
SEQ ID No.2：GTTGGTGCACCAGATCAAACAATTGGTGCTCCTCCCTCCATCTGTTGTGAAAATGAGAAATGGAGCGGAATTGCAAAGCTGAAGAAGTGCGGGACCCTGTCTTGTTTTGCTAAATAGAGTTGAGAATTAAGTCGTTAGCAACTACTACTGCGCCTTTAGAAAGCTAAATTGACACTCATAAATGTCTTTTTTTTTTTCCTAACATTCTAATATATTTaaatgaatgcttacttTCGGAAGTCCTTGTTCTGACCTGTTGGTCTGACGTTATTAGTGGGTCAATT GTGGCTCCTGTTTGTATCGTTCATACCACTTGTAACACTTCCGTATGAATGAAATCATTTGATCAaaatgaatgct tacttGAATATGTAAATATGCATGTGGTTTAGGGTTAGGGATATTCTTTTCGATGGAATCAAAAGAGGGTTACATGTGGGCTCTAGTATGGC
Materials:
1. the Chinese rose leaves used in the examples were collected from the China rose resource garden of the research institute of forestry and fruit tree in Beijing.
2. The plant genome DNA extraction kit is purchased from Tiangen Biochemical technology (Beijing) Co., Ltd, and has the product model: DP 360.
PCR amplified Taq DNA polymerase was purchased from Biotechnology engineering (Shanghai) Ltd, product No. B600001 with Taq DNA polymerase 5U/. mu.L, 10 XPCR Buffer, 25mM MgCl2。
4. The upstream and downstream primers were synthesized by Biotechnology engineering (Shanghai) Ltd.
Example 1 verification of petal colors of lunar Red and the Temple of heaven white Using the methods provided by the invention
Leaves of the Chinese rose varieties of Chinese rose red and Tiantan white are taken as identification materials. The petals of the moon red are red, and the petals of the sky altar white are white, as shown in figure 1.
The specific operation is as follows:
1. the plant genome DNA extraction kit DP360 is used for respectively extracting the genome DNA of the leaves of the moon red and the Tiantan white, the extraction steps are operated according to the kit instructions, and electrophoresis identification is carried out after extraction, and the result is shown in figure 2.
2. Taking the extracted genome DNA as a template, and carrying out PCR reaction amplification by using a PCR amplification kit by using an upstream primer SEQ ID No.3 and a downstream primer SEQ ID No. 4;
the upstream primer sequence (5'→ 3') SEQ ID No.3 is GTTGGTGCACCAGATCAAACAATTGGTGC;
the sequence of the downstream primer (5'→ 3') SEQ ID No.4 is GCCATACTAGAGCCCACATGTAAC;
the PCR reaction composition is: template genomic DNA 3.5. mu.L at a concentration of 20 ng/. mu.L, 10 XPCR buffer 2.5. mu.L, 25mM MgCl22.5 μ L, 1 μ L of 2.5mM dNTPs, 1 μ L of 10 μ M upstream primer, 1 μ L of 10 μ M downstream primer, 0.2 μ L of 1U Taq enzyme, and water to make up to 25 μ L;
PCR reaction procedure: 95 ℃ for 5min, (95 ℃ for 20s, 55 ℃ for 30s, 72 ℃ for 30s) for 35 cycles, 72 ℃ for 5 min;
3. and (3) gel electrophoresis detection: the gel was run on 0.75% agarose gel (EB) for 15 minutes, and the amplified fragments were observed under an ultraviolet lamp, as shown in FIG. 3.
As can be seen from FIG. 3, the rose variety having a rose color of red comprises Indel bands, and the variety is a red rose; and the rose variety with the variety of Tiantan white has no Indel band, and the variety is proved not to be red rose but white rose variety.
In FIG. 3, another band with a small difference is carried by lunar red and Tiantan white, sequencing analysis is carried out on the band of Tiantan white, the length of the sequence is 320bp, and the sequence obtained by sequencing is shown as SEQ ID No. 5:
GTTGGTGCACCAGATCAAACAATTGGTGCTCCTCTCTCCATCTGTTGTGAAAATGAGAAATGGAGTGGAATTGCAAAGCTGAAGAAGTTCGGGACCTTATCTTGTTTTGCTAAATAGAGtTGAGAATTAAGTCGTTAGCAACTATTACTGCGCCTTTAGAAAGCTAAATTGACACTCATAAATGTCTTTTTTTTTTTCCTAACATTCTAATATATTTaaatgaatgcttacttGAATATGTAAATATGCATATGGTTTAGGGTTATGGATATTCTTTTCGATGGAATCAAAAGAGGGTTACATGTGGGCTCTAGTATGGC
comparing SEQ ID No.2 with Indel marker sequence with SEQ ID No.5 of Temple white, it can be seen from FIG. 4 that the band of Temple white does not carry Indel marker sequence. Because an Indel marker sequence needs a replication target site when inserted into a genome, and the length of the replication target site is 16bp, the Indel marker sequence also exists in a non-red petal rose variety (lower case partial sequence). Then, the sequences on both sides of the lunar red Indel marker sequence were compared with the sequence of the Tiantan white band, as can be seen from FIG. 5, the sequences on both sides of the lunar red Indel marker sequence were different by 8 nucleotides, and the remaining sequences were identical to the sequence of the Tiantan white band.
And sequencing the band which appears in the moon red and is not similar to the Tiantan white to obtain the sequence which is consistent with the 320bp sequence of the Tiantan white. The position analysis of the 320bp sequence found that the sequence was distributed on chromosome 5 and 7 of China rose, has multiple copies, and this is present in all China rose, so that the 320bp band is amplified in red China rose, and the copy number may be higher than that of the sequence with Indel marker because of multiple copies. Therefore, a 452bp band with Indel marker sequence and a 320bp band without Indel marker sequence were observed simultaneously in the moon red electrophoresis.
Example 2 validation of 18 materials of the filial generation population of lunar Red and Tiantan white using the method of the invention
The material of example 1 is hybridized with the mother plant of Yueyuehong and the father plant of Tiantan as parents, 18 different progeny plants in the filial generation group are taken for distinguishing and verification, and then the true petal color of the material in the field is checked for false.
1. Extracting the genomic DNA (with the concentration of 20 ng/. mu.L) of the leaves of the 18 different progeny plants (numbered as materials 1 to 18) by using a plant genomic DNA extraction kit DP360 respectively, and extracting according to the steps provided by the kit instructions;
2. respectively taking the extracted genomic DNA of the materials 1 to 18 as templates, and carrying out PCR reaction amplification by using an upstream primer SEQ ID No.3 and a downstream primer SEQ ID No.4 and using a PCR amplification kit;
the upstream primer sequence (5'→ 3') SEQ ID No.3 is GTTGGTGCACCAGATCAAACAATTGGTGC;
the sequence of the downstream primer (5'→ 3') SEQ ID No.4 is GCCATACTAGAGCCCACATGTAAC;
adopting a PCR method; template genomic DNA 3.5. mu.L at a concentration of 20 ng/. mu.L, 10 XPCR buffer 2.5. mu.L, 25mM MgCl22.5 μ L, 1 μ L of 2.5mM dNTPs, 1 μ L of 10 μ M upstream primer, 1 μ L of 10 μ M downstream primer, 0.2 μ L of 1U Taq enzyme, and water to make up to 25 μ L;
PCR reaction procedure: 5min at 95 ℃; 35 cycles of 95 ℃ for 20s, 55 ℃ for 30s, 72 ℃ for 30 s; 5min at 72 ℃;
3. and (3) gel electrophoresis detection: the PCR results of the 18 materials and the PCR results of the moon red and Tiantan white parents prepared in example 1 were electrophoresed on 0.75% agarose gel (EB) for 15 minutes, and the amplified fragments were observed under an ultraviolet lamp using the gel, and the results are shown in FIG. 5.
As can be seen from FIG. 6, the PCR results for material 1, 2, 4, 10, 12, 13, 15, 17 and the moon red parent all carry bands with Indel sequences, which are red in flowering and consistent in fruiting when compared to the corresponding plants after flowering. The PCR results of the materials 3, 5, 6, 7, 8, 9, 11, 14, 16 and 18 and the Tiantan white parent have no Indel sequence, and compared with the corresponding plants after flowering, the plants are white in flower and consistent in result.
The results prove that the method provided by the invention can identify the filial generation of the red variety of lunar red and the white variety of Temple white.
EXAMPLE 3 identification of 17 different colored varieties of Chinese roses by the method of the invention
Taking 17 parts of Chinese rose varieties with different colors for blind test, presuming whether the flower color of the Chinese rose is red or not according to Indel molecular detection results, and checking false according to the real field petal color of the Chinese rose varieties.
The method comprises the following steps:
1. extracting leaf genome DNA of 17 parts of materials (numbered as materials 1 to 17) by using a plant genome DNA extraction kit respectively according to kit instructions;
2. respectively taking the extracted leaf genome DNA of the materials 1 to 17 as a template, and carrying out PCR reaction amplification by using an upstream primer SEQ ID No.3 and a downstream primer SEQ ID No.4 and using a PCR amplification kit;
the upstream primer sequence (5'→ 3') SEQ ID No.3 is GTTGGTGCACCAGATCAAACAATTGGTGC;
the sequence of the downstream primer (5'→ 3') SEQ ID No.4 is GCCATACTAGAGCCCACATGTAAC;
the PCR reaction composition is; template genomic DNA at a concentration of 20 ng/. mu.L, 3.5. mu.L, 10 XPCR buffer 2.5. mu.L, 2.5mM MgCl22.5. mu.L, 1. mu.L of 2.5mM dNTPs, 1. mu.L of 10. mu.M forward primer, and 10. mu.M reverse primer1 mu L of Taq enzyme, 0.2 mu L of Taq enzyme, and water is added to complement to 25 mu L;
PCR reaction procedure: 5min at 95 ℃; 35 cycles of 95 ℃ for 20s, 55 ℃ for 30s, 72 ℃ for 30 s; 5min at 72 ℃;
3. and (3) gel electrophoresis detection: the PCR results of the 17 materials were run on 0.75% agarose gel (EB) for 15 minutes, and the amplified fragments were observed under an ultraviolet lamp, and the results are shown in FIG. 6.
As can be seen from FIG. 7, the materials 1, 3, 4, 5, 7, 9, 12, 14 and 17 all contain the China rose varieties of which the Indel bands all belong to red petals, and the verification is performed with the actual China rose petal colors in the field, wherein the variety of the material 1 is China rose, the variety of the material 3 is Yipinzhuyu, the variety of the material 4 is red rose king, the variety of the material 5 is Chinfie, the variety of the material 7 is red hat, the variety of the material 9 is Xinghuacun, the variety of the material 12 is English grand, the variety of the material 14 is Samantha, and the variety of the material 17 is Zhu-Yin Shuanghui. The varieties are red petal Chinese rose varieties, which shows that the red petal varieties really have Indel strips. The materials 2, 6, 8, 10, 11, 13, 15 and 16 have no Indel strips and are of China rose varieties with non-red petals, and the China rose petal colors are checked with the actual China rose petal colors in the field, wherein the variety of the material 2 is white altar, the variety of the material 6 is white costal, the variety of the material 13 is white snowflake, the variety of the material 15 is iceberg, the variety of the material 16 is wedding white, and the varieties are white petal China rose varieties; the material 8 is golden but not changed, the material 10 is Tengjinfenghuang, the material 11 is golden phoenix, and the varieties are yellow petal Chinese rose varieties, which shows that the non-red petal varieties do not have Indel strips.
It can be seen from the above embodiments that the Indel marking and identification method provided by the present invention can indeed identify whether the rose varieties with different petal colors are red, so that it is possible to distinguish whether red is a rose variety with colored petals by taking leaf material at the early growth stage of the rose, such as the seedling stage, without waiting for the flowering stage, thereby greatly saving breeding time and reducing the cost of breeding time and economic cost. The method is simple in operation technology and easy to popularize, and is very beneficial to carrying out Chinese rose molecular assisted breeding.
The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.
SEQUENCE LISTING
Scientific research institute for forestry fruit trees in Beijing City
<120> Indel marker related to red rose petals and molecular method for identifying red rose petals
<130> DEMO
<160> 5
<170> PatentIn version 3.3
<210> 1
<211> 148
<212> DNA
<213> Artificial sequence
<400> 1
aaatgaatgc ttactttcgg aagtccttgt tctgacctgt tggtctgacg ttattagtgg 60
gtcaattgtg gctcctgttt gtatcgttca taccacttgt aacacttccg tatgaatgaa 120
atcatttgat caaaatgaat gcttactt 148
<210> 2
<211> 452
<212> DNA
<213> Artificial sequence
<400> 2
gttggtgcac cagatcaaac aattggtgct cctccctcca tctgttgtga aaatgagaaa 60
tggagcggaa ttgcaaagct gaagaagtgc gggaccctgt cttgttttgc taaatagagt 120
tgagaattaa gtcgttagca actactactg cgcctttaga aagctaaatt gacactcata 180
aatgtctttt tttttttcct aacattctaa tatatttaaa tgaatgctta ctttcggaag 240
tccttgttct gacctgttgg tctgacgtta ttagtgggtc aattgtggct cctgtttgta 300
tcgttcatac cacttgtaac acttccgtat gaatgaaatc atttgatcaa aatgaatgct 360
tacttgaata tgtaaatatg catgtggttt agggttaggg atattctttt cgatggaatc 420
aaaagagggt tacatgtggg ctctagtatg gc 452
<210> 3
<211> 29
<212> DNA
<213> Artificial sequence
<400> 3
gttggtgcac cagatcaaac aattggtgc 29
<210> 4
<211> 23
<212> DNA
<213> Artificial sequence
<400> 4
ccatactaga gcccacatgt aac 23
<210> 5
<211> 320
<212> DNA
<213> Artificial sequence
<400> 5
gttggtgcac cagatcaaac aattggtgct cctctctcca tctgttgtga aaatgagaaa 60
tggagtggaa ttgcaaagct gaagaagttc gggaccttat cttgttttgc taaatagagt 120
tgagaattaa gtcgttagca actattactg cgcctttaga aagctaaatt gacactcata 180
aatgtctttt tttttttcct aacattctaa tatatttaaa tgaatgctta cttgaatatg 240
taaatatgca tatggtttag ggttatggat attcttttcg atggaatcaa aagagggtta 300
Claims (6)
1. An Indel marker related to red petals of Chinese roses, wherein the Indel marker has a nucleotide sequence shown as SEQ ID No. 1.
2. A sequence with Indel markers associated with red petals of a rose, wherein the sequence is shown as SEQ ID No. 2.
3. The primer with Indel-labeled sequences related to red petals of Chinese roses according to claim 2, wherein the nucleotide sequence of the upstream sequence primer in the primer is shown as SEQ ID No.3, and the nucleotide sequence of the downstream sequence primer is shown as SEQ ID No. 4.
4. Use of the Indel marker of claim 1 or the sequence of claim 2 for screening roses with red petals.
5. A molecular method for identifying red petals of Chinese rose, which is characterized by comprising the following steps:
1) taking leaves of the Chinese rose variety to be identified, and separating and extracting genome DNA;
2) taking the genomic DNA extracted in the step 1) as a template, and carrying out PCR amplification by using an upstream primer SEQ ID No.3 and a downstream primer SEQ ID No. 4;
3) and (3) gel electrophoresis detection: and (3) carrying out gel electrophoresis on the amplified product, taking out the gel, observing the amplified fragment under an ultraviolet lamp, wherein the variety with the strip of SEQ ID No.2 is the red petal Chinese rose variety.
6. The molecular method for identifying red petals of Chinese rose according to claim 5, wherein the amplification system of the PCR reaction in the step 2) is as follows: template genomic DNA 3.5. mu.L at a concentration of 20 ng/. mu.L, 10 XPCR buffer 2.5. mu.L, 25mM MgCl22.5 μ L, 1 μ L of 2.5mM dNTPs, 1 μ L of 10 μ M upstream primer, 1 μ L of 10 μ M downstream primer, 0.2 μ L of 1U Taq enzyme, and water to make up to 25 μ L;
the reaction conditions of the PCR reaction are as follows:
PCR reaction procedure: 5min at 95 ℃; 35 cycles of 95 ℃ for 20s, 55 ℃ for 30s, 72 ℃ for 30 s; 5min at 72 ℃.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011101270.3A CN112159865B (en) | 2020-10-15 | 2020-10-15 | Indel mark related to red rose petals and molecular method for identifying red rose petals |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011101270.3A CN112159865B (en) | 2020-10-15 | 2020-10-15 | Indel mark related to red rose petals and molecular method for identifying red rose petals |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112159865A true CN112159865A (en) | 2021-01-01 |
| CN112159865B CN112159865B (en) | 2022-05-06 |
Family
ID=73867073
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011101270.3A Active CN112159865B (en) | 2020-10-15 | 2020-10-15 | Indel mark related to red rose petals and molecular method for identifying red rose petals |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112159865B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576282A (en) * | 2018-12-18 | 2019-04-05 | 中国农业大学 | Chinese rose transcription factor RhMYB4 and its development of floral organs regulation in application |
| CN111315764A (en) * | 2019-12-12 | 2020-06-19 | 中国农业科学院生物技术研究所 | Petal purpurin and coding gene thereof |
-
2020
- 2020-10-15 CN CN202011101270.3A patent/CN112159865B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109576282A (en) * | 2018-12-18 | 2019-04-05 | 中国农业大学 | Chinese rose transcription factor RhMYB4 and its development of floral organs regulation in application |
| CN111315764A (en) * | 2019-12-12 | 2020-06-19 | 中国农业科学院生物技术研究所 | Petal purpurin and coding gene thereof |
Non-Patent Citations (1)
| Title |
|---|
| DIETMAR F.SCHULZ等: "Genome-Wide Association Analysis of the Anthocyanin and Carotenoid Contents of Rose Petals", 《FRONTIERS IN PLANT SCIENCE》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN112159865B (en) | 2022-05-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| CN109628635B (en) | Development and application of gene marker for regulating purple color of capsicum olivum | |
| CN110305978A (en) | SNP site and its versatility molecular labeling, acquisition methods and application of a kind of and pepper fruit towards tight association | |
| CN103993098B (en) | The SRAP molecule marking method that China's gold leaf Siberian elm leaf look proterties is relevant and application | |
| CN114410818A (en) | Indel molecular marker primer closely linked with wax gourd fruit size and application thereof | |
| CN108796119B (en) | Specific molecular marker PCMI-M001 for rapid identification of male young seedlings of populus | |
| CN112695125B (en) | Katelia SSR molecular marker primer composition and application thereof | |
| CN107586866B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Moore | |
| CN101481737A (en) | Molecular marker tightly linked with Cucumis sativus tumor gene Tu | |
| CN106350591B (en) | Construct SSR primer, constructed finger-print and its application of coloured silk Ye Luanshu Variety fingerprinting | |
| CN112159865B (en) | Indel mark related to red rose petals and molecular method for identifying red rose petals | |
| CN108754015B (en) | Specific molecular marker PCMI-F001 for rapid identification of female young populus diversifolia seedlings | |
| CN102242186B (en) | Two color-related mutations in apple MdMYB1 gene and detection method thereof | |
| CN110607391A (en) | Molecular marker closely linked with character control of Indian pumpkin red fruit peel, primer and application | |
| CN113736795B (en) | MYB1 homologous gene affecting radish anthocyanin synthesis and identification method thereof | |
| CN108165652B (en) | Specific molecular marker TGMI001 for identifying sex of torreya grandis at seedling stage | |
| CN110564886B (en) | Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification | |
| CN112695124B (en) | Phalaenopsis SSR molecular marker primer composition and application thereof | |
| CN108531636A (en) | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower | |
| CN112391489B (en) | SNP molecular marker related to watermelon flesh color and application thereof | |
| CN111876477B (en) | Molecular marker primer combination for identifying sex characters of holly plants and application thereof | |
| CN111088383B (en) | Molecular marker for identifying purple genes of capsicum olivum and development method and application thereof | |
| CN105671039B (en) | The molecular labeling indel15-1 of soybean early flowering season main effect QTL and its application | |
| CN109652415B (en) | Characteristic sequence, labeled primer and identification method of pecan variety Osage | |
| CN109628636B (en) | SSR molecular marker for identifying hybrid of Xinjiang grape and Kyoho grape and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |