CN112094827B - Phyllostachys pubescens salt stress response gene PeFeSOD2 and application thereof - Google Patents
Phyllostachys pubescens salt stress response gene PeFeSOD2 and application thereof Download PDFInfo
- Publication number
- CN112094827B CN112094827B CN202010994483.7A CN202010994483A CN112094827B CN 112094827 B CN112094827 B CN 112094827B CN 202010994483 A CN202010994483 A CN 202010994483A CN 112094827 B CN112094827 B CN 112094827B
- Authority
- CN
- China
- Prior art keywords
- rice
- pefesod2
- salt stress
- gene
- salt
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0089—Oxidoreductases (1.) acting on superoxide as acceptor (1.15)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8273—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for drought, cold, salt resistance
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y115/00—Oxidoreductases acting on superoxide as acceptor (1.15)
- C12Y115/01—Oxidoreductases acting on superoxide as acceptor (1.15) with NAD or NADP as acceptor (1.15.1)
- C12Y115/01001—Superoxide dismutase (1.15.1.1)
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Medicinal Chemistry (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
A phyllostachys pubescens salt stress response gene PeFeSOD2 and application thereof belong to the technical field of molecular biology. The invention provides a phyllostachys edulis salt stress response gene PeFeSOD2 on one hand, and provides application of the phyllostachys edulis salt stress response gene PeFeSOD2 on the other hand. The invention firstly expresses the phyllostachys pubescens PeFeSOD2 gene in rice in an excessive way, and uses a PCR method to prove that the gene is successfully integrated into a rice genome, thus obtaining a positive plant. The salt stress treatment is carried out on the water-cultured transgenic rice and the wild rice, and the result shows that the transgenic plant has stronger salt tolerance capability compared with the wild rice, which shows that the overexpression of the PeFeSOD2 gene improves the salt tolerance of the transgenic rice.
Description
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a salt stress response gene of phyllostachys pubescensPeFeSOD2And applications thereof.
Background
Mao bamboo (A)Phyllostachys edulis) The single-axis scattered bamboo species of the genus Phyllostachys belonging to the subfamily Bambusoideae of the family Gramineae are widely distributed in southern areas of China, and have the advantages of fast forest establishment, wide application, high economic benefit and the like. According to the ninth national forest resource clearing result in China, the area of the Chinese bamboo forest is 641.16 ten thousand hm2Wherein the moso bamboo forest reaches 467.78 ten thousand hm2And accounts for 72.96% of the total area of the bamboo forest. By the end of 2014, the total yield of bamboo industry in China reaches 1845.10 hundred million yuan, and the bamboo is an important economic bamboo species in China. In addition, the moso bamboo has great ecological benefit, and has good water permeability and water and soil retention capacity. The moso bamboo is beautiful and tall and straight, enjoys elegant and popular, and is particularly suitable for building scenic bamboo forests in scenic spots or large parks. Therefore, the moso bamboo integrates economic benefit, ecological benefit and social effect, and has great development and utilization potential. However, the moso bamboo likes wet, draining and air-permeable acidic sandy soil, although it has certain tolerance to salt stress of low concentrationHowever, soil salinization still is one of the important environmental factors limiting the distribution and utilization of moso bamboos. In recent years, with the development of molecular biology, a series of adversity stress response genes have been identified in the moso bamboos, but the current data on the research of the salt-tolerant gene functions of the moso bamboos are still very deficient, so that the moso bamboos are worthy of more deep exploration.
When a plant is subjected to abiotic stress such as high temperature, drought, high salt and the like, the plant can generate a large amount of Reactive Oxygen Species (ROS), also called active Oxygen, and if the ROS cannot be cleared in time, a series of harmful reactions can be generated on the plant body. Plants, in order to cope with stress, have produced a corresponding clearance system in which superoxide dismutase (SOD) is the key enzyme in the plant's active oxygen scavenging system, making superoxide anion O2-Disproportionation reaction to produce H2O2And O2Generation of H2O2Regenerating H by subsequent enzymatic and non-enzymatic reactions2O and O2Thereby preventing the plant cells from being poisoned by the active oxygen.
With the development of biotechnology, the research on plant-related mechanisms from the perspective of molecular biology has become a hotspot. The nature of the stress tolerance is gradually revealed to become the target of researchers on the molecular level, so that the salt tolerance of the moso bamboo is improved by utilizing molecular biology research and analyzing the molecular mechanism related to the salt tolerance of the moso bamboo and exploring the salt stress response gene, which has important practical significance and application prospect on the stress tolerance of the moso bamboo.
