CN112094900A - Probe set for detecting monogenic recessive genetic disease, kit, screening method and application thereof - Google Patents
Probe set for detecting monogenic recessive genetic disease, kit, screening method and application thereof Download PDFInfo
- Publication number
- CN112094900A CN112094900A CN202011044906.5A CN202011044906A CN112094900A CN 112094900 A CN112094900 A CN 112094900A CN 202011044906 A CN202011044906 A CN 202011044906A CN 112094900 A CN112094900 A CN 112094900A
- Authority
- CN
- China
- Prior art keywords
- recessive genetic
- sequence
- screening
- monogenic recessive
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6869—Methods for sequencing
- C12Q1/6874—Methods for sequencing involving nucleic acid arrays, e.g. sequencing by hybridisation
Abstract
The invention relates to the field of molecular diagnosis, in particular to a probe set, a kit, a screening method and application thereof for detecting monogenic recessive genetic diseases, which are used for primary prevention and control of birth defects. The invention aims at 164 genes of 194 serious disabling lethal monogenic recessive genetic diseases, combines a target sequence liquid phase hybridization capture technology and a high-throughput sequencing technology, designs 3343 probe capture areas, can design and obtain corresponding probes based on the provided probe capture areas according to a conventional method, realizes screening of carriers before pregnancy of the 194 monogenic recessive genetic diseases, thereby accurately predicting the risk of serious monogenic recessive genetic disease patients who may have enough fertility to influence fertility determination, and has the advantages of high accuracy, good specificity and high throughput, and wide application prospect.
Description
Technical Field
The invention relates to the field of molecular diagnosis, in particular to a probe set for detecting monogenic recessive genetic diseases, a kit, a screening method and application thereof.
Background
The monogenic recessive hereditary disease is an important cause of birth defects of children, great pain and burden are brought to children patients and families, and although the incidence of the monogenic hereditary disease is low, the comprehensive incidence of the disease is not low and exceeds 1/100 due to a plurality of diseases. According to recent research data, 85% of individuals in the population are probably carriers of serious genetic diseases, and the individuals can carry 2-5 recessive genetic disease-causing genes, so that the human has higher genetic load, and abnormal genes are probably transmitted to the next generation although the carriers do not cause diseases. If even the partner carried the same disease causing gene, their offspring would have a probability of 1/4 of suffering from the disease, which would not be predicted by ordinary pre-pregnancy examination.
In recent years, a plurality of domestic and foreign researches show that the gene screening of high-carrying-rate recessive genetic diseases of the couples before pregnancy is an important primary prevention measure for preventing birth defects. Related studies (Kabackm, Lim-Steele J, Dabhokar D, Brown D, Levy N, Zeiger K.tay-Sachs disease-carrier screening, pre-national diagnosis, and The molecular era.an International patent, 1970to 1993, The International TSD Data Collection network.JAMA.1993Nov 17; 270 (2307-15)) show that early International genetic testing for screening carriers of recessive genetic diseases for The consumer market is technically dominated by Polymerase Chain Reaction (PCR), polymorphism chip hybridization, and fluorescence detection of large fragment deletions and duplications. However, these methods can only identify one or several gene mutations at a time, are suitable for targeted examination, and are high in cost, few in applicable diseases, narrow in popularization and low in throughput. High throughput sequencing can detect hundreds of diseases simultaneously and can be done with great accuracy. Extensive Carrier Screening (ECS) has also been generated and developed.
Therefore, it is highly desirable to develop a gene detection probe set capable of simultaneously detecting/screening multiple single-gene recessive genetic diseases causing severe disability, a kit matched with the same, and a specific screening method and application thereof.
Disclosure of Invention
Therefore, a gene detection probe set, a kit, a specific screening method and application aiming at 194 single-gene recessive genetic diseases causing serious disability and causing death need to be provided, so that the problems of high detection cost, few applicable diseases, narrow popularization range and low flux in the prior art are solved.
In order to achieve the above objects, the first aspect of the present invention provides a probe set for monogenic recessive genetic disease detection, wherein the probe set is designed based on 3343 capture regions of 164 genes, and the capture regions are shown in table 1.
In a second aspect, the present invention provides a kit for detecting a monogenic recessive genetic disorder, which comprises the probe set of the first aspect of the present invention.
