CN110564886B - Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification - Google Patents
Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification Download PDFInfo
- Publication number
- CN110564886B CN110564886B CN201910929264.8A CN201910929264A CN110564886B CN 110564886 B CN110564886 B CN 110564886B CN 201910929264 A CN201910929264 A CN 201910929264A CN 110564886 B CN110564886 B CN 110564886B
- Authority
- CN
- China
- Prior art keywords
- hybrid
- camellia
- ssr
- primer
- parent
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Molecular Biology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Botany (AREA)
- Mycology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses an SSR (simple sequence repeat) marker primer for golden camellia and application thereof in hybrid identification, 5 pairs of primers are developed, and the authenticity of a golden camellia hybrid is effectively identified by combining an SSR marker technology with morphological character analysis, so that a scientific basis is provided for golden camellia crossbreeding.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a golden camellia SSR marker primer and application thereof in hybrid identification.
Background
Camellia nitidissima (A) and (B)Camellia nitidissima) Belonging to genus Camellia of Theaceae (Theaceae) (Theaceae)Camellia) The golden camellia group, called as 'queen of tea family' and 'panda of plant kingdom', is a first-class rare or endangered plant of the state, and has golden yellow flower color, rich wax luster, dark green leaf color and purplish red new leaf, and has higher ornamental value. However, the golden camellia has smaller diameter and single petal, and the golden camellia is used as a parent to be hybridized and distant hybridized with camellia resources with high ornamental value and strong stress resistance, such as large flowers, heavy petals and the like, so that the characteristics of the golden camellia are expected to be improved, and a new high-quality stress-resistant golden camellia variety is cultivated. China is the golden camellia resource distribution center, more than 30 golden camellia species account for more than 80% of the golden camellia species in the world, and the golden camellia has incomparable resource advantages abroad. Fully utilizes the advantages of rich golden camellia resources in China, is expected to make a breakthrough in a short term through hybridization and distant hybridization, and obtains a new golden camellia variety with independent intellectual property rights, such as golden camellia and Vietnam ampelopsis tea (A)C. amplexicaulis) Hybridizing to obtain the new variety ' Dongyang Hai ', jinhua tea and Camellia japonica ' WubaoC. japonica'Wubao') hybrid culture of new speciesDanxin' and the like.
The identification and selection of filial generation of camellia and related species and between varieties are mainly carried out by a method of observing phenotypic characters, so that the effective identification and selection of the filial generation of materials with similar morphological characters or the filial generation of the materials with the similar morphological characters in the early stage are difficult. The molecular marker technology is an effective means for identifying the hybrid or hybrid progeny in which two or more species participate and detecting the genomic composition and structural change thereof in the hybrid or the allopolyploid. The combination of molecular marker and morphological character observation can identify new germplasm quickly and accurately, reveal gene variation in new germplasm and provide guidance for the positioning of important character genes. The molecular marker technology has no related report in the research of hybrid identification of the golden camellia, and the selection effect and the breeding efficiency of the golden camellia can be effectively improved by applying the molecular marker technology to the breeding of the golden camellia.
SSR markers are also called Microsatellite DNA (Microsatelite DNA), and compared with other molecular markers, SSR markers are inherited in a Mendelian manner and are codominant; the quantity is rich, and the polymorphism is high; the information quantity is large due to multiple alleles; meanwhile, the method has the characteristics of good repeatability, strong reliability and the like, and is widely applied to aspects of genetic diversity and genetic structure analysis, germplasm resource identification, genetic map construction and the like. At present, SSR molecular identification technology is mainly applied to crops and various commercial crops, and no relevant report is found on the identification of golden camellia hybrids by utilizing SSR molecular marker technology.
The invention develops 5 pairs of SSR primers, utilizes SSR marking technology combined with morphological character analysis to carry out rapid identification and early selection on hybrid progeny of the golden camellia, determines the relationship of genetic variation between a hybrid variety and a parent of the hybrid variety, and reveals the genetic diversity basis of the hybrid variety, thereby greatly improving the breeding efficiency, shortening the breeding period and providing technical support and scientific basis for golden camellia breeding.
Disclosure of Invention
The invention provides the SSR marker primer which is independently developed and designed, and the SSR marker technology is combined with morphological characters to carry out rapid identification and early selection on hybrid progeny of the golden camellia, so that technical support and scientific basis are provided for golden camellia breeding, the breeding efficiency of the golden camellia is improved, and the breeding period is shortened.
