CN112029883A - Dual-probe detection kit for avian pathogenic group escherichia coli - Google Patents
Dual-probe detection kit for avian pathogenic group escherichia coli Download PDFInfo
- Publication number
- CN112029883A CN112029883A CN202011045188.3A CN202011045188A CN112029883A CN 112029883 A CN112029883 A CN 112029883A CN 202011045188 A CN202011045188 A CN 202011045188A CN 112029883 A CN112029883 A CN 112029883A
- Authority
- CN
- China
- Prior art keywords
- escherichia coli
- detection
- yjaa
- chua
- probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/16—Primer sets for multiplex assays
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a dual-probe detection kit for detecting B2 group escherichia coli and D group escherichia coli, which aims at avian escherichia coli virulence island geneschuAAndyjaA2 pairs of specific primers and fluorescent probes which are not interfered with each other are designed and screened, the screening of pathogenic group escherichia coli can be completed in one reaction, B2 and D groups are separated, the detection reaction is high in brightness and strong in specificity, the lower detection limit can reach 5 copies/reaction, the detection process is rapid and efficient, and the method is suitable for large-batch detection.
Description
Technical Field
The invention belongs to the technical field of biological detection, and particularly relates to a dual-probe detection kit for escherichia coli of an avian pathogenic group.
Background
Avian colibacillosis is a general term for acute and chronic infectious diseases of poultry caused by avian pathogenic escherichia coli. It is a major cause of high morbidity and mortality in the poultry industry around the world. The pathogenic escherichia coli of poultry can induce poultry to generate different clinical symptoms, mainly including escherichia coli septicemia, escherichia coli granuloma, air sac disease (chronic respiratory disease), poultry cellulitis, swollen head syndrome, peritonitis, meningitis, salpingitis, synovitis, omphalitis, yolk sac infection and the like. Since ligniers (1894) first reported colibacillosis in chickens, many developed countries and regions of the poultry industry in the world have been reported to develop this disease. With the rapid development of the intensive poultry industry, the species, incidence and severity of colibacillosis have a continuously increasing trend, which becomes one of the important diseases harming the poultry industry, and brings serious threat and great economic loss to the poultry industry.
The Escherichia coli antigens are complex and have a plurality of serotypes, and 173 Escherichia coli O antigens (thalli antigens) are determined so far, and the antigen typing is the most basic serological typing of Escherichia coli; the number of K antigen (capsular antigen) types is also more than 100. Common dominant serotypes of avian pathogenic E.coli are O1, O2, O11, O18, O26, O35, O78, O88, and the like. The method for identifying pathogenic escherichia coli by serological identification and typing has long detection time and complex operation, and is difficult to realize simultaneous detection of large-batch samples clinically. Therefore, a rapid, efficient, sensitive and specific detection method is urgently needed.
Phylogenetic grouping is an important feature of the molecular epidemiology of E.coli. Scientists have discovered 3 genes that can distinguish between different populations of E.coli by constructing a subtractive library: chuA, yjaA and DNA fragment tspe4.c 2. Coli were divided into 4 groups of A, B1, B2 and D according to different combinations of three genes: that is, those containing the chuA gene and yjaA gene were B2 group, those containing only chuA gene and not yjaA gene were D group, and those containing no chuA gene were B1 or A group. Epidemiological data at home and abroad indicate that the pathogenic escherichia coli outside the intestinal tract is mainly B2 and D group, so that the escherichia coli B2 and D group are also called pathogenic group escherichia coli.
The TaqMan probe method, a new real-time quantitative PCR technology, has become an effective means for detecting and quantifying microorganisms with extremely low concentration. Real-time PCR is more sensitive than conventional PCR, saves more time for screening large clinical sample amount, does not need gel electrophoresis, and is faster than traditional PCR. Compared with SYBR Green I dye method, the TaqMan probe method has the advantages that the fluorescence signal of the TaqMan probe method is only from the target sequence and is not influenced by primer dimer, and the probe used by the TaqMan probe method can be combined with any double-stranded DNA and even non-specific amplification can be carried out. The method is rapid, high in specificity, high in sensitivity and relatively low in cost, and becomes a first-choice diagnostic tool for measuring bacteria in food, water, feces and tissue samples. On the basis of a probe-method fluorescent quantitative PCR technology, establishing the avian pathogenic group escherichia coli dual-probe-method fluorescent PCR aiming at the chuA and yjaA genes has very important significance.