In a third aspect of the present invention, there is provided a screening method for monogenic recessive genetic diseases, comprising: detection is carried out using a probe set according to the first aspect of the invention.
As an alternative embodiment, the gene screening method specifically includes the following steps:
(1) collecting and extracting samples: collecting a sample to be detected, and extracting genome DNA;
(2) DNA fragmentation: ultrasonically breaking or enzyme-cutting the genome DNA to a DNA fragment of 100-500 bp;
(3) end repair/dA tail addition to linker attachment: performing terminal repair/dA tail addition on the DNA fragment and connecting with a linker to obtain a product, and purifying the product;
(4) amplification before hybridization: performing PCR amplification enrichment and purification on the purified product in the step (3) to obtain a DNA library for hybrid capture;
(5) first probe capture: closing the DNA library before hybridization, and performing hybridization capture by using the probe set;
(6) and (3) enriching a target area: eluting the captured product of the first probe to obtain a captured target sequence, and performing PCR amplification on the captured target sequence to obtain an enriched target sequence;
(7) second probe capture and target region enrichment: taking the enriched target sequence as a DNA library captured by the probe for the second time, repeating the step (5) and the step (6), enriching the target region for the second time to obtain the enriched target sequence, and purifying to obtain a product to be tested; and
(8) sequencing and analyzing: and performing second-generation sequencing on the product to be sequenced, and analyzing a sequencing result by adopting bioinformatics.
As an optional embodiment, in step (1), the sample to be tested is blood spot, blood or oral mucosa cell.
As an alternative embodiment, in step (3), the linker is a Y-linker, the Y-linker comprises a first sequence and a second sequence, the first sequence is shown as SEQ ID No.1, and the second sequence is shown as SEQ ID No. 2.
As an alternative embodiment, in step (4), the purification is magnetic bead purification; the PCR amplification and enrichment system comprises: the purified product was 14.5. mu.L; 17.5 mu L of 2 XHi-Fi warm start premix solution; and 3 mu L of label primer mixed solution;
the forward sequence of the tag primer is shown as SEQ ID NO.3, and the reverse sequence is shown as SEQ ID NO. 4;
the reaction conditions for PCR amplification enrichment are as follows: pre-denaturation at 98 ℃ for 45 s; denaturation at 98 ℃ for 15sec, annealing at 60 ℃ for 30sec, and extension at 72 ℃ for 30sec, and circulating for 12 times; final extension at 72 deg.C for 1 min; keeping the temperature at 4 ℃.
As an alternative embodiment, in step (6), the PCR amplification system is: captured target sequence 20. mu.L; 2 multiplied by 25 microlitres of high-fidelity hot start premix; and 5 mu L of library amplification primer-TS mixed solution;
the reaction conditions for PCR amplification enrichment are as follows: pre-denaturation at 98 ℃ for 45 s; denaturation at 98 ℃ for 15sec, annealing at 60 ℃ for 30sec, and extension at 72 ℃ for 30sec, and circulating for 8 times; final extension at 72 deg.C for 1 min; keeping the temperature at 4 ℃.
As an alternative embodiment, in step (3), the terminal repair/dA tail addition and linker ligation employs the KAPAhyper Plus Kit from Illumina.
As an alternative embodiment, in step (6), the elution is carried out using
Hybridization and Wash Kit。
As an alternative embodiment, in step (8), the second generation sequencing is performed using NovaSeq6000, an Illumina second generation sequencing platform;
in the second generation sequencing, the forward sequence of the primer is shown as SEQ ID NO.5, and the reverse sequence is shown as SEQ ID NO. 6.
In a fourth aspect the invention provides the use of a kit according to the second aspect of the invention in the detection of a monogenic recessive genetic disorder.
Different from the prior art, the technical scheme provides 164 genes aiming at 194 serious disabling lethal single-gene recessive genetic diseases, and 3343 probe capture areas (shown in table 1) are designed by combining a target sequence liquid phase hybridization capture technology and a high-throughput sequencing technology. Corresponding probes can be designed and obtained based on the provided probe capture region according to a conventional method, so that screening of pre-pregnant carriers with 194 monogenic recessive genetic diseases is realized, and a prepared pregnant couple can be helped to know the carrying conditions of pathogenic genes of severe monogenic recessive genetic diseases of the two parties in advance, so that the risk of children with severe monogenic recessive genetic diseases which are possibly born enough to influence the fertility decision can be accurately predicted, and effective measures such as test-tube infants or prenatal diagnosis and the like can be intervened in advance. The probe set provided by the invention has the advantages of high accuracy and high flux in the gene screening of 194 serious disabling lethal single-gene recessive genetic diseases, and has wide application prospect.