In order to achieve the purpose, the technical scheme adopted by the invention is as follows:
the specific method for developing the golden camellia SSR marker primer comprises the following steps: camellia chrysantha transcriptome sequencing and splicing data were obtained according to Li et al reports (published in Functional & Integrated genetics, vol.18, pp.6, 659-671) (published in NCBI Short Read Archive database https:// www.ncbi.nlm.nih.gov/sra, accession number PRJNA 389977). The SSR marker is predicted by utilizing MISA software (open source software is disclosed in https:// weblast. Ipk-gaterssleben. De/MISA /), 237 is developed and designed from the SSR marker to carry out Polymerase Chain Reaction (PCR) amplification and product detection on the SSR primer, and 5 pairs of SSR primers are screened out according to the amplification result to carry out golden camellia hybrid identification.
The SSR labeled primers of the golden camellia comprise the following specific components:
numbering the primers: SSR52, upstream primer: 5 'GGACGAGATTGCTGAAAAAGC-3', a downstream primer: 5 'TGCACTTCGACTTGCTCAC-3', repeating unit: (CCA) 7;
primer numbering: SSR53, upstream primer: 5 'AAGTCTAAGGACGCAGCCAA-3', a downstream primer: 5 'TGGAAGAAGGAGACGAAGGA-3', repeating unit: (AAC) 6;
primer numbering: SSR69, upstream primer: 5 'TTGTTGGGTATGCCAAGTCA-3', a downstream primer: 5 'TCTGTAAGGAAGGCAAGGGA-3', repeating unit: (GAG) 6;
primer numbering: SSR208, upstream primer: 5 'CGGAAGAAGACGGTGAAG-3', a downstream primer: 5 'AATGGCGTCTCCAATTTGTC-3', a repeating unit: (CAA) 5;
primer numbering: SSR241, upstream primer: 5-: 5 'CGGGCTTAATTCTTCATCCA-3', a repeating unit: (GGT) 6.
Application of the camellia chrysantha SSR marker primer in identification of the authenticity of camellia chrysantha hybrids.
The method for identifying the camellia nitidissima hybrid specifically comprises the following steps:
step 1, DNA extraction: adding liquid nitrogen into the camellia nitidissima hybrid and the parent leaves thereof, grinding the hybrid and the parent leaves thereof, extracting DNA, detecting the concentration and purity of the DNA, and detecting the quality of the DNA by 0.8% agarose gel electrophoresis;
step 4, morphological character analysis: observing and counting flowers of the camellia nitidissima hybrid and the parent thereof in the full-bloom stage, identifying the authenticity of the hybrid according to the flower morphology of the camellia nitidissima hybrid and the parent thereof, and judging the camellia nitidissima hybrid to be a real hybrid by detecting the appearance of male parent specific characters which the female parent does not have or new characters which the parents do not have.
Preferably, the SSR amplification reaction in step 2 is performed on a Veriti 96-Well Thermal Cycler.
Preferably, 25 μ L of reaction system in step 2: the DNA sample contained 100 ng of template DNA 1.5. Mu.L, 2 XTSINGKE Master Mix 12.5. Mu.L, 10 mmol. Multidot.L-1 primer 2. Mu.L, and ultrapure water 9. Mu.L.
Preferably, the PCR amplification procedure: 94. pre-denaturation at deg.C for 5 min; 94. denaturation at 55 deg.C for 30 s, annealing at 55 deg.C for 30 s, extension at 72 deg.C for 30 s, and 35 cycles; 72. extension at deg.C for 9 min.
Preferably, the Qsep100 full-automatic nucleic acid protein analysis system is adopted in the step 3 for electrophoretic separation detection and fragment size determination.
Preferably, in the step 1, the DNA is extracted according to an extraction method of a CTAB plant genome DNA rapid extraction kit of Beijing Edelay Biotechnology Limited.
By this, the following advantageous effects can be obtained:
SSR primers used for identifying hybrid SSR molecular markers of golden camellia are independently developed and designed in the laboratory, and the primer information is shown in table 1.
TABLE 1 Camellia nitidissima hybrid and parent SSR amplification primer thereof
When the SSR molecular markers of the golden camellia hybrid are identified, according to a peak value diagram shown by Qsep100 software, the golden camellia hybrid is judged to be a real hybrid by detecting that the golden camellia hybrid has male parent characteristic peaks and bands which are not possessed by a female parent or has the male parent characteristic peaks and bands simultaneously.