Disclosure of Invention
Aiming at the problems in the prior art, the invention aims to design and provide a salt stress response gene of moso bambooPeFeSOD2And applications thereof.
The salt stress response gene of moso bambooPeFeSOD2It is characterized in that the gene has a nucleotide sequence shown as SEQ ID No.1 or a nucleotide sequence which is formed by replacing, deleting or adding one or more nucleotides in the sequence and has the same function.
The salt stress response gene of moso bambooPeFeSOD2Characterized in that the codeThe amino acid sequence of the protein is shown as SEQ ID No. 2.
The salt stress response gene of moso bambooPeFeSOD2The application of the salt-tolerant compound in participating in a salt-tolerant pathway.
The salt stress response gene of moso bambooPeFeSOD2The application of the plant salt tolerance enhancement.
The salt stress response gene of moso bambooPeFeSOD2The application of the salt tolerance of rice is enhanced.
The bamboo salt stress response gene containing the bamboo salt stress response genePeFeSOD2The carrier of。
The host containing the vector.
The method specifically comprises the following steps:
(1) salt stress response gene of moso bambooPeFeSOD2The method comprises the following steps of collecting moso bamboo seeds from Guangxi, cultivating the moso bamboo seeds in an intelligent greenhouse of Zhejiang agriculture and forestry university until the moso bamboo seedlings are grown (1 month), and then culturing the moso bamboo seedlings in a phytotron of Zhejiang agriculture and forestry university at the temperature of 25 ℃ and the humidity of 70% for experimental use. Then extracting RNA and reverse transcribing to cDNA to clonePeFeSOD2The total length of the CDS sequence of (1) is 1281 bp. The recombinant plasmid is connected with a pMD18-T vector for sequencing, and after the vector is identified to be correct, the constructed vector is heterogeneously transformed into rice.
(2) To further understandPeFeSOD2The function of (2) is that an over-expression vector is constructed to carry out heterologous transformation on rice. Firstly, PCR technology is utilizedPeFeSOD2Screening positive plants of the gene-transformed rice to obtain T1 generation seeds, culturing the seeds for one month by using a water culture method, selecting the rice with consistent growth vigor for salt stress treatment, sampling 0h, 3h, 6h and 12h after the rice treatment, quickly freezing the rice by using liquid nitrogen, storing the rice in an ultra-low temperature refrigerator at the temperature of-80 ℃, and extracting DNA (deoxyribonucleic acid) and PCR (polymerase chain reaction) detection, extracting RNA (ribonucleic acid), observing and counting phenotypes and determining enzyme activity related indexes, thereby verifying the improvement of the salt tolerance of the rice.
Compared with the prior art, the invention has the following advantages and effects:
1. the invention is obtained from moso bambooPeFeSOD2The nucleotide sequence of the gene is shown as SEQ ID No.1, and the amino acid sequence of the encoded protein is shown asShown in SEQ ID No. 2.
2. The invention clones the moso bambooPeFeSOD2Genes and their function of responding to salt stress. The invention comprises a salt stress response gene of phyllostachys edulisPeFeSOD2The cloning and PCR primer design and reaction conditions of (1) and the application of using transgenic technology to illustrate the salt stress response of the moso bamboo SOD gene.
3. The invention firstly uses the moso bambooPeFeSOD2The gene is over-expressed in rice, and a PCR method is used for proving that the gene is successfully integrated into a rice genome, so that a positive plant is obtained.
4. The invention carries out salt stress treatment on the water-cultured transgenic rice and the wild rice, and the result shows that the transgenic plant has stronger salt tolerance capability compared with the wild rice, which indicates thatPeFeSOD2The over-expression of the gene improves the tolerance of the transgenic rice to salt.
Drawings
FIG. 1 shows a schematic view of aPeFeSOD2Detecting positive plants of the transgenic rice strains;
FIG. 2PeFeSOD2Gene expression level of positive plants of transgenic rice strains;
FIG. 3 Fv/Fm value analysis of different rice lines under salt stress treatment;
FIG. 4 analysis of MDA content of different rice lines under salt stress treatment;
FIG. 5 SOD enzyme activity analysis of different rice lines under salt stress treatment;
FIG. 6 phenotypic analysis of different rice lines under salt stress treatment;
FIG. 7 analysis of rice salt stress-related gene expression.
Detailed Description
The present invention will now be described in further detail with reference to specific examples, which are intended to be illustrative, but not limiting, of the invention.