Disclosure of Invention
In the prior art, Escherichia coli in poultry is detected by separating and identifying bacteria, pathogenic or nonpathogenic Escherichia coli is distinguished by serological typing, PCR detection aiming at a single virulence gene or multiple common PCR detection aiming at multiple genes is also available, but rapid, sensitive and systematic detection of mass samples cannot be realized. Aiming at avian-origin escherichia coli virulence island genes chuA and yjaA, 2 pairs of non-interfering specific primers and fluorescent probes are designed and screened, the screening of pathogenic escherichia coli can be completed in one reaction, groups B2 and D are separated, the lower detection limit can reach 5 copies/reaction, the detection process is rapid and efficient, and the kit is suitable for large-scale detection.
In order to achieve the purpose, the invention adopts the following technical scheme:
real-time fluorescent quantitative PCR primers and probes for detection of B2 group E.coli and D group E.coli:
the specific primers are as follows:
chuA1：5’－CTGGGTGGAGTGATCTCCTA－3’
chuA2：5’－TGCCGCCAGTACCAAAG－3’
yjaA1：5’－GAAAGCAAACGTGAAGTGTCAG－3’
yjaA2：5’－GGTGGAGTTGCAGAACAAGA－3’
the specific probe is as follows:
chuAP：5’－FAM－TTGCAGGAAGGACAAAGCAGTGGT－BHQ1－3’
yjaAP：5’－HEX－CCAGCGCCTGTTAATCGCCAATTT－BHQ1－3’。
the avian pathogenic group escherichia coli dual probe detection kit comprises the primer and the probe; further, the kit also comprises a qPCR reaction solution, a chuA gene positive plasmid and a yjaA gene positive plasmid.
The invention also provides an application method of the avian pathogenic bacteria escherichia coli dual probe detection kit in the specific embodiment, which comprises the following steps:
1. sample processing and DNA template extraction
The intestinal tract is the main parasitic part of pathogenic colibacillus, live poultry can take intestinal tract contents by collecting anal cotton swabs, dead poultry can directly take small tissues from meat products, DNA is extracted, and positive control and negative control are set for each detection.
2. Reaction system and reaction parameters
The reaction system is as follows:
TABLE 1 fluorescent PCR reaction System
The fluorescence PCR reaction is carried out on a multi-channel fluorescence quantitative PCR instrument, fluorescence signals FAM and HEX are selected, and the reaction parameters are as follows: at 95 ℃ for 5min, then at 95 ℃ for 10sec, and at 58.1 ℃ for 30sec, 40 cycles were performed with dual fluorescence detection at 58.1 ℃ and the threshold set to the point where the threshold line just exceeded the peak of the normal negative sample.
3. Result judgment
The result was determined from the Ct value (threshold cycle, the number of cycles that the fluorescence signal in each reaction tube reached to a set threshold) of each probe and the amplification curve by fluorescence quantification.
(1) Quality control standard
Negative control: no Ct value and no amplification curve;
positive control: ct value is less than or equal to 30, and amplification curve obviously increases logarithmically;
if one of the negative control or the positive control does not meet the standard, the detection is invalid;
(2) the result of the judgment
Under the premise that the detection result is established, the Ct value of the detection sample is less than or equal to 35.0, and a specific amplification curve appears, so that the detection sample is judged to be positive; otherwise, the result is judged to be negative. When the FAM channel (chuA detection) is positive and the HEX channel (yjaA detection) is positive, the detection result is reported as positive detection of B2 group escherichia coli; when the FAM channel (detecting chuA) is positive but the HEX channel (detecting yjaA) is negative, the detection result is reported as positive detection of D group escherichia coli; when both the FAM channel (for detecting chuA) and the HEX channel (for detecting yjaA) are negative, the detection result is reported as the detection negative of pathogenic escherichia coli.