The authenticity of the golden camellia hybrid is effectively identified according to the form of the golden camellia hybrid and the hybrid parent thereof, and the golden camellia hybrid is judged to be a real hybrid by detecting the appearance of the male parent specific character which the female parent does not have or the new character which the parents do not have.
According to the SSR molecular markers and morphological character analysis, the authenticity of the golden camellia hybrid can be effectively identified.
The cross breeding is an important method for variety breeding, particularly, the color variation of the camellia is rich, and varieties with different colors can be expected to be cultivated through hybridization and distant hybridization. The invention utilizes SSR molecular marker technology to analyze the hybrid and the parents of the golden camellia, combines morphological character analysis, can effectively identify the hybrid, determines the relationship of the genetic variation of the hybrid and the parents, and reveals the genetic diversity basis of hybrid varieties, thereby providing scientific basis for the cross breeding of the golden camellia. The invention provides a scientific and effective method for identifying the golden camellia hybrid. Compared with molecular marking methods such as morphological characters, ISSR and the like, the method is simple and convenient to operate, strong in stability and high in repeatability, is suitable for identification of golden camellia hybrids, and provides scientific basis for golden camellia crossbreeding.
Drawings
The present invention is described in further detail below with reference to the attached drawings.
FIG. 1 shows the amplified peak and electrophoresis of hybrid Camellia Chysantha 'the sea of winter yang' and its parent SSR 52.
FIG. 2 shows the amplified peak and electrophoresis of hybrid Camellia Chysantha 'the sea of winter yang' and its parent SSR 53.
FIG. 3 is a flower of Camellia Chysantha, camellia sinensis, and their hybrid 'winter-yang sea'.
FIG. 4 shows the 'regression' of the Camellia Chysantha hybrid and the SSR69 amplified peak and electrophoresis diagram of the parent.
FIG. 5 is the 'regression' of the hybrid of golden camellia and the SSR241 amplified peak image and electrophoresis image of the parent thereof.
FIG. 6 Camellia Chysantha, 'Small Rose' and their hybrids 'return' to the flower.
FIG. 7 is the amplification peak diagram and electrophoresis diagram of the hybrid 'Zhenghuangqi' of golden camellia and its parent SSR 53.
FIG. 8 shows the amplified peak and electrophoretogram of hybrid 'Zhenghuangqi' of Camellia nitidissima and its parent SSR 208.
FIG. 9 is a flower of Camellia Chysantha, yinbai Charles and their hybrid 'Zhenghuangqi'.
Detailed Description
The invention is further described below with reference to the accompanying drawings:
the specific method for developing the golden camellia SSR marker primer comprises the following steps: camellia chrysantha transcriptome sequencing and splicing data were obtained according to Li et al reports (published in Functional & Integrated genetics, vol.18, pp.6, 659-671) (published in NCBI Short Read Archive database https:// www.ncbi.nlm.nih.gov/sra, accession number PRJNA 389977). An SSR mark is predicted by MISA software (open source software disclosed in https:// weblast. Ipk-gatersleen. De/MISA /), 237 is developed and designed from the SSR mark to carry out Polymerase Chain Reaction (PCR) amplification and product detection on SSR primers, and 5 pairs of SSR primers are screened out according to the amplification result to carry out golden camellia hybrid identification.
The 5 pairs of SSR primers are specifically as follows (Table 1):
primer numbering: SSR52, upstream primer: 5 'GGACGAGATTGCTGAAAAAGC-3', a downstream primer: 5 'TGCACTTCGACTTGCTCAC-3', the repeating unit: (CCA) 7;
primer numbering: SSR53, upstream primer: 5 'AAGTCTAAGGACGCAGCCAA-3', a downstream primer: 5 'TGGAAGAAGGAGACGAAGGA-3', repeating unit: (AAC) 6;
primer numbering: SSR69, upstream primer: 5 'TTGTTGGGTATGCCAAGTCA-3', a downstream primer: 5 'TCTGTAAGGAAGGCAAGGGA-3', a repeating unit: (GAG) 6;
numbering the primers: SSR208, upstream primer: 5 'CGGAAGAAGACGGTGAAG-3', a downstream primer: 5 'AATGGCGTCTCCAATTTGTC-3', a repeating unit: (CAA) 5;
numbering the primers: SSR241, upstream primer: 5-: 5 'CGGGCTTAATTCTTCATCCA-3', a repeating unit: (GGT) 6.