Example 1: mao bambooPeFeSOD2Cloning of genes
1. Preparing materials: the moso bamboo seeds are collected from Guangxi Guilin, cultivated in an intelligent greenhouse of Zhejiang agriculture and forestry university until the moso bamboo seedlings (1 month) grow, and then cultivated in an artificial climate room of Zhejiang agriculture and forestry university at the temperature of 25 ℃ and the humidity of 70% for subsequent experiments.
2. RNA extraction
(1) Preparing experimental tools such as a mortar and a pestle for experiments, sterilizing at high temperature, taking experimental materials stored at-80 ℃ in an ultralow-temperature refrigerator, adding liquid nitrogen into the mortar, and quickly grinding into powder.
(2) Transferring the ground powder into a 2mL centrifuge tube treated by RNA-free, adding 1mL of RNAiSomplus reagent, fully shaking and uniformly mixing, standing for 5min, and centrifuging for 5min at 12000g on a low-temperature high-speed centrifuge at 4 ℃.
(3) After centrifugation, 800 mu L of supernatant is taken to be put into a 1.5mL centrifuge tube treated by RNA-free, 200 mu L of trichloromethane is added, the mixture is shaken for 15s and then kept stand for 5min, and then centrifuged for 15min at 12000g on a low-temperature high-speed centrifuge at 4 ℃.
(4) After centrifugation, 400 mu L of supernatant is taken to be put into a new 1.5mL centrifuge tube treated by RNA-free, isopropanol precooled at the temperature of minus 20 ℃ is added, the mixture is inverted for 2 to 3 times, then is kept stand for 10min, and is centrifuged for 10min at the temperature of 4 ℃ and 7500g in a low-temperature high-speed centrifuge.
(5) The supernatant was discarded, 1mL of 75% ethanol was added, the precipitate was resuspended, and then centrifuged at 7500g for 5min at 4 ℃ in a low temperature high speed centrifuge.
(6) Discarding the supernatant, centrifuging at 4 deg.C and 7500g for 2min in a low-temperature high-speed centrifuge, collecting the residual ethanol to the bottom of the tube, sucking off the residual ethanol with a pipette gun, drying for 5min on an ultraclean bench, adding 30mL of RNA-free water to dissolve the precipitate, detecting the concentration and agarose gel electrophoresis, and storing at-80 deg.C.
3. Reverse transcription of RNA
RNA reverse transcription experiments were performed using the PrimeScript RT reagent Kit with gDNA Eraser reverse transcription Kit, all consumables were treated with RNA-free, and all experiments were performed on ice.
(1) The system for removing genomic DNA from RNA is as follows.
Reaction system for removing genome DNA
Preparing reaction liquid, mixing uniformly, and reacting for 2min at 42 ℃.
(2) Reverse transcription reaction, adding the obtained reaction solution into the following reaction system
Reverse transcription system
And uniformly mixing the prepared reaction solution, reacting at 37 ℃ for 15min, reacting at 85 ℃ for 5s, and then placing on ice for cooling to obtain the reaction solution, namely the cDNA.
4. Cloning of genes
(1) Extracting from the database of moso bambooPeFeSOD2cDNA sequence of gene, designing primer, the sequence is as follows:
PeFeSOD 2-F: ATGGCGTTCACCACACTGGT (shown as SEQ ID No. 3);
PeFeSOD 2-R: CTACAAGTCACCATCCTCACG (shown as SEQ ID No. 4).
(2) The moso bamboo cDNA obtained by the reverse transcription is taken as a template, and PCR amplification is carried out by using a designed primer, wherein the system is as follows:
reverse transcription system
After the reaction solution is prepared, the reaction system is as follows: pre-denaturation at 95 ℃ for 5min, denaturation at 95 ℃ for 30s, annealing at 60 ℃ for 30s, extension at 72 ℃ for 60s, 35 cycles, and extension at 72 ℃ for 10 min.
(3) And (4) performing electrophoresis detection, namely performing electrophoresis detection by using 1.5% agarose gel, and performing gel cutting, recovery and purification if the size of the band is consistent with the expected size.
(4) And (4) recovering and purifying the gel, and performing PCR product purification reaction after gel tapping recovery by using a SanPrep column type DNA gel recovery kit.
(5) And (3) performing ligation reaction, namely constructing the recovered PCR product on a pMD18-T vector through TA ligation, wherein the reaction system is as follows:
TA cloning ligation System
After mixing evenly, reacting for 3-6h at 16 ℃.
(6) Transformation reaction, the ligation product was transformed into DH5 alpha E.coli competence for sequencing.