Detailed Description
In order to explain technical contents, structural features, and objects and effects of the technical means in detail, the following detailed description is given with reference to specific embodiments.
By comparing the expansibility carrier screening projects developed by several existing companies in China, the disease and gene differences detected by each detection product can be found to be large, and some organizations even include diseases with low morbidity, late-onset diseases, low penetrance rate diseases, and moderate or light phenotypes. Therefore, the design of the extensible carrier screening detection gene package is very critical, and the detection cost is considered, and the screening coverage rate and the detection rate are considered: 1) the disease with low incidence needs to be eliminated, namely the carrying rate is selected to be greater than 1/500 from the frequency data of large-scale population; 2) selection for severe single-gene disease leading to foolish and leading to foolish, and sufficient to influence fertility decisions, was performed in conjunction with the findings of the ACOG Committee (NO.690[4] and NO.691[5 ]).
The exon regions and the important regulatory regions of the gene packet are taken as screening targets, if a series of hybridization probe sets can be designed and synthesized, and a high-throughput sequencing method based on probe capture is adopted for screening, so that the pre-pregnancy screening of hundreds of single-gene recessive genetic diseases causing serious disability and death can be effectively realized at one time.
Therefore, the inventor designs a group of gene detection probe sets aiming at 194 serious disabling lethal monogenic recessive genetic diseases by combining a target sequence liquid-phase hybridization capture technology and a high-throughput sequencing technology, and provides a screening method for pregnant couples to know disease-causing genes of the serious monogenic recessive genetic diseases carried by the two parties in advance.
It should be noted that the test materials, reagents and the like used in the examples of the present invention are commercially available unless otherwise specified.
In the present example, the term "probe" is a short piece of DNA that is used to capture the target sequence to which it is complementary.
In the embodiment of the invention, the probe capture area of the disease gene related to the severe disabling lethal monogenic recessive genetic disease can be synthesized into the corresponding probe according to the conventional method, and the synthesis of the probe can be completed only by providing the information of the capture area to a professional probe design and synthesis company, such as Egtai Cor Kongshi https:// design.
Example 1194 Gene detection Probe set for Severe disabling lethal monogenic recessive genetic disease
The inventor obtains 194 single-gene recessive genetic diseases with high carrying rate and severe disability and related genes thereof (see table 2 in detail) by referring to a large number of single-gene recessive genetic disease pathogenic gene related documents and databases, finally designs 3343 probe capture areas (the capture areas are shown in table 1) by high-throughput experimental screening and related experimental verification, and the probes aiming at the probe capture areas are jointly used for detecting 194 pathogenic genes of severe disability and lethal single-gene recessive genetic diseases. The probe aiming at the designed probe capture area has strong specificity and high sensitivity, and can effectively detect the deletion, duplication and point mutation of 194 serious disabling lethal monogenic recessive genetic diseases.
TABLE 1194 Capture regions for 164 causative genes for monogenic recessive genetics
Table 2194 monogenic recessive genetic diseases and 164 pathogenic genes corresponding to the same
Example 2194 methods for capturing and sequencing Severe disabling lethal monogenic recessive genetic diseases
In the embodiment, a small amount (2mL) of peripheral blood of a detected person is used for extracting DNA, and the condition that the detected person carries a monogenic recessive genetic disease pathogenic gene is screened from massive genetic information of the detected person by combining high-throughput target gene sequencing with a bioinformatics analysis means, and the method comprises the following specific steps:
(1) collecting and extracting samples: taking 7 parents' blood samples clinically confirmed to be single-gene genetic children (GJB 2 related non-syndromic deafness, Bardet-Biedl syndrome 12, spinal muscular atrophy, rhabdomyopathy, limb girdle muscular dystrophy 2B, retinitis pigmentosa, Usher syndrome) as examples, the extraction of genome DNA was performed respectively. Wherein, the genome DNA can be extracted by adopting the existing DNA extraction kit on the market; the Kit used was the QIAamp DNAoboodMini Kit.
(2) DNA fragmentation: and ultrasonically breaking the genome DNA into DNA fragments of 100-500 bp.
(3) End repair and linker attachment: performing end repair and sequencing adaptor ligation on the DNA fragment by using KAPAhyper Plus Kit of Illumina company; the product was purified using DNA purification Beads VAHTS DNAClean Beads.
Wherein, connect for Y type connects, includes: a first sequence (shown as SEQ ID NO. 1) comprising an N1 sequence, an N2 sequence and N3 which are connected in sequence; and a second sequence (shown as SEQ ID NO. 2) comprising an S1 sequence and an S2 sequence which are connected in sequence. Wherein the N2 sequence is complementary to the S2 sequence. N1 sequence: ACACTCTTTCCCTACACGAC, respectively; n2 sequence GACGCTCTTCCG; n3 sequence: an ATCT; sequence S1: CACTGACCTCAAGTCTGCACA, respectively; sequence S2: CGAGAAGGCTAG are provided.
The structure of the Y-shaped joint is as follows:
5’-ACACTCTTTCCCTACAC-
-GACGCTCTTCCGATCT-3’
-CGAGAAGGCTAG-5’
3’-CACTGACCTCAAGTCTGCACA-
(4) amplification before hybridization: and (4) carrying out PCR amplification enrichment on the purified product in the step (3), wherein a PCR amplification enrichment system comprises:
the reaction conditions are as follows:
the PCR amplification product was purified using DNA purified magnetic Beads VAHTS DNAClean Beads to obtain a DNA library for hybrid capture.
Wherein, the forward sequence of the tag primer is as follows:
5 '-AATGATACGGCGACCACCGAGATCTACAC [ Index1] ACACTCTTTCCCTACACGAC-3' (shown in SEQ ID NO. 3);
the reverse sequence is: 3 '-CAAGCAGAAGACGGCATACGAGAT [ Index2] GTGACTGGAGTTCAGACGTGT-5' (shown in SEQ ID NO. 4).
Index1 and Index2 are labeled primers, usually consisting of 6 or 8 specific base sequences, used to identify different samples, and may be, for example: TGCAGCTA, TGCTTGAC, TGGCGAAT, TGATCCGT, TTCACAAGC, TCAATGGA, AGGATATC, GGACTCAA, ACCACGTT, ATCTGCAT.
(5) First probe capture: use of
Hybridization and Washkit, according to the instruction, DNA library is blocked before Hybridization to obtain blocked DNA library(ii) a Then preparing a probe mixture from the probe group aiming at the probe capture area in the embodiment 1; performing hybridization capture with the closed DNA library for 4-16 hours; the conditions for hybrid capture were as follows:
(6) and (3) enriching a target area: using the first probe to capture the product
Eluting with Hybridization and Wash Kit to obtain a captured target sequence, and performing PCR amplification on the captured target sequence to obtain an enriched target sequence, wherein the PCR amplification system is as follows:
the reaction conditions are as follows:
(7) second probe capture and target region enrichment: and (3) taking the enriched target sequence as a DNA library captured by the second probe, repeating the step (5) and the step (6) to perform the probe capture and the target region enrichment again, and purifying the second enriched target sequence by using DNA purification magnetic Beads VAHTS DNAclean Beads to obtain a product to be sequenced.
(8) Sequencing the product to be sequenced by using an Illumina next generation sequencing platform NovaSeq6000, and analyzing the sequencing result by adopting bioinformatics.
Wherein, the forward sequence of the primer used in the second generation sequencing is as follows: 5'-ACACTCTTTCCCTACACGAC-3' (shown in SEQ ID NO. 5);
the reverse sequence is: 3 '-CAAGCAGAAGACGGCATACGAGAT-5' (shown in SEQ ID NO. 6).
In this example, the results of the quantification of the amount of the Qubit by the concentration of the extracted genomic DNA and the concentration of the DNA library are shown in Table 3.
TABLE 3 genomic DNA extraction concentration and DNA library concentration
In this example, the results of the quantitying of the Qubit in the post-capture library are shown in table 4.
TABLE 4 Qubit quantitation of post-capture libraries
In this example, the results of screening the blood samples of parents of 7 patients with genetic diseases are shown in Table 5.