TABLE 1 Camellia nitidissima hybrid and parent SSR amplification primer thereof
Application of the golden camellia SSR marker primer in identifying authenticity of golden camellia hybrids.
The method for identifying the camellia nitidissima hybrid specifically comprises the following steps:
s1, DNA extraction: after the leaves are added with liquid nitrogen and ground, DNA is extracted according to the extraction method of the CTAB plant genome DNA rapid extraction kit of Beijing Ederly Biotech Limited. The DNA concentration and purity were measured by a NanoDrop 2000 ultramicro spectrophotometer (Thermo Co., USA), and the DNA quality was measured by 0.8% agarose gel electrophoresis.
S2, SSR amplification: the SSR primers developed and designed in the laboratory are utilized, and the golden camellia hybrid and the parent DNA thereof are used as templates for SSR amplification. SSR amplification reactions were carried out on Veriti 96-Well Thermal Cycler (Thermo Fisher Scientific). 25. μ L reaction: containing 100 ng of template DNA 1.5. Mu.L, 2 XTSINGKE Master Mix 12.5. Mu.L, 10 mmol. Multidot.L -1 mu.L of primer and 9. Mu.L of ultrapure water. PCR amplification procedure: 94. pre-denaturation at deg.C for 5 min; 94. denaturation at 55 ℃ for 30 s, annealing at 55 ℃ for 30 s, extension at 72 ℃ for 30 s, and 35 cycles; 72. extension at C for 9 min.
S3, detection of an amplification product: the amplified products were subjected to electrophoretic separation detection and fragment size determination on a Qsep100 full-automatic nucleic acid protein analysis system (Bioptic, inc.). And (3) performing peak map analysis and allele reading and analysis on the SSR detection result by using Qsep100 software.
S4, morphological character analysis: the flowers of the camellia chrysantha hybrid and the parent full-bloom stage are observed and counted, the character registration is carried out according to the national standard 'specificity, consistency and stability test guideline of new plant variety, camellia genus' (GB/T26911-2011), and the authenticity of the hybrid is identified according to the forms of the hybrid parent and the hybrid.
Example 1
1. Material
Camellia nitidissima hybrid 'Dongyang' of seaC.'Dongyang Zhihai') and its mother golden camellia and father yunnan stem-clasping tea (tea)C. amplexicaulis) Meanwhile, the plant is planted in a greenhouse, leaves of the plant are collected to carry out DNA extraction and SSR amplification, flowers in the full-bloom stage of the plant are observed and counted, and character registration is carried out according to the national standard 'specificity, consistency and stability test guideline of new plant varieties' Camellia (GB/T26911-2011).
Analysis of
SSR analysis of hybrid of Camellia chrysantha 'the sea of winter yang' and parent thereof is carried out according to the method, and the information of the used primers is shown in Table 2.
TABLE 2 Camellia nitidissima hybrid 'Shanghai' and its parent SSR amplification primers
The result of primer SSR52 amplification of hybrid Camellia nitidissima 'winter sun' and its parent is shown in figure 1, the characteristic peak and band of female parent Camellia nitidissima are detected at 268 bp, the characteristic peak and band of male parent Vietnam stem-clasping tea are detected at 251 bp, and the characteristic peak and band of hybrid 'winter sun' are detected at 268 bp and 251 bp respectively, which indicates that the hybrid 'winter sun' has the characteristic peak and band of male parent and female parent at the same time, especially has the characteristic peak and band (indicated by arrow) of male parent Vietnam stem-clasping tea at 251 bp, and is determined as a real hybrid.
The result of the primer SSR53 amplification golden camellia hybrid 'the sea of winter yang' and the parent thereof is shown in figure 2, the characteristic peaks and bands are detected at 262 bp by the female parent golden camellia, the characteristic peaks and bands are detected at 280 bp by the male parent Vietnam stem-clasping tea, and the characteristic peaks and bands are detected at 262 bp and 280 bp by the hybrid 'the sea of winter yang', which indicates that the hybrid 'the sea of winter yang' simultaneously has the characteristic peaks and bands of the male parent and the female parent, particularly has the characteristic peaks and bands (indicated by arrows) at 280 bp by the male parent Vietnam stem-clasping tea, and the hybrid is judged to be a real hybrid.