(7) Sequencing, namely selecting 3 bacteria liquid which is positive in the PCR detection in the steps, sequencing, performing sequence comparison by using DNAMAN software, keeping the bacteria liquid with the correct sequencing comparison, adding 20% of sterile glycerol with the same quantity to preserve bacteria, and storing the bacteria liquid at-80 ℃. The final moso bambooPeFeSOD2The gene sequence is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.
Example 2:PeFeSOD2obtaining of genetically heterologously transformed rice
(1) DNA extraction and PCR detection
Extracting DNA of T1 rice leaves, detecting whether the transgenic rice is positive by using a PCR detection mode, reserving positive plants, and collecting seeds subsequently. The method comprises the following specific steps:
firstly, preparing experimental tools such as a mortar and a pestle for experiments, sterilizing at high temperature, taking experimental materials stored at-80 ℃ in an ultralow-temperature refrigerator, adding liquid nitrogen into the mortar, and quickly grinding into powder.
② taking a sterilized 2mL centrifuge tube, adding the sample, then adding 800 mu LCTAB solution, uniformly mixing, heating in water bath at 65 ℃ for 30min, and uniformly mixing once every 10 min.
③ adding 800 mu L of trichloromethane into a centrifuge tube, evenly mixing, centrifuging at 12000g for 10min in a centrifuge, and keeping the supernatant.
Pre-cooling isopropanol at-20 deg.c for some time, adding pre-cooled isopropanol in 500 microliter into the supernatant, mixing and letting the sample stand at-20 deg.c for 20 min.
Fifthly, centrifuging the sample in 12000g for 10min in a centrifuge, pouring off the supernatant and keeping the bottom precipitate.
Sixthly, washing the precipitate by using 75% ethanol, centrifuging for 10min at 12000g in a centrifuge, pouring out supernatant, keeping the bottom precipitate, completely absorbing residual ethanol by using a liquid transfer gun, and naturally volatilizing in a super clean bench.
And seventhly, adding 30mL of TE buffer to dissolve the precipitate, detecting the concentration, and storing at-20 ℃.
Allowing the obtained DNA to undergo PCR detection, and finally obtaining 19 positive strains which are respectively named as OE-1 to OE-19 as shown in figure 1.
(2) RNA extraction andPeFeSOD2detection of Gene expression level
The RNA extraction method of example 1 was used to extract RNA from transgenic rice, and the details are not repeated here.
② carrying out the above-mentioned extraction of RNAPeFeSOD2And detecting the expression level of the gene. As can be seen from FIG. 2, the difference isPeFeSOD2The expression quantity of the transgenic rice line has great difference. And finally, selecting OE-4 and OE-8 transgenic plants for subsequent experiments according to the expression quantity measuring result and the quantity of harvested positive seeds.
(3) Culture of transgenic rice
Putting the obtained seeds of the transgenic rice positive seedlings in a 42 ℃ oven for drying for 5 days.
Soaking the seeds for 1-2 days, wrapping the seeds with wet gauze, accelerating germination for 2-3 days at the temperature of 28 ℃ until the seeds are exposed to the white, and subsequently transferring the rice seedlings to a water culture box.
And thirdly, selecting transgenic rice seedlings and wild-type seedlings which have consistent growth vigor in a water culture box, transferring the transgenic rice seedlings and the wild-type seedlings to a rice water culture nutrient solution for continuous culture, selecting 30 plants of each plant line, and culturing the plants in an intelligent greenhouse for about one month.
Example 3:PeFeSOD2application of gene heterogenous transformation rice in improving salt tolerance
(1) Salt stress treatment
Culturing rice to a proper size, respectively treating the rice water culture nutrient solution containing 150mM NaCl and a normal rice water culture nutrient solution, and performing phenotype observation statistics and enzyme activity related index determination on the treated rice water culture nutrient solution, wherein each group is provided with 3 repeats.
（2）PeFeSOD2Determination of stress resistance related physiological indexes of transgenic rice
(ii) detection of rice leaf Fv/Fm
And (3) respectively measuring Fv/Fm values of plant leaves at 0d, 1d, 3d and 5d of rice stress treatment by using a plant efficiency instrument, and determining the selected position of the plant leaves as second-leaf leaves of the plant. As shown in FIG. 3, the Fv/Fm values of both the normally cultured wild-type rice and the transgenic rice are between 0.78 and 0.80, and after salt stress treatment, the Fv/Fm value of the wild-type strain is decreased at a rate significantly higher than that of the transgenic strain, and by the 5 th day after treatment, the Fv/Fm value of the wild-type strain is decreased to less than 0.32, while the transgenic strain can still be maintained at more than 0.67. The above results illustratePeFeSOD2The salt stress resistance of the transgenic rice is stronger than that of a wild type strain. Phyllostachys pubescens SOD genePeFeSOD2Has the function of strengthening the salt tolerance of the salt stress resistance of plants to a certain extent.
Measurement of Malondialdehyde (MDA)
After the rice is treated for 24 hours with high salt, MDA content of a control group and an experimental group is determined by using a Malondialdehyde (MDA) content determination kit of Suzhou Keming Biotechnology Limited. The measurement method is as follows:
1) and (3) roughly extracting a sample, weighing 0.1g of leaf tissue, adding 1mL of extracting solution, performing ice bath homogenization, centrifuging at 8000g and 4 ℃ for 10min, and placing on ice for detection.
2) 0.6mL of reagent one is sucked into a 1.5mL centrifuge tube, 0.2mL of sample is added, and the mixture is mixed evenly.
3) Preserving heat in 95 ℃ water bath for 30min, placing in an ice bath for cooling, and centrifuging for 10min at 25 ℃ after cooling of 10000 g.
4) The supernatant was pipetted into a 1mL glass cuvette and the absorbance at 532nm and 600nm was measured and recorded as a532 and a600, Δ a = a532-a 600.
5) Calculating the MDA content according to the following formula:
MDA content (μmol/g FW) = [ Δ A × Total volume of reaction System 8 × 10%-4L/A (malonaldehyde molar extinction coefficient 155 a)103L/mol/cm multiplied by the optical path of the cuvette 1cm multiplied by 109) Division (sample mass 0.1 g. Add sample volume 0.2mL division add extract volume 1 mL)]=0.258×ΔA。
The determination results are shown in fig. 4, and under normal conditions, the MDA content of the transgenic rice line and the wild-type rice line is maintained at a low value, and no significant difference exists. However, after the rice is subjected to salt stress treatment, the MDA content of the rice is increased, and the MDA content of the wild type strain is increased more quickly, which means that the cell membrane of the wild type rice is damaged more seriously and the transgenic rice is damaged less, which also reflects that the transgenic rice is possibly stronger in stress resistance compared with the wild type rice.
③ determination of superoxide dismutase (SOD) Activity
After the rice is treated for 24 hours with high salt, superoxide dismutase (SOD) activity determination kits of Suzhou Keming biotechnology limited company are used for determining the SOD enzyme activity of the control group and the experimental group. The measurement method is as follows:
1) extracting the crude enzyme solution, weighing 0.1g of leaf tissue, adding 1mL of extracting solution, performing ice bath homogenization, centrifuging at 8000g and 4 ℃ for 10min, and placing on ice for detection.
2) Preheating the spectrophotometer for more than 30min, adjusting the wavelength to 450nm, and adjusting the distilled water to zero.
3) Diluting the reagent three-purpose distilled water by 50 times, uniformly mixing the reagent I and the reagent II in a ratio of 20mL to 0.1mL, and dissolving the reagent IV powder in 5mL of distilled water. The working solution is prepared from the following specific components:
and (3) measuring the tube: add 50. mu.L of sample, 50. mu.L of diluted reagent three, 800. mu.L of mixture of reagent one and reagent two, and 100. mu.L of reagent four.
And (4) control: 50 μ L of distilled water, 50 μ L of diluted reagent three, 800 μ L of mixed solution of reagent one and reagent two, and 100 μ L of reagent four were added.
4) After the measuring tube and the control tube are fully mixed, the light absorption value A and the A control are measured at 450 nm.
5) SOD enzyme activity is calculated, and the unit is defined as that when the inhibition percentage in a xanthine oxidase coupling reaction system is 50%, the SOD enzyme activity in the reaction system is defined as one enzyme activity unit. The specific calculation formula is as follows:
percent inhibition = (a control-a assay) ÷ a control × 100%;
SOD activity (U/g FW) = [ inhibition percentage ÷ (1-inhibition percentage) × total reaction system volume 1mL ]/(sample mass 0.1g × sample volume added to total reaction system 0.05mL ÷ added extract volume 1 mL) =200 × inhibition percentage ÷ (1-inhibition percentage).
As shown in FIG. 5, even if the sample was not processed,PeFeSOD2the SOD enzyme content of the transgenic rice over-expression strains OE-4 and OE-8 is obviously higher than that of the wild type. And after high-salt treatment for 12 hours, the SOD enzyme contents of the wild rice and the transgenic rice are increased, but the SOD enzyme contents of the two lines of the transgenic rice are increased to a higher degree compared with the wild rice, which shows that the SOD enzyme activity of the transgenic rice is higher than that of the wild rice, and the stress resistance of the transgenic rice to salt stress is higher than that of the wild rice.
（3）PeFeSOD2Salt tolerant phenotype analysis of transgenic rice
After salt treatment, the phenotypes of the transgenic rice and the wild rice were observed as shown in fig. 6, and under the condition of normal growth, the transgenic rice and the wild rice were relatively consistent in growth vigor and no obvious difference occurs. However, after the rice water culture nutrient solution with 150mM NaCl is treated, the growth vigor of the transgenic rice and the wild rice is obviously different. After NaCl treatment for 3 days, the yellowing and curling phenomena of wild rice leaves are more serious, and the yellowing and curling phenomena of transgenic line leaves are obviously lighter than those of wild rice leaves. After 7 days of NaCl treatment, as shown in the figure, the leaves of the wild rice are almost completely yellow or whitened, while the leaves of the transgenic rice have no obvious change. In addition, the invention also carries out relevant statistics on the plant height, the root length, the leaf number and the yellow leaf number of different rice lines under different treatments. As shown in table 1, the plant height and root length of the transgenic rice and the wild-type rice were not significantly different in the absence of salt stress, but were shorter than those of the untreated rice in the absence of salt stress, but were significantly lower in the plant height and root length. In addition, according to significance analysis, the leaf number of different rice lines under different treatments is not significantly different, but the yellow leaf number of wild rice is significantly more than that of transgenic rice under the same treatment after salt stress treatment. The results also indicate that the transgenic rice has stronger salt stress resistance than the wild rice.
TABLE 1 phenotypic analysis of different Rice lines under salt stress treatment
（4）PeFeSOD2Transgenic rice salt stress related gene expression analysis
To study furtherPeFeSOD2The research also determines the related genes of Na + channel and K + channel proteinOsSOS1，OsHKT1AndOsKAT1expression profile of (2). The results are shown in FIG. 7, for wild-type rice and transgenic rice under normal growth conditionsOsSOS1AndOsHKT1does not change significantly with time, butOsKAT1The gene is up-regulated to a certain degree, but the up-regulated expression level is not high, and the expression patterns of the three genes of the wild rice and the transgenic rice are basically consistent. But transgenic rice after salt stress treatmentOsSOS1，OsHKT1AndOsKAT1the expression quantity is increased sharply, and the expression quantities of the three genes of the wild type strain are also increased to a certain extent, but the up-regulation degree is far lower than that of the transgenic strain. In conclusion, it is shown thatPeFeSOD2The transgenic rice can up-regulate the expression of related genes of Na + channel and K + channel proteins, thereby better maintaining the concentration balance of Na + and K + per se and enhancing the salt stress resistance per se.
Sequence listing
<110> Zhejiang agriculture and forestry university
<120> phyllostachys edulis salt stress response gene PeFeSOD2 and application thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1281
<212> DNA
<213> Phyllostachys edulis
<400> 1
atggcgttca ccacactggt ggccgtggga ggcggcctct ctcttggtct cttcgcctcc 60
tcgagctcca gctccagctc cgcttccttc ctcctctgcg gcggcggcgg cgactcccga 120
cggcatggac tccgccgctt cgtcatccca cagagaggag gctccagggg agagaggacg 180
agaagatggg attgccttgt acttcattgt gccaatgagg cgaatgtggt gactgaggat 240
gatgctgtgg acgatgctac tgatgatgaa accgcttctg atgctgatac ggatgacgct 300
gttgagaccg gcggtgatgg tgcagatggg ctggaatccc cacctctcga cgatgctgct 360
tctattgcct ggataaagca acagcccctt ccttatcctt cggatgctct tgagccatac 420
atgagcaagg agacggtgga gcagcactgg ggaattcatc agcacatgca cgtggagagg 480
ctcaacggca tgatcggtgg cagtgagtgg gaggggatgt cactggggca gatgatgctc 540
tcctccttca acgagggcag ggagccaccc catcctccct tcttccatgc tgcacagata 600
tggaaccatg atttcttttg gcggtccatg aagcctggtg gtgggggcaa gccccctgaa 660
cggcttctga aatttattaa cagggacttc ggatcctatg acggcatgat ccaacaattc 720
atagatgctg cattaactca atttggttct ggatgggttt ggctatgtta caaagggagc 780
aagttgcctc acgtgaattc aagaagccca atcccatctg acaattatgg taggctggtc 840
atctcaaaga cgccgaatgc tgtcaaccct cttgcctggg gtcactctcc actccttgca 900
attgatgttt gggagcatgc gtactacctg gattatgaga atcggaaggc tgattacgtc 960
tccacatttc tagataagct tgtgtcatgg gaaatggttg aggccaggct caagaaggcc 1020
gttgtacgag caatagaaag agatgggcat atcaacacaa agcagctaag gaagcaactt 1080
ttagctcggg cgaagagtcg aagcagaggt aggcctcagc aggccaatgg agatgcaaga 1140
gagcagacca gcagtcaggc gagaaggcga ccaagaagcc cgattcagca ggcctctaga 1200
ggcgtgacaa tggagagcgc aagtggggcg cagcaggcgg ctcgtgtagc tgagttgagc 1260
cgtgaggatg gtgacttgta g 1281
<210> 2
<211> 426
<212> PRT
<213> Phyllostachys edulis
<400> 2
Met Ala Phe Thr Thr Leu Val Ala Val Gly Gly Gly Leu Ser Leu Gly
1 5 10 15
Leu Phe Ala Ser Ser Ser Ser Ser Ser Ser Ser Ala Ser Phe Leu Leu
20 25 30
Cys Gly Gly Gly Gly Asp Ser Arg Arg His Gly Leu Arg Arg Phe Val
35 40 45
Ile Pro Gln Arg Gly Gly Ser Arg Gly Glu Arg Thr Arg Arg Trp Asp
50 55 60
Cys Leu Val Leu His Cys Ala Asn Glu Ala Asn Val Val Thr Glu Asp
65 70 75 80
Asp Ala Val Asp Asp Ala Thr Asp Asp Glu Thr Ala Ser Asp Ala Asp
85 90 95
Thr Asp Asp Ala Val Glu Thr Gly Gly Asp Gly Ala Asp Gly Leu Glu
100 105 110
Ser Pro Pro Leu Asp Asp Ala Ala Ser Ile Ala Trp Ile Lys Gln Gln
115 120 125
Pro Leu Pro Tyr Pro Ser Asp Ala Leu Glu Pro Tyr Met Ser Lys Glu
130 135 140
Thr Val Glu Gln His Trp Gly Ile His Gln His Met His Val Glu Arg
145 150 155 160
Leu Asn Gly Met Ile Gly Gly Ser Glu Trp Glu Gly Met Ser Leu Gly
165 170 175
Gln Met Met Leu Ser Ser Phe Asn Glu Gly Arg Glu Pro Pro His Pro
180 185 190
Pro Phe Phe His Ala Ala Gln Ile Trp Asn His Asp Phe Phe Trp Arg
195 200 205
Ser Met Lys Pro Gly Gly Gly Gly Lys Pro Pro Glu Arg Leu Leu Lys
210 215 220
Phe Ile Asn Arg Asp Phe Gly Ser Tyr Asp Gly Met Ile Gln Gln Phe
225 230 235 240
Ile Asp Ala Ala Leu Thr Gln Phe Gly Ser Gly Trp Val Trp Leu Cys
245 250 255
Tyr Lys Gly Ser Lys Leu Pro His Val Asn Ser Arg Ser Pro Ile Pro
260 265 270
Ser Asp Asn Tyr Gly Arg Leu Val Ile Ser Lys Thr Pro Asn Ala Val
275 280 285
Asn Pro Leu Ala Trp Gly His Ser Pro Leu Leu Ala Ile Asp Val Trp
290 295 300
Glu His Ala Tyr Tyr Leu Asp Tyr Glu Asn Arg Lys Ala Asp Tyr Val
305 310 315 320
Ser Thr Phe Leu Asp Lys Leu Val Ser Trp Glu Met Val Glu Ala Arg
325 330 335
Leu Lys Lys Ala Val Val Arg Ala Ile Glu Arg Asp Gly His Ile Asn
340 345 350
Thr Lys Gln Leu Arg Lys Gln Leu Leu Ala Arg Ala Lys Ser Arg Ser
355 360 365
Arg Gly Arg Pro Gln Gln Ala Asn Gly Asp Ala Arg Glu Gln Thr Ser
370 375 380
Ser Gln Ala Arg Arg Arg Pro Arg Ser Pro Ile Gln Gln Ala Ser Arg
385 390 395 400
Gly Val Thr Met Glu Ser Ala Ser Gly Ala Gln Gln Ala Ala Arg Val
405 410 415
Ala Glu Leu Ser Arg Glu Asp Gly Asp Leu
420 425
<210> 3
<211> 20
<212> DNA
<213> primer (primer)
<400> 3
atggcgttca ccacactggt 20
<210> 4
<211> 21
<212> DNA
<213> primer (primer)
<400> 4
ctacaagtca ccatcctcac g 21
Claims (1)
1. Salt stress response gene of moso bambooPeFeSOD2Application of salt tolerance enhancing gene of rice and salt stress response gene of moso bambooPeFeSOD2The nucleotide sequence of (A) is shown in SEQ ID No. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010994483.7A CN112094827B (en) | 2020-09-21 | 2020-09-21 | Phyllostachys pubescens salt stress response gene PeFeSOD2 and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010994483.7A CN112094827B (en) | 2020-09-21 | 2020-09-21 | Phyllostachys pubescens salt stress response gene PeFeSOD2 and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN112094827A CN112094827A (en) | 2020-12-18 |
| CN112094827B true CN112094827B (en) | 2022-02-22 |
Family
ID=73754804
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010994483.7A Active CN112094827B (en) | 2020-09-21 | 2020-09-21 | Phyllostachys pubescens salt stress response gene PeFeSOD2 and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112094827B (en) |
-
2020
- 2020-09-21 CN CN202010994483.7A patent/CN112094827B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN112094827A (en) | 2020-12-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN109797157B (en) | Abiotic stress resistant transcription factor PbrbHLH92, primer thereof, encoded protein and application | |
| CN102112613A (en) | Genes, proteins and vectors for increaseing tolerance of plants and microbes to abiotic stresses and use thereof | |
| CN110317816A (en) | A kind of transcription factor NtMYB44b that can improve tobacco drought resisting and its directed mutagenesis method and application | |
| CN111763683B (en) | Cryptomeria fortunei CfICE1 gene and application thereof | |
| CN113621040B (en) | Du pear salt-tolerant gene PbHSF3A and application thereof in plant salt-tolerant genetic improvement | |
| CN108728450B (en) | Gene CdERF1 significantly induced by low temperature in cynodon dactylon and application thereof | |
| CN113621625A (en) | Application of sesame SiERF103 gene in enhancing plant resistance | |
| CN108410880B (en) | Danbo black soybean citric acid transport protein gene and application thereof | |
| CN113046362B (en) | Gene for improving cadmium resistance cadmium content and relieving cadmium stress DNA damage and application thereof | |
| CN104388433B (en) | A kind of Plant Osmotic Stress inducible promoter and application thereof | |
| CN111763251B (en) | Trifolium repens transcription factor TrNAC and coding sequence and application thereof | |
| CN112094827B (en) | Phyllostachys pubescens salt stress response gene PeFeSOD2 and application thereof | |
| CN113943742B (en) | Gene DcCIPK24 capable of improving drought tolerance and salt tolerance of plants and application thereof | |
| CN106892973A (en) | Plant adversity resistance related protein GhMYB4 and encoding gene and application | |
| CN107090462B (en) | NF-Y nuclear transcription factor gene ZmNF-YA13, protein encoded by same and application thereof | |
| CN111662368B (en) | Rubber grass drought-enduring gene TkMYC2, protein, primer, vector, host bacterium and application thereof | |
| CN111996197B (en) | Salt-tolerant gene and protein of pyrus betulaefolia, recombinant vector and application | |
| CN112391405B (en) | Application of tea tree hexokinase CsHXK3 gene in regulation of plant growth and development and enhancement of cold resistance | |
| CN106146635B (en) | Corn ZmSTP1 protein and coding gene and application thereof | |
| CN108118063B (en) | Mulberry potassium ion channel related gene MaKCO5 and application thereof | |
| CN107630026B (en) | Extremely dry-tolerant erythroaldehyde dehydrogenase gene and encoded protein thereof | |
| CN111454340A (en) | Elytrigia elongata external rectification potassium channel protein and coding gene and application thereof | |
| CN104774847A (en) | Julans sigillata Dode proline-enriched protein gene JsPRP1 and applications thereof | |
| CN113604475B (en) | Application of cotton GH_D03G1517 gene in promotion of drought resistance and salt tolerance | |
| CN116497038B (en) | Alfalfa low temperature resistant gene MfJAZ1 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20220523 Address after: Room a-6614, building 3, No. 20, Yong'an Road, Shilong Economic Development Zone, Mentougou District, Beijing 102300 Patentee after: Zoomlion Tiansheng (Beijing) Biotechnology Co.,Ltd. Address before: 311300 Wu Su street, Ling'an District, Hangzhou, Zhejiang Province, No. 666 Patentee before: ZHEJIANG A & F University |