Compared with the prior art, the invention has the following advantages and effects:
in the prior art, bacteria separation is mainly used, a PCR detection method is established for part of strains, but no method and standard for quickly, sensitively and systematically detecting various food-borne pathogenic bacteria in chicken or chicken products exist at present. The invention develops and develops a double-fluorescence PCR detection kit aiming at virulence island genes chuA and yjaA of avian Escherichia coli by using a Taqman probe method multiple real-time fluorescence quantitative PCR technology. According to the invention, pathogenic group escherichia coli can be screened from a sample through one reaction, and group B and group D can be simultaneously separated, the detection reaction sensitivity is high, the specificity is strong, the detection lower limit can reach 5 copies/reaction system, the detection process is rapid and efficient, and the method is suitable for large-scale detection. The kit provided by the invention can be used for detecting poultry anus swabs, can be used for clinically detecting a large number of samples without causing damage to detected animals, is favorable for clinical popularization, and can also be used for detecting escherichia coli pollution in the poultry product processing process. The kit provides a tool and a method for detecting, preventing and controlling escherichia coli in the poultry industry chain.
Drawings
FIG. 1 is a graph showing the amplification of a mixture of the chuA and yjaA genes while performing a dual fluorescence PCR assay. 1 is chuA and 2 is yjaA.
FIG. 2 is a graph showing the amplification curve of chuA gene detected by the kit and the detection method thereof.
FIG. 3 is a yjaA gene standard graph.
FIG. 4 is a graph showing the amplification curve of chuA gene detected by the kit and the detection method thereof.
FIG. 5 is a yjaA gene standard graph.
Detailed Description
The invention is further described with reference to the following figures and specific examples, which are intended to be illustrative only and not limiting to the scope of the invention.
EXAMPLE 1 design and screening of primers and probes
Downloading chuA and yjaA whole gene sequences from different sources from GenBank, and designing 3 pairs of primers and corresponding TaqMan probes. Sequence alignment analysis and design was performed using Primer Premier5 and Oligo7 software. In designing the probe, designing up-and-down primers in the conserved region of the chuA and yjaA genes, and designing the primers and the probe on two strands, wherein the length is kept between 15 and 32bp, and the probe fragment ensures that the GC content is between 30 and 80 percent. The Tm values of the primers and the probes are higher than those in the conventional PCR, and the amplified fragments are kept between 50bp and 150 bp. Probes specifically binding with target genes are designed between the upstream and downstream primers, and the two genes are marked by different fluorescent groups. The 5 'end of the chuA probe is marked with FAM (Green) fluorescent group, and the 3' end is marked with BHQ1 quenching group. The 5 'end of the yjaA probe is marked with a HEX (Pink) fluorescent group, and the 3' end is marked with a BHQ1 quenching group. Wherein the probe is purified by HPLC, the upstream and downstream primers are purified by PAGE, and the absolute value of the Δ G value is not more than 5.
The designed primers and probes are used for analyzing the linear relation between the amplification efficiency and the amplification curve and screening the optimal combination by amplifying the chuA gene positive plasmid and the yjaA gene positive plasmid (connected to a pUCm-T vector).
The specific primers finally selected were:
chuA1：5’－CTGGGTGGAGTGATCTCCTA－3’
chuA2：5’－TGCCGCCAGTACCAAAG－3’
yjaA1：5’－GAAAGCAAACGTGAAGTGTCAG－3’
yjaA2：5’－GGTGGAGTTGCAGAACAAGA－3’
the specific probes finally selected were:
chuAP：5’－FAM－TTGCAGGAAGGACAAAGCAGTGGT－BHQ1－3’
yjaAP：5’－HEX－CCAGCGCCTGTTAATCGCCAATTT－BHQ1－3’
example 2 avian pathogenic bacteria Escherichia coli double probe method fluorescence PCR detection kit
A poultry pathogenic group escherichia coli double probe method fluorescence PCR detection kit comprises: specific primers chuA1, chuA2, yjaA1 and yjaA2, two fluorescent probes chuAP and yjaAP, a fluorescent PCR reaction solution and chuA and yjaA standards (chuA gene positive plasmid; yjaA gene positive plasmid). The fluorescent PCR reaction solution comprises the following components: qPCR Probe Master Mix; deionized water; primers specific for two pairs of genes: chuA1, chuA2, yjaA1, yjaA2, and two fluorescent probes: chuAP, yjaAP.
The specific primers are as follows:
chuA1：5’－CTGGGTGGAGTGATCTCCTA－3’
chuA2：5’－TGCCGCCAGTACCAAAG－3’
yjaA1：5’－GAAAGCAAACGTGAAGTGTCAG－3’
yjaA2：5’－GGTGGAGTTGCAGAACAAGA－3’
the specific probe is as follows:
chuAP：5’－FAM－TTGCAGGAAGGACAAAGCAGTGGT－BHQ1－3’
yjaAP: 5 '-HEX-CCAGCGCCTGTTAATCGCCAATTT-BHQ 1-3'. Example 3 specificity and sensitivity of avian pathogenic bacteria Escherichia coli double-probe method fluorescence PCR detection method, Material and method
(1) Bacterial strains
Standard strains of Avian Pasteurella (Avian Pasteurella Multocida C48-1), Salmonella (Salmonella enteritidis CVCC 3375), Escherichia coli (Escherichia coli ATCC25922), and Campylobacter jejuni (Campylobacter. jejuni ATCC 33291) were purchased from the China center for culture of microorganisms.
(2) Extraction of bacterial DNA
Bacterial DNA was extracted using the QIAxtractor high throughput nucleic acid purification workstation according to the instructions. Mu.l was taken as template for PCR reaction.
(3) Fluorescent PCR reaction conditions
After a series of optimization, the total volume of the reaction is 25. mu.l, and the reaction system is shown in Table 1.
Detecting on a multi-channel fluorescent quantitative PCR instrument, selecting fluorescent signals FAM and HEX, and carrying out reaction parameters as follows: at 95 ℃ for 5min, then at 95 ℃ for 10sec, and at 58.1 ℃ for 30sec, 40 cycles were performed with dual fluorescence detection at 58.1 ℃ and the threshold set to the point where the threshold line just exceeded the peak of the normal negative sample.
(4) Specificity detection for dual fluorescent PCR reactions
Selecting poultry Pasteurella, Salmonella, Escherichia coli and Campylobacter jejuni standard strains, Escherichia coli DH5 alpha, Staphylococcus aureus, enterococcus and chicken tissue, extracting DNA, and performing multiplex fluorescence PCR detection.
(5) Sensitivity detection of dual fluorescent PCR reactions
And (3) carrying out 10-time series gradient dilution by using the constructed chuA and yjaA plasmid standards (with pUCm-T as a framework) as a reaction template, carrying out fluorescence PCR reaction in parallel, and detecting the sensitivity and the lowest detection limit of each dilution gradient, wherein each dilution gradient is subjected to 3 detection repetitions.
Second, test results
(1) Detection result of double fluorescence PCR of standard substance
The chuA and yjaA plasmid standard samples are added into one reaction system at the same time, as shown in figure 1, 2 fluorescent amplification curves are amplified, 1 is chuA and 2 is yjaA, and the results show that one reaction system can simultaneously detect 2 samples of escherichia coli virulence island genes without interfering the detection results.
The chuA and yjaA standards were detected by fluorescence PCR, respectively, and the amplification curves were significantly logarithmically increased as shown in FIGS. 2 and 4.
(2) Specificity of quadruple fluorescent PCR reaction
After the 7 strains and the chicken tissues are detected by the method, only a positive control has an amplification curve, and the 7 strains, the muscle tissues and the negative control have no single amplification curve.
(3) Sensitivity of Dual fluorescent PCR reactions
And performing fluorescence PCR amplification on the chuA and yjaA standard sample after 10-fold gradient dilution, drawing a standard curve, and as shown in figures 3 and 5, aiming at the linear relation of Ct values of the detection results of the two genes, the Ct values are both greater than 0.99, the repeatability among the repetitions is good, and the minimum detection limit of 2 genes can reach 5 copies/reaction.
Example 4
335 chicken anus swab samples collected in a laboratory were tested by the established double fluorescent PCR method (which can be completed within 2 hours).
Firstly, preparation of bacterial DNA template
The anal swab of the live chicken to be tested was taken from a sterilized cotton swab, diluted with 200. mu.l PBS, 100. mu.l of the dilution was used to extract bacterial DNA using the QIAxtractor high throughput nucleic acid purification workstation, and the chuA and yjaA standards provided in the kit were used as positive controls and sterile water as a negative control.
Secondly, preparing a double fluorescence PCR detection reaction system according to the table 1
Third, PCR reaction conditions
Detecting on a multi-channel fluorescent quantitative PCR instrument, selecting fluorescent signals FAM and HEX, and carrying out reaction parameters as follows: at 95 ℃ for 5min, then at 95 ℃ for 10sec, and at 58.1 ℃ for 30sec, 40 cycles were performed with dual fluorescence detection at 58.1 ℃ and the threshold set to the point where the threshold line just exceeded the peak of the normal negative sample.
Fourthly, judgment of the result
(1) Quality control standard
Negative control: no Ct value and no amplification curve;
positive control: ct value is less than or equal to 30, and amplification curve obviously increases logarithmically;
if one of the negative control or the positive control does not meet the standard, the detection is invalid;
(2) and (4) judging the result:
under the premise that the detection result is established, the Ct value of the detection sample is less than or equal to 35.0, and a specific amplification curve appears, so that the detection sample is judged to be positive; otherwise, the result is judged to be negative.
When the FAM channel (chuA detection) is positive and the HEX channel (yjaA detection) is positive, the detection result is reported as positive detection of B2 group escherichia coli; when the FAM channel (detecting chuA) is positive but the HEX channel (detecting yjaA) is negative, the detection result is reported as positive detection of D group escherichia coli; when both the FAM channel (for detecting chuA) and the HEX channel (for detecting yjaA) are negative, the detection result is reported as the detection negative of pathogenic escherichia coli.
Fifthly, detection results are as follows:
the detection result shows that 110 samples are chuA positive samples and 65 samples are yjaA positive samples. The correctness of the detection result of the double fluorescence PCR is also confirmed by the bacteria separation identification and the common PCR result.
Claims (3)
- The real-time fluorescent quantitative PCR detection primers and probes for B2 group escherichia coli and D group escherichia coli are characterized in that:the primer is as follows:chuA1：5’－CTGGGTGGAGTGATCTCCTA－3’chuA2：5’－TGCCGCCAGTACCAAAG－3’yjaA1：5’－GAAAGCAAACGTGAAGTGTCAG－3’yjaA2：5’－GGTGGAGTTGCAGAACAAGA－3’the specific probe is as follows:chuAP：5’－FAM－TTGCAGGAAGGACAAAGCAGTGGT－BHQ1－3’yjaAP：5’－HEX－CCAGCGCCTGTTAATCGCCAATTT－BHQ1－3’。
- 2. the avian pathogenic group escherichia coli dual probe detection kit is characterized by comprising the primer and the probe of claim 1.
- 3. The dual probe detection kit for pathogenic escherichia coli of avian species according to claim 2, further comprising a qPCR reaction solution, a chuA gene positive plasmid, and a yjaA gene positive plasmid.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011045188.3A CN112029883A (en) | 2020-09-28 | 2020-09-28 | Dual-probe detection kit for avian pathogenic group escherichia coli |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011045188.3A CN112029883A (en) | 2020-09-28 | 2020-09-28 | Dual-probe detection kit for avian pathogenic group escherichia coli |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN112029883A true CN112029883A (en) | 2020-12-04 |
Family
ID=73574816
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011045188.3A Pending CN112029883A (en) | 2020-09-28 | 2020-09-28 | Dual-probe detection kit for avian pathogenic group escherichia coli |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN112029883A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690889A (en) * | 2012-06-18 | 2012-09-26 | 黑龙江八一农垦大学 | Multiple-PCR (polymerase chain reaction) kit and detection method of Escherichia coli (E.coli) |
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| CN109355437A (en) * | 2018-12-11 | 2019-02-19 | 上海捷诺生物科技有限公司 | A kind of respiratory pathogen Multiple detection kit |
-
2020
- 2020-09-28 CN CN202011045188.3A patent/CN112029883A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102690889A (en) * | 2012-06-18 | 2012-09-26 | 黑龙江八一农垦大学 | Multiple-PCR (polymerase chain reaction) kit and detection method of Escherichia coli (E.coli) |
| CN106119413A (en) * | 2016-07-01 | 2016-11-16 | 浙江省疾病预防控制中心 | A kind of HIV (human immunodeficiency virus) multiple fluorescence PCR detection reagent box and detection method |
| CN109355437A (en) * | 2018-12-11 | 2019-02-19 | 上海捷诺生物科技有限公司 | A kind of respiratory pathogen Multiple detection kit |
Non-Patent Citations (5)
| Title |
|---|
| JERMAINE KHUMALO等: "Diagnostic accuracy of two multiplex real-time polymerase chain reaction assays for the diagnosis of meningitis in children in a resource-limited setting", 《PLOS ONE》 * |
| MOUNIRA SMATI等: "Real-Time PCR for Quantitative Analysis of Human Commensal Escherichia coli Populations Reveals a High Frequency of Subdominant Phylogroups", 《APPL ENVIRON MICROBIOL》 * |
| XIN WANG等: "Clinical Validation of Multiplex Real-Time PCR Assays for Detection of Bacterial Meningitis Pathogens", 《J CLIN MICROBIOL》 * |
| 张召兴等: "河北地区蛋鸡源大肠杆菌分子分群、耐药性及生物被膜检测与分析", 《中国兽医学报》 * |
| 陈亚强等: "2016-2017年重庆地区禽源大肠杆菌流行病学调查及耐药性分析", 《中国预防兽医学报》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN110791590A (en) | Dual real-time fluorescence detection primer probe set, kit and method for genes VP72 and CD2V of African swine fever virus | |
| CN110004240B (en) | Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit | |
| CN110305975B (en) | RPA kit for rapidly detecting mycoplasma synoviae and application thereof | |
| CN106834432B (en) | Cross primer amplification primer group for detecting haemophilus parasuis, kit and application | |
| CN106434935B (en) | Compositions and methods for identifying Pasteurella multocida and/or Haemophilus parasuis | |
| CN115786543A (en) | Multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum | |
| CN113186312B (en) | Molecular marker for distinguishing Brucella A19 vaccine strain and wild strain | |
| CN109371148B (en) | Fluorescent PCR kit for identifying three porcine respiratory bacteria and quantitative detection method | |
| CN108411041B (en) | Fluorescent quantitative RT-PCR kit for detecting novel chicken reovirus and application thereof | |
| Dokphut et al. | Development of a loop-mediated isothermal amplification assay for rapid detection of African swine fever. | |
| CN116656845A (en) | Triple fluorescent quantitative PCR detection kit for diagnosing brucella vaccine immunity and natural infection and detection method thereof | |
| CN112029883A (en) | Dual-probe detection kit for avian pathogenic group escherichia coli | |
| CN110699470A (en) | Dual PCR primer, kit, application and method for detecting salmonella and identifying pullorum disease/gallinarum serotype | |
| CN112195258B (en) | Multiplex PCR detection kit for multiple pathogenic bacteria of waterfowl and application thereof | |
| CN111719020B (en) | Kit, primer and probe for detecting bovine rotavirus | |
| CN113416797A (en) | Fluorescent quantitative PCR detection kit for simultaneously detecting 7 types of adenoviruses | |
| CN109897918B (en) | Double real-time fluorescence quantitative detection method for carp edema virus and koi herpesvirus | |
| CN110129460B (en) | Double qPCR (quantitative polymerase chain reaction) kit for two drug-resistant genes of super bacteria and detection method | |
| CN115572774A (en) | Method for identifying new infectious disease virus of three chicken flocks | |
| CN106978510A (en) | A kind of primer of duck New-type adenovirus Eva Green real-time fluorescence quantitative PCRs detection | |
| CN112695137A (en) | PMA-qPCR detection method of porcine pseudorabies virus | |
| CN114480726A (en) | Primer probe set, kit and detection method for African swine fever virus nucleic acid detection | |
| CN111996294A (en) | Primer pair and kit for quantitatively detecting eel herpesvirus | |
| CN115852043B (en) | Multiplex fluorescence PCR primer probe set for detecting four cat diarrhea related viruses, kit and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20201204 |
|
| WD01 | Invention patent application deemed withdrawn after publication |