The results of the primer SSR52 and the primer SSR53 for amplifying the hybrid camellia nitidissimilis 'the sea of winter yang' and the parent thereof show that the hybrid has the characteristic peaks and bands of the male parent and the female parent at the same time, particularly the characteristic peaks and bands of the male parent (the male parent has the peaks and bands which are not possessed by the female parent), and the 'the sea of winter yang' is judged to be the real hybrid of the camellia nitidissimilis and the tea leaves clasping stems from Vietnam according to the results.
Morphological character analysis
The flower of Camellia Chysantha hybrid 'the sea of winter sun' and parent Camellia Chysantha and Vietnam Bao stem tea is shown in figure 3, wherein the flower color of female parent Camellia Chysantha is yellow, and the flower type is single-petal type; the flower color of the male parent Vietnamese ampelopsis stem tea is red, and the flower shape is single-petal type; the flower color of the hybrid 'the sea of winter sun' is red, and the flower type is a half-double petal type; the hybrid 'the sea of winter yang' has flower patterns (red) peculiar to male parents and flower patterns (half-petaloid) not possessed by the parents, and is judged as a real hybrid according to the flower patterns.
And (3) combining the results of SSR molecular marker analysis and morphological character analysis to judge that the 'winter-yang sea' is a real hybrid of the golden camellia and the Vietnam stem-embracing tea.
Example 2
1. Material
Golden camellia hybrid 'regression' (ii)C. ' Huigui ') and its female parent camellia chrysantha and male parent ' rose flowerC. sasanqua ' Xiiaomeigui ') is planted in a greenhouse, leaves of the Xiiaomeigui ') are collected to be subjected to DNA extraction and SSR amplification, flowers in the full-bloom stage are observed and counted, and character registration is carried out according to the national standard ' specificity, consistency and stability test guideline camellia of new plant varieties ' (GB/T26911-2011).
Amplification assay
SSR analysis of the hybrid 'regression' and the parents of the golden camellia is carried out according to the method, and the information of the used primers is shown in a table 3.
TABLE 3 Camellia nitidissima hybrid 'regression' and its parent SSR amplification primers
The result of primer SSR69 amplification golden camellia hybrid 'regression' and parent thereof is shown in figure 4, characteristic peaks and bands are detected at 267 bp by female parent golden camellia, characteristic peaks and bands are detected at 275 bp and 288 bp by male parent 'small roses', and characteristic peaks and bands are detected at 267 bp, 275 bp and 288 bp by the hybrid 'regression', so that the hybrid 'regression' has the characteristic peaks and bands of the male parent and the female parent at the same time, particularly the characteristic peaks and bands (indicated by arrows) at 275 bp and 288 bp by the male parent 'small roses', and the hybrid is judged to be a true hybrid.
The result of primer SSR241 amplification golden camellia hybrid 'regression' and parent thereof is shown in figure 5, characteristic peaks and bands are detected at 238 bp of female parent golden camellia, characteristic peaks and bands are detected at 294 bp of male parent 'small rose', and characteristic peaks and bands are detected at 238 bp and 294 bp of hybrid 'regression' respectively, which indicates that the hybrid 'regression' simultaneously has characteristic peaks and bands of male parent and female parent, particularly characteristic peaks and bands (indicated by arrows) at 294 bp of tea of male parent 'small rose', and the hybrid is judged to be a real hybrid.
The results of primer SSR69 and SSR241 amplification camellia nitidissimilis hybrid 'regression' and parents thereof show that the hybrid simultaneously has characteristic peaks and bands of a father and a mother, particularly characteristic peaks and bands of a father, and the 'regression' is judged to be a real hybrid of camellia nitidissimilis and 'small roses'.
Morphological character analysis
Flower of Camellia Chysantha hybrid 'regress' and its parent Camellia Chysantha and 'small rose' is shown in FIG. 6, wherein flower color of female parent Camellia Chysantha is yellow, and flower type is single-petal type; the flower color of the male parent 'small rose' is red, and the flower shape is a half-double petal type; the 'regression' flower color of the hybrid is pink, and the flower type is a single petal type; the hybrid 'regressed' has a color (pink) which is not possessed by the parents, and is judged as a true hybrid according to the color.
And (3) judging that the 'regression' is a real hybrid of the golden camellia and the 'small rose' by combining the SSR molecular markers and morphological character analysis results.