Screening results of single-gene recessive genetic disease pathogenic genes of parents of table 57 hereditary patients
Remarking: and (3) variant classification: p (Pathogenic), LP (likelyypathenic, suspected Pathogenic).
From the above results, it can be seen that the parents of 7 children are carriers of the pathogenic genes of the genetic disease of the children, and each person carries 2-3 pathogenic variants on average. If the parents of the children are screened and detected by the probe set provided by the invention before pregnancy, the carrying conditions of high-risk genes of the parents can be known, the risk of the child suffering from the childbearing genetic disease can be predicted in advance, and measures are taken in advance for intervention through further genetic consultation, assisted childbearing or prenatal diagnosis so as to effectively prevent the birth defects.
In conclusion, by designing the corresponding probes according to the probe capture area (shown in table 1), the screening of the pre-pregnant carrier with 194 serious disabling lethal genetic diseases can be realized. In addition, the method has the advantages of high accuracy, good specificity and high flux, and has wide application prospect.
It should be noted that, although the above embodiments have been described herein, the scope of the present invention is not limited thereby, and the technical parameters and raw material components which are not described in detail can still obtain the same or similar technical effects as the above embodiments when they are changed within the range of the parameters listed in the present invention, and still fall within the scope of the present invention. Therefore, based on the innovative concepts of the present invention, the technical solutions of the present invention can be directly or indirectly applied to other related technical fields by making changes and modifications to the embodiments described herein or by using equivalent structures or equivalent processes performed in the present specification, and are included in the scope of the present invention.
Sequence listing
<110> Fuzhou data technology research institute Co., Ltd
<120> Probe set for monogenic recessive genetic disease detection, kit, screening method and use thereof
<130> P14912
<160> 6
<170> SIPOSequenceListing 1.0
<210> 1
<211> 33
<212> DNA
<213> Artificial sequence (Artificial)
<400> 1
acactctttc cctacacgac gctcttccga tct 33
<210> 2
<211> 33
<212> DNA
<213> Artificial sequence (Artificial)
<400> 2
cactgacctc aagtctgcac acgagaaggc tag 33
<210> 3
<211> 57
<212> DNA
<213> Artificial sequence (Artificial)
<220>
<221> unsure
<222> (30)..(37)
<220>
<221> misc_feature
<222> (30)..(37)
<223> n is a, c, g, or t
<400> 3
aatgatacgg cgaccaccga gatctacacn nnnnnnnaca ctctttccct acacgac 57
<210> 4
<211> 53
<212> DNA
<213> Artificial sequence (Artificial)
<220>
<221> unsure
<222> (25)..(32)
<220>
<221> misc_feature
<222> (25)..(32)
<223> n is a, c, g, or t
<400> 4
caagcagaag acggcatacg agatnnnnnn nngtgactgg agttcagacg tgt 53
<210> 5
<211> 20
<212> DNA
<213> Artificial sequence (Artificial)
<400> 5
acactctttc cctacacgac 20
<210> 6
<211> 24
<212> DNA
<213> Artificial sequence (Artificial)
<400> 6
caagcagaag acggcatacg agat 24
Claims (10)
1. A probe set for use in the detection of monogenic recessive genetic disorders, characterized by: the probe set was designed based on 3343 capture regions of 164 genes, as shown below:
2. a kit for the detection of monogenic recessive genetic disorders, characterized in that: the kit contains a set of probes according to claim 1.
3. A screening method for monogenic recessive genetic diseases is characterized in that: detection is carried out using a probe set according to claim 1.
4. The method for screening monogenic recessive genetic disorder according to claim 3, wherein: the gene screening method specifically comprises the following steps:
(1) collecting and extracting samples: collecting a sample to be detected, and extracting genome DNA;
(2) DNA fragmentation: ultrasonically breaking or enzyme-cutting the genome DNA to a DNA fragment of 100-500 bp;
(3) end repair/dA tail addition to linker attachment: performing terminal repair/dA tail addition on the DNA fragment and connecting with a linker to obtain a product, and purifying the product;
(4) amplification before hybridization: performing PCR amplification enrichment and purification on the purified product in the step (3) to obtain a DNA library for hybrid capture;
(5) first probe capture: closing the DNA library before hybridization, and performing hybridization capture by using the probe set;
(6) and (3) enriching a target area: eluting the captured product of the first probe to obtain a captured target sequence, and performing PCR amplification on the captured target sequence to obtain an enriched target sequence;
(7) second probe capture and target region enrichment: taking the enriched target sequence as a DNA library captured by the probe for the second time, repeating the step (5) and the step (6), enriching the target region for the second time to obtain the enriched target sequence, and purifying to obtain a product to be tested; and
(8) sequencing and analyzing: and performing second-generation sequencing on the product to be sequenced, and analyzing a sequencing result by adopting bioinformatics.
5. The method for screening monogenic recessive genetic disorder according to claim 4, wherein: in the step (1), the sample to be detected is blood spot, blood or oral mucosa cell.
6. The method for screening monogenic recessive genetic disorder according to claim 4, wherein: in the step (3), the linker is a Y-type linker, the Y-type linker comprises a first sequence and a second sequence, the first sequence is shown as SEQ ID NO.1, and the second sequence is shown as SEQ ID NO. 2.
7. The method for screening monogenic recessive genetic disorder according to claim 4, wherein: in the step (4), the purification is magnetic bead purification; the PCR amplification and enrichment system comprises:
the purified product was 14.5. mu.L; 17.5 mu L of 2 XHi-Fi warm start premix solution; and 3 mu L of label primer mixed solution;
the forward sequence of the tag primer is shown as SEQ ID NO.3, and the reverse sequence is shown as SEQ ID NO. 4;
the reaction conditions for PCR amplification enrichment are as follows:
pre-denaturation at 98 ℃ for 45 s; denaturation at 98 ℃ for 15sec, annealing at 60 ℃ for 30sec, and extension at 72 ℃ for 30sec, and circulating for 12 times; final extension at 72 deg.C for 1 min; keeping the temperature at 4 ℃.
8. The method for screening monogenic recessive genetic disorder according to claim 4, wherein: in step (6), the PCR amplification system is as follows:
captured target sequence 20. mu.L; 2 multiplied by 25 microlitres of high-fidelity hot start premix; and 5 mu L of library amplification primer-TS mixed solution;
the reaction conditions for PCR amplification enrichment are as follows:
pre-denaturation at 98 ℃ for 45 s; denaturation at 98 ℃ for 15sec, annealing at 60 ℃ for 30sec, and extension at 72 ℃ for 30sec, and circulating for 8 times; final extension at 72 deg.C for 1 min; keeping the temperature at 4 ℃.
9. The method for screening monogenic recessive genetic disorder according to claim 4, wherein: in the step (8), the second generation sequencing is carried out by using NovaSeq6000 which is an Illumina second generation sequencing platform;
in the second generation sequencing, the forward sequence of the primer is shown as SEQ ID NO.5, and the reverse sequence is shown as SEQ ID NO. 6.
10. Use of the kit of claim 2 in the detection of monogenic recessive genetic disorders.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011044906.5A CN112094900A (en) | 2020-09-28 | 2020-09-28 | Probe set for detecting monogenic recessive genetic disease, kit, screening method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011044906.5A CN112094900A (en) | 2020-09-28 | 2020-09-28 | Probe set for detecting monogenic recessive genetic disease, kit, screening method and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112094900A true CN112094900A (en) | 2020-12-18 |
Family
ID=73783878
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011044906.5A Pending CN112094900A (en) | 2020-09-28 | 2020-09-28 | Probe set for detecting monogenic recessive genetic disease, kit, screening method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112094900A (en) |
Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978284A (en) * | 2012-11-19 | 2013-03-20 | 金子兵 | Gene chip for screening various ophthalmological hereditary diseases as well as preparation and usage method of gene chip |
| CN103667254A (en) * | 2012-09-18 | 2014-03-26 | 邵阳 | Enrichment and detection method of target gene fragment |
| CN107937513A (en) * | 2017-11-30 | 2018-04-20 | 东莞市第八人民医院 | 50 kinds of hereditary disease genetic test probe groups of neonate and screening method |
| US20190192691A1 (en) * | 2016-04-11 | 2019-06-27 | Obsidian Therapeutics, Inc. | Regulated biocircuit systems |
| CN110499364A (en) * | 2019-07-30 | 2019-11-26 | 北京凯昂医学诊断技术有限公司 | A kind of probe groups and its kit and application for detecting the full exon of extended pattern hereditary disease |
| CN110938685A (en) * | 2019-12-11 | 2020-03-31 | 福建福君基因生物科技有限公司 | Gene detection probe set for neonatal hereditary metabolic disease and hemoglobinopathy and application thereof |
-
2020
- 2020-09-28 CN CN202011044906.5A patent/CN112094900A/en active Pending
Patent Citations (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103667254A (en) * | 2012-09-18 | 2014-03-26 | 邵阳 | Enrichment and detection method of target gene fragment |
| CN102978284A (en) * | 2012-11-19 | 2013-03-20 | 金子兵 | Gene chip for screening various ophthalmological hereditary diseases as well as preparation and usage method of gene chip |
| US20190192691A1 (en) * | 2016-04-11 | 2019-06-27 | Obsidian Therapeutics, Inc. | Regulated biocircuit systems |
| CN107937513A (en) * | 2017-11-30 | 2018-04-20 | 东莞市第八人民医院 | 50 kinds of hereditary disease genetic test probe groups of neonate and screening method |
| CN110499364A (en) * | 2019-07-30 | 2019-11-26 | 北京凯昂医学诊断技术有限公司 | A kind of probe groups and its kit and application for detecting the full exon of extended pattern hereditary disease |
| CN110938685A (en) * | 2019-12-11 | 2020-03-31 | 福建福君基因生物科技有限公司 | Gene detection probe set for neonatal hereditary metabolic disease and hemoglobinopathy and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2663864B1 (en) | Immunodiversity assessment method and its use | |
| Ameziane et al. | Diagnosis of fanconi anemia: mutation analysis by next-generation sequencing | |
| US20030211522A1 (en) | Methods for fetal DNA detection and allele quantitation | |
| EP1807538A2 (en) | Methods and kits for detecting germ cell genomic instability | |
| CN106591273B (en) | One group of gene new mutation relevant to Organic acidemia and detection kit | |
| CN106591441A (en) | Probes, method and chip for detecting alpha and/or beta-thalassemia mutation based on whole-gene capture sequencing and application of such probes, such method and such chip | |
| CN106319065A (en) | Kit and capture probe for human BRCA1/2 gene detection on basis of high-throughput sequencing | |
| CN107937513B (en) | 50 kinds of hereditary disease genetic test probe groups of newborn and screening method | |
| CN106701925A (en) | Cataract pathogenic gene detection kit and detection method thereof | |
| US9879314B2 (en) | Method for detecting HLA-A*31:01 allele | |
| CN108866154B (en) | Noninvasive prenatal haplotype construction method based on long-fragment DNA capture and third-generation sequencing | |
| CN110714077B (en) | Primer for simultaneously detecting BRCA1/2 exon sequences and chemotherapeutic drug sites and application thereof | |
| EP0763136B1 (en) | Method and probes for detecting markers bound to the locus of child spinal muscular atrophies | |
| CN110734974B (en) | SNP locus combination and detection primer for cancer chemotherapy drugs | |
| CN112094900A (en) | Probe set for detecting monogenic recessive genetic disease, kit, screening method and application thereof | |
| CN110938685A (en) | Gene detection probe set for neonatal hereditary metabolic disease and hemoglobinopathy and application thereof | |
| CN108977449B (en) | Pathogenic mutation of primary immunodeficiency disease and application thereof | |
| WO2020230739A1 (en) | Hla class i allele deficient hemocyte detection method | |
| CN113637739B (en) | SCN5A mutant gene, application and Brugada syndrome detection kit | |
| CN114854737B (en) | Three-generation sequencing platform-based class I HLA gene amplification primer, kit and typing method | |
| CN113444784B (en) | Severe congenital neutropenia detection primer composition and application | |
| KR100642421B1 (en) | 1711.2-12 Diagnosis method and kits for inherited neuropathies caused by duplication or deletion of chromosome 17p11.2-p12 region | |
| CN108034709B (en) | Application of GUCA1A gene in preparation of products for detecting cone cell malnutrition | |
| CN116179671A (en) | Amplification primer group, kit and method for HLA genotyping | |
| WO2024076469A1 (en) | Non-invasive methods of assessing transplant rejection in pregnant transplant recipients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20201218 |