Example 3
1. Material
Golden camellia hybrid 'Zhenghuangqi' (flag root and stem)C.' Zhenghuangqi ') and its mother golden camellia and its father ' Yinbai ChagasC. japonica' Yinbai Chalisi ') is planted in a greenhouse, leaves of the Yinbai Chalisi ' are collected to carry out DNA extraction and SSR amplification, flowers in full-bloom stage are observed and counted, and character registration is carried out according to the national standard ' specificity, consistency and stability test guideline camellia of new plant variety ' (GB/T26911-2011).
Amplification assay
SSR analysis of hybrid 'Zhenghuangqi' of golden camellia and parent thereof is carried out according to the method, and the information of the used primers is shown in Table 4.
TABLE 4 Camellia nitidissima hybrid 'Zhenghuangqi' and parent SSR amplification primers thereof
The result of the primer SSR53 amplification golden camellia hybrid 'positive yellow flag' and the parent thereof is shown in figure 7, the characteristic peaks and bands of the female parent golden camellia are detected at 269 bp, the characteristic peaks and bands of the male parent 'silver white charles' are detected at 281 bp, and the characteristic peaks and bands of the hybrid 'positive yellow flag' are detected at 269 bp and 281 bp respectively, which indicates that the hybrid 'positive yellow flag' has the characteristic peaks and bands of the male parent and the female parent at the same time, particularly has the characteristic peaks and bands (indicated by arrows) of the male parent 'silver white charles' at 281 bp, and the hybrid is judged to be a real hybrid.
The result of amplifying the golden camellia hybrid 'Zhenghuangqi' and the parent thereof by the primer SSR208 is shown in figure 8, the female parent golden camellia detects characteristic peaks and bands at 200 bp and 205 bp, the male parent 'Yinbai Chairus' detects characteristic peaks and bands at 192 bp, and the hybrid 'Zhenghuangqi' detects characteristic peaks and bands at 192 bp, 200 bp and 205 bp respectively, which indicates that the hybrid 'Zhenghuangqi' has the characteristic peaks and bands of the male parent and the female parent, particularly has the characteristic peaks and bands (indicated by arrows) at 192 bp of the male parent 'Yinbai Chairus', and is judged to be a real hybrid.
The results of the primer SSR53 and the primer SSR208 for amplifying the golden camellia hybrid 'Zhenghuangqi' and the parent thereof show that the hybrid simultaneously has the characteristic peaks and the bands of the male parent and the female parent, particularly the characteristic peaks and the bands of the male parent, and accordingly, the 'Zhenghuangqi' is judged to be a real hybrid of the golden camellia and the 'Yinbu Charis'.
Morphological character analysis
Golden camellia hybrid 'Zhenghuangqi' and parent golden camellia and 'Yinbai Charles' flower are shown in figure 9, wherein the flower color of the female parent golden camellia is yellow, and the flower shape is single-petal type; the flower color of the male parent 'Yinbai Charles' is white, and the flower shape is a half-petaled type; the hybrid 'Zhenghuangqi' flower color is light yellow, and the flower type is a rose petaling type; the hybrid 'positive yellow flag' has a flower pattern (rosette pattern) and a flower color (yellowish color) which are not possessed by parents, and is determined as a real hybrid.
And (3) judging that the 'Zhenghuangqi' is a real hybrid of the golden camellia and the 'Yinbai Chairusi' by integrating the results of the SSR molecular marker analysis and the morphological character analysis.
The principles and embodiments of the present invention have been described herein using specific examples, which are presented only to assist in understanding the method and its core concepts of the present invention. It should be noted that, for those skilled in the art, it is possible to make various improvements and modifications to the present invention without departing from the principle of the present invention, and those improvements and modifications also fall within the scope of the claims of the present invention.
Claims (8)
1. The SSR marker primer for the golden camellia is characterized by comprising the following specific components:
numbering the primers: SSR52, upstream primer: 5 'GGACGAGATTGCTGAAAAAGC + 3', a downstream primer: 5 'TGCACTTCGACTTGCTCAC-3', repeating unit: (CCA) 7;
primer numbering: SSR53, upstream primer: 5 'AAGTCTAAGGACGCAGCCAA-3', a downstream primer: 5 'TGGAAGAAGGAGACGAAGGA-3', repeating unit: (AAC) 6;
primer numbering: SSR69, upstream primer: 5 'TTGTTGGGTATGCCAAGTCA-3', a downstream primer: 5 'TCTGTAAGGAAGGCAAGGGA-3', repeating unit: (GAG) 6;
primer numbering: SSR241, upstream primer: 5-: 5 'CGGGCTTAATTCTTCATCCA-3', a repeating unit: (GGT) 6.
2. The application of the camellia nitidissima SSR marker primer according to claim 1 in identifying authenticity of camellia nitidissimila.
3. A method for identifying a camellia nitidissima hybrid by using the camellia nitidissima SSR marker primer of claim 1, which is characterized by comprising the following steps of: the identification method specifically comprises the following steps:
step 1, DNA extraction: grinding the hybrid of the golden camellia and the parent leaves thereof by adding liquid nitrogen, extracting DNA, detecting the concentration and purity of the DNA, and detecting the quality of the DNA by 0.8 percent agarose gel electrophoresis;
step 2, SSR amplification: performing SSR amplification by using the golden camellia hybrid and the hybrid parent DNA thereof as templates by using SSR primers;
step 3, detection of amplification products: carrying out electrophoretic separation detection and fragment size determination on the amplified product, carrying out peak image analysis and allele reading and analysis on the SSR detection result, and detecting that the golden camellia hybrid has male parent characteristic peaks and bands which are not possessed by a female parent or has male parent characteristic peaks and bands which are possessed by a male parent and a female parent at the same time according to the peak image, namely, determining that the golden camellia hybrid is a real hybrid;
step 4, morphological character analysis: observing and counting flowers of the camellia chrysantha hybrid and the parent thereof in the full-bloom stage, identifying the authenticity of the hybrid according to the flower form of the camellia chrysantha hybrid and the parent thereof, and judging the camellia chrysantha hybrid to be a real hybrid if male parent specific characters which the female parent does not have or new characters which the parents do not have appear are detected.
4. The method for identifying Camellia nitidissima hybrids of claim 3, wherein: the SSR amplification reaction in step 2 was carried out on a Veriti 96-Well Thermal Cycler.
5. The method for identifying Camellia nitidissima hybrids of claim 4, wherein: 25 μ L reaction in step 2: the DNA sample contained 100 ng of template DNA 1.5. Mu.L, 2 XTSINGKE Master Mix 12.5. Mu.L, 10 mmol. Multidot.L-1 primer 2. Mu.L, and ultrapure water 9. Mu.L.
6. The method of identifying a Camellia nitidissima hybrid according to claim 5, wherein: PCR amplification procedure: 94. pre-denaturing at the temperature of 5 min; 94. denaturation at 55 ℃ for 30 s, annealing at 55 ℃ for 30 s, extension at 72 ℃ for 30 s, and 35 cycles; 72. extension at deg.C for 9 min.
7. The method for identifying Camellia nitidissima hybrids of claim 3, wherein: and 3, performing electrophoretic separation detection and fragment size determination by using a Qsep100 full-automatic nucleic acid protein analysis system.
8. The method for identifying Camellia nitidissima hybrids of claim 3, wherein: in the step 1, DNA is extracted according to an extraction method of a CTAB plant genome DNA rapid extraction kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910929264.8A CN110564886B (en) | 2019-09-29 | 2019-09-29 | Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910929264.8A CN110564886B (en) | 2019-09-29 | 2019-09-29 | Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110564886A CN110564886A (en) | 2019-12-13 |
| CN110564886B true CN110564886B (en) | 2023-01-03 |
Family
ID=68783070
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910929264.8A Active CN110564886B (en) | 2019-09-29 | 2019-09-29 | Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110564886B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN116574839B (en) * | 2023-06-19 | 2024-03-22 | 中国林业科学研究院亚热带林业研究所 | SSR (simple sequence repeat) marker primer, method and application for rapidly identifying camellia varieties |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104004756A (en) * | 2014-06-06 | 2014-08-27 | 中国农业科学院茶叶研究所 | SSR (Simple Sequence Repeat) core primer group and method thereof for identifying tea variety |
| CN104293776A (en) * | 2013-07-17 | 2015-01-21 | 中国检验检疫科学研究院 | SNP molecular marker used for identifying camellia nitidissima and application thereof |
| CN108728572A (en) * | 2018-06-08 | 2018-11-02 | 棕榈生态城镇发展股份有限公司 | A kind of labeling method of calibration four seasons camellia hybrid new breed molecular identity card |
| CN110133141A (en) * | 2019-05-24 | 2019-08-16 | 中国林业科学研究院亚热带林业研究所 | A method of identification camellia pattern bud mutation kind |
| CN110144418A (en) * | 2019-02-17 | 2019-08-20 | 钦州学院 | A kind of C. olelfera SSR molecular marker primer and labeling method and application |
-
2019
- 2019-09-29 CN CN201910929264.8A patent/CN110564886B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293776A (en) * | 2013-07-17 | 2015-01-21 | 中国检验检疫科学研究院 | SNP molecular marker used for identifying camellia nitidissima and application thereof |
| CN104004756A (en) * | 2014-06-06 | 2014-08-27 | 中国农业科学院茶叶研究所 | SSR (Simple Sequence Repeat) core primer group and method thereof for identifying tea variety |
| CN108728572A (en) * | 2018-06-08 | 2018-11-02 | 棕榈生态城镇发展股份有限公司 | A kind of labeling method of calibration four seasons camellia hybrid new breed molecular identity card |
| CN110144418A (en) * | 2019-02-17 | 2019-08-20 | 钦州学院 | A kind of C. olelfera SSR molecular marker primer and labeling method and application |
| CN110133141A (en) * | 2019-05-24 | 2019-08-16 | 中国林业科学研究院亚热带林业研究所 | A method of identification camellia pattern bud mutation kind |
Non-Patent Citations (1)
| Title |
|---|
| "Genetic relationships in a germplasm collection of Camellia japonica and Camellia oleifera using SSR analysis";Y.Zhao，et al;《Genetics and Molecular Research》;20170216;第16卷(第1期);摘要、表2、第6页第2至4段 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN110564886A (en) | 2019-12-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN108192990B (en) | SNP molecular marker related to watermelon peel background color and application thereof | |
| CN113637789B (en) | Wheat stripe rust resistance gene YrTD121 linked KASP molecular marker, primer, kit and application | |
| CN106916897B (en) | Molecular marker for identifying purity of pumpkin hybrid seeds 'Yinhui No. three' of Indian pumpkin and application of molecular marker | |
| CN102242219B (en) | Method and pair of special primers for identifying purple properties of Chinese cabbages | |
| CN110564886B (en) | Golden camellia SSR (simple sequence repeat) marker primer and application thereof in hybrid identification | |
| AU2020103461A4 (en) | Molecular marker of rice amylose content micro-control gene SSIIIb and application thereof | |
| CN114752702B (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN113528702B (en) | KASP marker closely linked with main effect QTL of lycopene in carrot and primer and application thereof | |
| CN113265481B (en) | Lycoris fluorescent EST-SSR molecular marker primer, method for identifying lycoris interspecific hybrid F1 generation and application thereof | |
| CN111394499B (en) | Nucleic acid composition for screening high-anthocyanin tea trees, application of nucleic acid composition and method for breeding high-anthocyanin tea trees | |
| CN110343778B (en) | Polymorphic marker primer of camellia variety spring Jiang Gongxia and camellia variety identification method | |
| CN108531636A (en) | A kind of molecular marked compound TJcM01 and its application for identifying muskmelon unisexual flower | |
| CN113930532A (en) | KASP molecular marker and method for detecting rice high-temperature-resistant gene TT1 | |
| Ko et al. | Screening transferable microsatellite markers across genus Phalaenopsis (Orchidaceae) | |
| CN109652415B (en) | Characteristic sequence, labeled primer and identification method of pecan variety Osage | |
| CN108330164B (en) | Characteristic sequence, primer and identification method of apocarya variety Moore | |
| JP2010035499A (en) | Method for identifying breed of chrysanthemum morifolium | |
| CN112159865B (en) | Indel mark related to red rose petals and molecular method for identifying red rose petals | |
| CN114150083B (en) | SSR marker primer for identifying black camellia hybrid and application thereof | |
| CN108690882B (en) | Molecular specific marker primer and detection method for hibiscus varieties of oxsulan, floru, alden and minuosha | |
| CN116814837B (en) | SSR (simple sequence repeat) marker primer, method and application for rapidly identifying varieties of camellia yunnanensis | |
| CN114717354B (en) | Molecular marker combination, primer set, kit, identification method and application for identifying asparagus super-male plants | |
| KR101429231B1 (en) | Primer Sets for Selecting Discriminating Color of Anthocyanin in Rice Pericarp and the Selecting Method thereof | |
| CN109666759B (en) | Characteristic sequence, labeled primer and identification method of apocarya variety Wichita | |
| CN107653338B (en) | Molecular marker influencing related traits of peony varieties and colors and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |