CN106834432B - Cross primer amplification primer group for detecting haemophilus parasuis, kit and application - Google Patents
Cross primer amplification primer group for detecting haemophilus parasuis, kit and application Download PDFInfo
- Publication number
- CN106834432B CN106834432B CN201610913751.1A CN201610913751A CN106834432B CN 106834432 B CN106834432 B CN 106834432B CN 201610913751 A CN201610913751 A CN 201610913751A CN 106834432 B CN106834432 B CN 106834432B
- Authority
- CN
- China
- Prior art keywords
- primer
- kit
- cross
- nucleic acid
- concentration
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a cross primer amplification primer group for detecting haemophilus parasuis, a kit and application. The primer group comprises a primer group with a nucleotide sequence shown as SEQ ID NO. 1-6; the kit comprises the primer group and the nucleic acid test strip; the use method of the kit is as follows: firstly, preparing a cross primer amplification reaction system; and (3) directly interpreting a product obtained by the constant-temperature reaction after being detected by a nucleic acid detection test strip: the positive result is that two strips appear, one strip is positioned in the detection area, and the other strip is positioned in the quality control area. The kit is simple to operate, low in cost, easy to observe a reaction result, good in specificity, very suitable for export quarantine, food sanitation and field detection of livestock farms, and easy to popularize and apply in a large range.
Description
Technical Field
The invention belongs to the technical field of biology, and particularly relates to a cross primer amplification rapid detection kit for haemophilus parasuis and application thereof.
Background
Haemophilus parasuis (Hps) is a common opportunistic pathogen of the upper respiratory tract of pigs, can invade the body under specific conditions to cause infectious diseases characterized by serous property, cellulolytic multiple serositis, arthritis, dyspnea, high fever and high mortality, and particularly has great harm to early weaned piglets. With the development of the large-scale pig industry, the range of the harm of the haemophilus parasuis to the pig industry is also enlarged, and huge economic loss is brought to the pig industry.
Although haemophilus parasuis disease is generally controlled by vaccination and antibiotic therapy, accurate pathogenic diagnosis is an important prerequisite for the control and purification of the disease. At present, bacterial separation is still a standard method for identifying haemophilus parasuis, but the haemophilus parasuis has the characteristics of tenderness, slow growth, high requirement on growth conditions and the like, so that the separation and culture technology of haemophilus parasuis is difficult to master in many laboratories. Therefore, to overcome this problem, molecular diagnostic methods directed to the amplification of pathogenic nucleic acids have been studied and applied.
The Haemophilus parasuis PCR detection technology established in 2006 by Angen et al (Angen, O.and S.Oliveira, et al (2007) 'Development of an improved specific PCR test for detection of Haemophilus parasuis.' Vet Microbiol 119(2-4):266-76.) can rapidly detect Haemophilus parasuis, but the sensitivity of the method is relatively insufficient. In addition, the PCR detection technology requires an expensive thermal cycling function instrument and skilled operators in the amplification process, which prevents the technology from being widely applied and popularized in veterinary base.
Disclosure of Invention
In view of the above, the present invention provides a cross primer amplification rapid detection kit for haemophilus parasuis and an application thereof, and the kit has the characteristics of high specificity, high sensitivity, visualization and simple operation method.
In order to solve the technical problems, the invention discloses a cross primer amplification primer group for detecting haemophilus parasuis, which consists of an external primer F3, an external primer B3, a displacement primer F1, a displacement primer F2, a cross primer CPR and a Probe;
the nucleotide sequence of the external primer F3 is shown as SEQ ID NO. 1;
the nucleotide sequence of the external primer B3 is shown as SEQ ID NO. 2;
the nucleotide sequence of the cross primer CPR is shown in SEQ ID NO. 3;
the nucleotide sequence of the replacement primer F1 is shown as SEQ ID NO. 4;
the nucleotide sequence of the replacement primer F2 is shown as SEQ ID NO. 5;
the nucleotide sequence of the Probe is shown in SEQ ID NO. 6.
Further, the 5' end of the replacement primer F1 is labeled with Biotin; the 3' end of the Probe Probe was labeled with Fitc.
The invention also discloses a cross primer amplification kit for detecting the haemophilus parasuis, which comprises the cross primer amplification primer group for detecting the haemophilus parasuis and a nucleic acid test strip.
Further, the nucleic acid detection test strip is a universal nucleic acid detection test strip.
Furthermore, the kit also comprises a totally enclosed type target nucleic acid amplification product rapid detection device, and the totally enclosed type target nucleic acid amplification product rapid detection device is obtained by placing a universal nucleic acid detection test strip into a palm plastic detection device.
Further, the kit also comprises dNTP mixture solution and MgSO4Solution, reaction buffer, BstWarmStartTMDNA polymerase, betaine solution.
Further, the method can be used for preparing a novel materialThe kit comprises 10 × Reaction Buffer (10 × ThermoPol Reaction Buffer) and Bst WarmStart with concentration of 8U/LTMDNA polymerase, dNTP mixture solution with concentration of 2.5mmol/L, betaine solution with concentration of 10mol/L, MgSO with concentration of 100mmol/L4Solution, cross primer CPR at a concentration of 10. mu. mol/L, displacement primer F2 at a concentration of 10. mu. mol/L, displacement primer F1 at a concentration of 10. mu. mol/L, outer primer F3 at a concentration of 10. mu. mol/L, outer primer B3 at a concentration of 10. mu. mol/L and Probe Probe at a concentration of 10. mu. mol/L.
The invention also discloses application of the primer group or the kit in detecting whether a sample to be detected is infected with haemophilus parasuis.
The invention also discloses a method for detecting whether a sample to be detected is infected with haemophilus parasuis, which comprises the following steps:
1) carrying out cross primer isothermal amplification on a sample to be detected by using the primer group or the kit to obtain an amplification product;
2) reaction: detecting the obtained product with nucleic acid detection test paper, and observing the result after 5 min;
3) and (4) interpretation of results: the judgment and the reading are carried out directly by naked eyes,
a) negative: only one strip appears in the quality control area, and no strip appears in the detection area, so that the sample to be detected is proved to have no haemophilus parasuis infection;
b) positive: two strips appear, one strip is positioned in the detection area, the other strip is positioned in the quality control area, and the sample to be detected is proved to be infected by haemophilus parasuis;
c) and (4) invalidation: no strip appears in the quality control area and the detection area, which indicates that the nucleic acid test strip is invalid.
Further, the constant-temperature reaction time in the step 1) is 30-40 min; the temperature of the isothermal reaction was 62 ℃.
Compared with the prior art, the invention can obtain the following technical effects:
1) because the cross primer amplification detection method has low cost, Bst WarmStart is utilizedTMThe DNA polymerase realizes isothermal amplification at 62 ℃ without a complicated and expensive PCR instrument, so the method is usedThe kit provided by the invention is low in use cost.
2) The kit provided by the invention has rapid reaction, can complete the reaction within 40min, and can complete the reaction within 30min at the fastest speed.
3) The kit provided by the invention has the advantages that the obtained reaction result is visual and accurate, and complex operation is not required. Respectively carrying out biomarker on the primer and the specific affinity probe, and then detecting a reaction product by using a totally enclosed target nucleic acid amplification product rapid detection device, so that the result can be accurately and visually and rapidly interpreted, and pollution can be prevented.
4) The kit provided by the invention has good specificity, and shows negative reaction to actinobacillus pleuropneumoniae, pasteurella, streptococcus and the like; the sensitivity is high, 14CFU of the Haemophilus parasuis genome DNA template can be detected at the lowest, and is 10 times higher than that of the PCR method. Even if the number of the bacterial cells is more than ten, the bacterial cells can be detected quickly and accurately.
5) The haemophilus parasuis cross primer amplification kit can rapidly and sensitively detect haemophilus parasuis, expensive instruments are not needed, and the reaction can be completed only by one constant-temperature water bath kettle. The kit is simple to operate, low in cost, easy to observe a reaction result, good in specificity, very suitable for export quarantine, food sanitation and field detection of livestock farms, and easy to popularize and apply in a large range.
Of course, it is not necessary for any one product in which the invention is practiced to achieve all of the above-described technical effects simultaneously.
Drawings
The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention and not to limit the invention. In the drawings:
FIG. 1 is a different MgSO of the present invention4The concentration and the electrophoresis brightness are plotted, wherein a Lane M is a DNA Marker DL2000, and lanes 1-5 correspond to MgSO (magnesium sulfate) in sequence4Reaction products at concentrations of 0mM, 2mM, 4mM, 6mM, 8mM, respectively;
FIG. 2 is a graph showing the relationship between the cross primers with different concentrations and the electrophoresis brightness, wherein lane M is DNA Marker DL2000, and lanes 1-6 correspond to the reaction products with cross primer CPR concentrations of 0.2. mu.M, 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M and blank control in sequence; the amounts of other ingredients are shown in table 2;
FIG. 3 is a graph showing the relationship between the displacement primers with different concentrations and the electrophoresis brightness, wherein Lane M is DNA Marker DL2000, and Lanes 1-6 correspond to the reaction products of displacement primers (F1+ F2) with concentrations of 0.2. mu.M, 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M and blank control in sequence; the amounts of other ingredients used are shown in table 2.
FIG. 4 is a graph showing the relationship between the electrophoresis brightness of the reactions at different temperatures, wherein Lane M is DNA Marker DL2000, and Lanes 1-7 correspond to the reaction products of reaction temperature 58 deg.C, 60 deg.C, 62 deg.C, 64 deg.C, 66 deg.C, 68 deg.C and blank control in sequence;
FIG. 5 is a graph showing the relationship between the concentration of different probes and the color intensity of the nucleic acid test strip, wherein 1-6 correspond to the test results of the nucleic acid test strip with Probe concentrations of 0.1. mu.M, 0.2. mu.M, 0.3. mu.M, 0.4. mu.M, 0.6. mu.M and blank control in sequence;
FIG. 6 is a graph showing the relationship between different reaction times and the color intensity of the nucleic acid test strip of the present invention, wherein lanes 1-6 correspond to the test results of the nucleic acid test strip with reaction times of 10min, 20min, 30min, 40min, 50min, 60min and blank control in sequence;
FIG. 7 is a diagram showing the results of the specific experiments using the cross-primer amplification kit of the present invention, wherein:
ctrl is a blank control; 1-15 detection results with genome DNA of serotype 1-15 of Haemophilus parasuis as a template; 16 is a detection result using genome DNA of Actinobacillus pleuropneumoniae strain S2 as a template; 17 is a detection result using genome DNA of a Pasteurella M5 strain as a template; 18 is the detection result with pasteurella genome DNA as the template; 19 is the detection result by using streptococcus genome DNA as a template; 20 is the detection result by using streptococcus genome DNA as a template;
FIG. 8 is a diagram showing the results of the sensitivity test of the cross-primer rapid detection kit provided by the present invention, wherein 1 is 1.4 × 104The genome DNA of the strain CFU Haemophilus parasuis S19, 2 is 1.4 ×103The genome DNA of the strain CFU Haemophilus parasuis S19, 3 is 1.4 × 102Genomic DNA of strain CFU, Haemophilus parasuis S19; 4 is the genomic DNA of 14CFU Haemophilus parasuis S19 strain; 5 is the genomic DNA of 1.4CFU of Haemophilus parasuis S19 strain; 6 is blank control;
FIG. 9 shows agarose gel electrophoresis of a product obtained by the PCR method of the present invention, in which 1 is 1.4 × 104The genome DNA of the strain CFU Haemophilus parasuis S19, 2 is 1.4 × 103The genome DNA of the strain CFU Haemophilus parasuis S19, 3 is 1.4 × 102Genomic DNA of strain CFU, Haemophilus parasuis S19; 4 is the genomic DNA of 14CFU Haemophilus parasuis S19 strain; 5 is the genomic DNA of 1.4CFU of Haemophilus parasuis S19 strain; blank control 6.
Detailed Description
The following embodiments are described in detail with reference to the accompanying drawings, so that how to implement the technical features of the present invention to solve the technical problems and achieve the technical effects can be fully understood and implemented.
The research idea of the invention is as follows: aiming at the defects of the PCR technology in diagnostic application, the research on the isothermal amplification technology is continuously and deeply carried out, and a new opportunity is brought to the formation of a rapid diagnostic method. The technology of the invention develops a cross primer amplification method of haemophilus parasuis, and combines the method with nucleic acid test strip detection, so that the detection process of haemophilus parasuis is more convenient and rapid. The detection kit provided by the technology of the invention does not need a complex instrument in the whole using process, the nucleic acid sample preparation and amplification procedures are simple and convenient, and the kit is easy to establish and develop in a veterinary base. In addition, the detection kit provided by the technology can ensure the sealing of the environment in the sample amplification and result judgment processes, and effectively avoids the occurrence of false positive caused by nucleic acid pollution.
Materials referred to in the examples:
a) the primer is synthesized by Shanghai biological engineering technology service company Limited; bst WarmStartTMDNA polymerase was purchased from New England; MgSO (MgSO)4(100mM) from New England; betaine (Betaine) was purchased from SigmaA driver; the totally enclosed device for rapid detection of target nucleic acid amplification product was purchased from Yosidada Biotechnology Ltd, Hangzhou (Cathaki, Ltd.: 0001-03).
b) The serotype 1-15 reference strains of haemophilus parasuis are awarded by a new researcher, actinobacillus pleuropneumoniae 259 strain, pasteurella 1657 strain and pasteurella 1662 strain, which are detected by the Lanzhou veterinary research institute of Chinese academy of agricultural sciences, and purchased from a Chinese veterinary medicine inspection institute;
c) the following biological materials have been disclosed in the literature, "detection of Streptococcus suis in tonsils of slaughtered pigs by multiplex PCR", Chinese preventive veterinary bulletin 2008(5): page 344 and 348 ]: streptococcus suis SS2 strain, Streptococcus suis SS9 strain.
EXAMPLE 1 design and Synthesis of Cross-primer isothermal amplification primers
First, primer design
According to the primer design principle, aiming at a conserved region sequence of the Haemophilus parasuis wzs gene (simultaneously ensuring that the conserved sequence has larger difference with a nucleotide sequence of the Pasteurella wzs gene), the primer design is carried out by applying the Primer 5 software, the GC content of the primer is ensured to be between 40% and 60% according to our experience, and the Tm value of each primer is about 55 ℃. Next, we used PrimerSelect tool of Larsergenge 7.0 biological software to perform primary screening on the primers, and the screening principle is to ensure that the dG value between each primer pair is small. We obtained 1 set of primers with better theoretical values by preliminary screening, as shown in Table 1 (in this case, F1 was not labeled with Biotin), the primers were synthesized by Shanghai Bioengineering and engineering services Co., Ltd., and the synthesized primers were diluted to a concentration of 10. mu.M with sterilized triple distilled water and stored at-20 ℃. Comprises 1 pair of external primers (F3 and B3, B3 is a complementary sequence of B3 c), two replacement primers (F1 and F2) and 1 Crossover Primer (CPR). CPR consists of F2 and B2 (complementary sequence of B2 c) sequences.
Example 2 application of Cross-primer isothermal amplification primer in detection of pathogen to be detected
Boiling extraction method of haemophilus parasuis genome DNA
(1) Collecting lyophilized serum type 5 Haemophilus parasuis, PBS (pH 7.4, 0.15M phosphate buffer: KH)2PO40.2g、Na2HPO4·12H2O2.9 g, NaCl 8g, KCl 0.2g), and inoculating 50. mu.L of the suspension in 5mL of TSB medium, and culturing at 37 ℃ for 24 hours with shaking.
(2) One loop was taken out of the loop, streaked on a TSA agar medium plate, and cultured at 37 ℃ for 24 hours.
(3) Individual colonies were picked, inoculated into 5mL of TSB liquid medium, and cultured with shaking at 37 ℃ for 18 hours.
(4) 1mL of bacterial culture is taken and centrifuged at 4000r/min for 5min to collect the thalli.
(5) Washed 3 times with 500. mu.L of sterilized ultrapure water.
(6) Resuspending the precipitate with 100 μ L sterilized ultrapure water, boiling at 100 deg.C for 5min, centrifuging at 12000g for 1min to obtain supernatant as DNA template, and storing at-20 deg.C.
Second, establishment of cross primer amplification method
The method comprises the steps of taking the genome DNA of serum 5 type haemophilus parasuis as a template, carrying out cross primer amplification by applying 1 set of primers (shown in table 1) with better primary screening theoretical value, carrying out agarose gel (mass-volume ratio is 2%) electrophoresis detection on the obtained product, and finally obtaining a primer group for the cross primer amplification of the haemophilus parasuis DNA, wherein the primer group comprises 1 pair of external primers (F3 and B3, B3 is a complementary sequence of B3 c), two replacement primers (F1 and F2) and 1 Cross Primer (CPR). CPR consists of F2 and B2 (complementary sequence of B2 c) sequences.
Wherein the sequence is a partial sequence of a haemophilus parasuis wzs gene (the nucleotide sequence is shown as SEQ ID NO. 1), and the Genebank number is KC 795349.1.
TABLE 1 primers for cross-primer amplification reaction of Haemophilus parasuis
Optimization of cross primer amplification reaction conditions
1. Optimization of reaction systems
Sequentially to MgSO4And optimizing the concentration ratio of the cross primer to the displacement primer, and carrying out agarose gel (mass-volume ratio is 2%) electrophoresis detection on the obtained result.
By setting different final concentrations of MgSO4: 0mM, 2mM, 4mM, 6mM and 8mM, and replacing the nucleic acid template with water to set blank control, and the dosage of other components is shown in Table 2 (the result is shown in FIG. 1); different final concentrations of cross-primer CPR: 0.2. mu.M, 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M, while a blank was set with water instead of the nucleic acid template, and the amounts of the other components were as shown in Table 2 (the results are shown in FIG. 2); different final concentrations of the displacement primer (F1+ F2): 0.2. mu.M, 0.4. mu.M, 0.6. mu.M, 0.8. mu.M, 1.0. mu.M, while a blank was prepared by replacing the nucleic acid template with water, and the amounts of the other components were as shown in Table 2 (the results are shown in FIG. 3). The detection condition is that the temperature is kept constant at 64 ℃ for 60 min. Based on the experimental results obtained, the optimized detection system (25. mu.L) was finally determined as shown in Table 2.
TABLE 2 optimized Haemophilus parasuis Cross primer amplification reaction System
2. Optimization of reaction temperature
In order to obtain the optimal reaction temperature, the LAMP reaction was carried out at 58 ℃, 60 ℃, 62 ℃, 64 ℃, 66 ℃ and 68 ℃ for 60min, the reaction system was as shown in Table 2, and a blank control was set by replacing the nucleic acid template with water. The optimum reaction temperature was determined from the repeated experiments and detected by mass-to-volume 2% agarose gel electrophoresis, and the results are shown in FIG. 4, which indicates that the optimum reaction temperature was 62 ℃.
Fourth, establishment of cross primer amplification detection method
1. Screening of affinity probes
The 5 'end of the F1 primer in the first set of primers is labeled with Biotin (Biotin), the affinity Probe Probe is designed for the nucleic acid sequence between F1 and B2c, and the 3' end of the Probe Probe is labeled with FITC (fluorescein isothiocyanate). Replacing F1 with Biotin (Biotin) -labeled F1 according to a reaction system shown in Table 2, and adding different equal amounts of Probe probes to establish a novel cross primer amplification reaction system for nucleic acid test strip detection. The method comprises the steps of carrying out cross primer amplification reaction by taking the genome DNA of serum 5 type haemophilus parasuis as a template, keeping the temperature of 62 ℃ for 60min, and simultaneously replacing a nucleic acid template with water to set a blank control. After the reaction is finished, the product is detected by a nucleic acid test strip, and a Probe which can make the blank reaction group nucleic acid test strip negative in detection and the genome DNA reaction group nucleic acid test strip positive in detection of the haemophilus parasuis is selected as an optimal Probe. The final probe sequence and labeling were as follows:
and (3) Probe: 5 '-CATACGTTGGCAAGCCTA-FITC-3', the nucleotide sequence of which is shown in SEQ ID NO. 6.
The result identification method of the nucleic acid test strip comprises the following steps:
(ii) a negative (-): only one band appeared in the control region (C), and no red band appeared in the detection region (T). The tested sample is proved to have no haemophilus parasuis infection;
② positive (+): two bands appear. One is positioned in the detection area (T), and the other is positioned in the quality control area (C). The tested sample was proved to be haemophilus parasuis infection.
③ invalid: no strip appears in the quality control area (C) and the detection area (T), which indicates that the nucleic acid test strip is invalid.
2. Optimization of affinity probe concentration
In order to reduce the non-specificity of the Probe and ensure the detection effect, the Probe probes with different final concentrations are added into a cross primer amplification reaction system: the amounts of the other components used were as shown in Table 2 (results are shown in FIG. 5), and the reaction products obtained were tested with a nucleic acid test strip to screen for the optimum Probe Probe concentrations. The cross-primer amplification reaction condition is constant temperature of 62 ℃ for 60 min. From the obtained experimental results, the optimum Probe Probe concentration was finally determined to be 0.2. mu.M.
3. Optimization of reaction time
The reaction time was increased by 10min, 20min, 30min, 40min, 50min, and 60min at the optimum reaction temperature (62 ℃), and the optimum reaction time was determined from a plurality of repeated experiments (the results are shown in FIG. 6) as shown in Table 2, and the results in FIG. 6 indicate that the optimum reaction time was 30 min. The optimized detection condition is that the temperature is kept at 62 ℃ for 30 min.
Fifth, cross primer amplification detection system specificity and sensitivity analysis
1. Specificity analysis
1-15 serotype haemophilus parasuis standard strains, actinobacillus pleuropneumoniae, pasteurella A, pasteurella B, streptococcus suis 2 and streptococcus suis 9 are used as genome DNA of a template detection system, and water is used for replacing a nucleic acid template to set a blank control. The reaction system is shown in table 2, the reaction conditions are the optimized conditions determined in step 3, and the nucleic acid test strip is used for detecting the product. The results obtained by detection using a totally enclosed rapid detection apparatus for a target nucleic acid amplification product (see results after 5 min) are shown in FIG. 7: two strips appear in a cross primer amplification reaction product with serotype 1-15 haemophilus parasuis standard strain genome DNA as a template, wherein one strip is positioned in a detection area (T), and the other strip is positioned in a quality control area (C); the cross primer amplification reaction products are obtained by respectively taking the genomic DNA and water of actinobacillus pleuropneumoniae, pasteurella A, pasteurella B, streptococcus suis 2 and streptococcus suis 9 as templates, only one strip appears in the quality control area (C), and no strip appears in the detection area (T). The result shows that the specificity of the detection system is good, and different serotypes of haemophilus parasuis can be specifically detected.
2. Sensitivity analysis
Taking the concentration of 1.4 × 107100 mu L of serum 5 type haemophilus parasuis TSB liquid culture of CFU/mL is sequentially added with 900 mu L of sterilized pure water for 10 times of gradient dilution, the diluted samples are respectively boiled for 5min and are kept stand on ice for 2min, and 1 mu L of sample liquid is respectively taken for cross primer amplification detection (the reaction system is shown in Table 2, except that the template is changed, and the reaction condition is the optimized condition determined in the step 3) and PCR detection. The primers used for PCR were:
p1: 5'-GTA ATG TCTAAG GACTAG-3', the nucleotide sequence of which is shown in SEQ ID NO. 7;
p2: 5 '-TAT CGRGAGATGAAA GAC-3', the nucleotide sequence of which is shown in SEQ ID NO. 8;
r1: 5'-CCTCGCGGCTTCGTC-3', the nucleotide sequence of which is shown in SEQ ID NO. 9;
PCR was performed using P1, P2, and R1 as primers, and the reaction system is shown in Table 3:
TABLE 3 PCR reaction System
The PCR procedure was as follows: pre-denaturation at 94 ℃ for 3 min; taking 94 deg.C 60s, 56 deg.C 45s, and 72 deg.C 1min as a cycle, running 35 cycles, finally extending at 72 deg.C for 10min, and storing at 4 deg.C.
The sensitivity of the cross-primer amplification detection method and the PCR agarose gel electrophoresis detection method are compared. As a result, as shown in FIGS. 8 and 9, the sensitivity of the cross-primer amplification detection method was 10 times higher than that of the PCR agarose gel electrophoresis method, and 14CFU of Haemophilus parasuis DNA was detected at the lowest. In contrast, the cross primer amplification detection method provided by the invention has high sensitivity, simpler operation (isothermal reaction), shorter time (only 30min), and more visual results (visual discrimination).
While the foregoing description shows and describes several preferred embodiments of the invention, it is to be understood, as noted above, that the invention is not limited to the forms disclosed herein, but is not to be construed as excluding other embodiments and is capable of use in various other combinations, modifications, and environments and is capable of changes within the scope of the inventive concept as expressed herein, commensurate with the above teachings, or the skill or knowledge of the relevant art. And that modifications and variations may be effected by those skilled in the art without departing from the spirit and scope of the invention as defined by the appended claims.
SEQUENCE LISTING
<110> institute of animal health of academy of agricultural sciences of Guangdong province
<120> cross primer amplification primer group for detecting haemophilus parasuis, kit and application
<130>2016
<160>10
<170>PatentIn version 3.5
<210>1
<211>20
<212>DNA
<213> Artificial sequence
<400>1
<210>2
<211>18
<212>DNA
<213> Artificial sequence
<400>2
<210>3
<211>37
<212>DNA
<213> Artificial sequence
<400>3
tgcctcagtt actgcgatat ctgtaggcgt tgactcc 37
<210>4
<211>20
<212>DNA
<213> Artificial sequence
<400>4
<210>5
<211>19
<212>DNA
<213> Artificial sequence
<400>5
<210>6
<211>18
<212>DNA
<213> Artificial sequence
<400>6
<210>7
<211>18
<212>DNA
<213> Artificial sequence
<400>7
<210>8
<211>18
<212>DNA
<213> Artificial sequence
<400>8
<210>9
<211>15
<212>DNA
<213> Artificial sequence
<400>9
cctcgcggct tcgtc 15
<210>10
<211>270
<212>DNA
<213> Haemophilus parasuis
<400>10
aaatgattgt ggttgcctcg gcatttatgt taggacttat ctttgcctca gttactgcga 60
tagcgaaaac gctactgcat agaggtattg agggaacatc tgaattagat gtgttaggct 120
tgccaacgta tgctacgattccatattcaa atgaacagcc tattttttct aagcataagg 180
ttcagcattt taaattattg tcggagtcaa cgcctacaga tccagcagtt gaggctttgc 240
gtagtttgcg tacaagtttg cattttgcaa 270
Claims (7)
1. The cross primer amplification primer group for detecting the haemophilus parasuis is characterized by consisting of an external primer F3, an external primer B3, a displacement primer F1, a displacement primer F2, a cross primer CPR and a Probe;
the nucleotide sequence of the external primer F3 is shown as SEQ ID NO. 1;
the nucleotide sequence of the external primer B3 is shown as SEQ ID NO. 2;
the nucleotide sequence of the cross primer CPR is shown in SEQ ID NO. 3;
the nucleotide sequence of the replacement primer F1 is shown as SEQ ID NO. 4;
the nucleotide sequence of the replacement primer F2 is shown as SEQ ID NO. 5;
the nucleotide sequence of the Probe is shown in SEQ ID NO. 6.
2. The cross-primer amplification primer set for detecting haemophilus parasuis according to claim 1, wherein the 5' -end of the replacement primer F1 is labeled with Biotin; the 3' end of the Probe Probe was labeled with Fitc.
3. The cross primer amplification kit for detecting haemophilus parasuis is characterized by comprising the cross primer amplification primer group for detecting haemophilus parasuis and the nucleic acid test strip of claim 1 or 2.
4. The kit of claim 3, wherein the nucleic acid detection strip is a universal nucleic acid detection strip.
5. The kit of claim 3, further comprising a totally enclosed device for rapid detection of the target nucleic acid amplification product, wherein the totally enclosed device for rapid detection of the target nucleic acid amplification product is obtained by placing a universal nucleic acid detection strip into a palm-top plastic detection device.
6. The kit of claim 3, further comprising a dNTP mix solution, MgSO4Solution, reaction buffer, Bst WarmStartTMDNA polymerase, betaine solution.
7. The kit according to claim 6, wherein said kit further comprises,the kit is characterized by comprising 10 × reaction buffer solution and Bst WarmStart with the concentration of 8U/LTMDNA polymerase, dNTP mixture solution with concentration of 2.5mmol/L, betaine solution with concentration of 10mol/L, MgSO with concentration of 100mmol/L4Solution, cross primer CPR at a concentration of 10. mu. mol/L, displacement primer F2 at a concentration of 10. mu. mol/L, displacement primer F1 at a concentration of 10. mu. mol/L, outer primer F3 at a concentration of 10. mu. mol/L, outer primer B3 at a concentration of 10. mu. mol/L and Probe Probe at a concentration of 10. mu. mol/L.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610913751.1A CN106834432B (en) | 2016-10-20 | 2016-10-20 | Cross primer amplification primer group for detecting haemophilus parasuis, kit and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610913751.1A CN106834432B (en) | 2016-10-20 | 2016-10-20 | Cross primer amplification primer group for detecting haemophilus parasuis, kit and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106834432A CN106834432A (en) | 2017-06-13 |
| CN106834432B true CN106834432B (en) | 2020-09-29 |
Family
ID=59145794
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610913751.1A Active CN106834432B (en) | 2016-10-20 | 2016-10-20 | Cross primer amplification primer group for detecting haemophilus parasuis, kit and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106834432B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN108588198A (en) * | 2018-04-23 | 2018-09-28 | 华南理工大学 | A kind of genome sequencing method for haemophilus parasuis molecule parting |
| CN108642192A (en) * | 2018-04-23 | 2018-10-12 | 华南理工大学 | A kind of method of haemophilus parasuis multidigit point sequence molecule parting |
| CN110205395A (en) * | 2019-06-17 | 2019-09-06 | 武汉科前生物股份有限公司 | Serotype method, primer combination and the PCR system of haemophilus parasuis |
| CN117025807B (en) * | 2023-10-07 | 2024-02-02 | 广东省农业科学院动物卫生研究所 | RPA-CRISPR/Cas12a primer group, gRNA and probe, kit and detection method |
Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2205967A1 (en) * | 2001-04-19 | 2004-05-01 | Universidad De Leon | PCR-based method for typing of Haemophilus parasuis allows discrimination of H. parasuis from other bacteria present in the pig respiratory apparatus, and classification of H. parasuis serotype |
| CN102776283A (en) * | 2012-07-05 | 2012-11-14 | 福建省农业科学院畜牧兽医研究所 | Visualized loop-mediated isothermal amplification kit for detecting Haemophilus parasuis |
| CN103205494A (en) * | 2013-03-29 | 2013-07-17 | 广西壮族自治区兽医研究所 | LAMP (loop-mediated isothermal amplification) method for detecting haemophilus parasuis |
| CN104388573A (en) * | 2014-12-09 | 2015-03-04 | 中国计量学院 | Method for detecting ingredients of beef source by virtue of cross primers and dual-probe isothermal amplification |
| CN104388578A (en) * | 2014-12-09 | 2015-03-04 | 中国计量学院 | Method for detecting NOS (nopaline synthase) terminator through crossing primer and dual-probe isothermal amplification |
| CN104630360A (en) * | 2015-02-04 | 2015-05-20 | 重庆出入境检验检疫局检验检疫技术中心 | Rapid HPS (haemophilus parasuis) isothermal amplification detection primers, kit and detecting method |
| CN104711359A (en) * | 2015-03-19 | 2015-06-17 | 山东省农业科学院畜牧兽医研究所 | Haemophilus parasuis detection kit and detection method thereof |
-
2016
- 2016-10-20 CN CN201610913751.1A patent/CN106834432B/en active Active
Patent Citations (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2205967A1 (en) * | 2001-04-19 | 2004-05-01 | Universidad De Leon | PCR-based method for typing of Haemophilus parasuis allows discrimination of H. parasuis from other bacteria present in the pig respiratory apparatus, and classification of H. parasuis serotype |
| CN102776283A (en) * | 2012-07-05 | 2012-11-14 | 福建省农业科学院畜牧兽医研究所 | Visualized loop-mediated isothermal amplification kit for detecting Haemophilus parasuis |
| CN103205494A (en) * | 2013-03-29 | 2013-07-17 | 广西壮族自治区兽医研究所 | LAMP (loop-mediated isothermal amplification) method for detecting haemophilus parasuis |
| CN104388573A (en) * | 2014-12-09 | 2015-03-04 | 中国计量学院 | Method for detecting ingredients of beef source by virtue of cross primers and dual-probe isothermal amplification |
| CN104388578A (en) * | 2014-12-09 | 2015-03-04 | 中国计量学院 | Method for detecting NOS (nopaline synthase) terminator through crossing primer and dual-probe isothermal amplification |
| CN104630360A (en) * | 2015-02-04 | 2015-05-20 | 重庆出入境检验检疫局检验检疫技术中心 | Rapid HPS (haemophilus parasuis) isothermal amplification detection primers, kit and detecting method |
| CN104711359A (en) * | 2015-03-19 | 2015-06-17 | 山东省农业科学院畜牧兽医研究所 | Haemophilus parasuis detection kit and detection method thereof |
Non-Patent Citations (2)
| Title |
|---|
| "Rapid detection of Haemophilus parasuis using cross-priming amplification and vertical flow visualization";Hongchao Gou et al.;《Journal of Microbiological Methods》;20171109;第144卷;第67-72页 * |
| Hao-Tai Chen et al.."Loop-mediated isothermal ampli¢cation for the rapid detection of Haemophilus parasuis".《FEMS Immunol Med Microbiol 》.2010,第60卷第283-285页. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106834432A (en) | 2017-06-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106834432B (en) | Cross primer amplification primer group for detecting haemophilus parasuis, kit and application | |
| CN110004240B (en) | Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit | |
| CN113249499B (en) | Salmonella typhi detection kit, and preparation method and application thereof | |
| CN108866244A (en) | Detect RPA primer and probe, kit and its method of prawn irido virus | |
| CN105936935B (en) | PCR detection kit for rapidly identifying specific serotype salmonella | |
| CN115029459A (en) | Kit for visually detecting Pasteurella multocida based on CRISPR-Cas12a and application | |
| CN110669870A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for serotype of Palima serogroup virus | |
| CN110305975B (en) | RPA kit for rapidly detecting mycoplasma synoviae and application thereof | |
| CN109371148B (en) | Fluorescent PCR kit for identifying three porcine respiratory bacteria and quantitative detection method | |
| CN115786543A (en) | Multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum | |
| CN106434935B (en) | Compositions and methods for identifying Pasteurella multocida and/or Haemophilus parasuis | |
| CN110438260A (en) | A kind of African swine fever virus nucleic acid test strips detection kit | |
| CN109337995A (en) | The PCR detection method and kit of bacillus tularense and its subspecies | |
| CN104975077B (en) | Pig source eperythrozoon fluorescent quantificationally PCR detecting kit and its application | |
| CN116656845A (en) | Triple fluorescent quantitative PCR detection kit for diagnosing brucella vaccine immunity and natural infection and detection method thereof | |
| CN110643740A (en) | Real-time fluorescent quantitative RT-PCR (reverse transcription-polymerase chain reaction) detection primer, probe and detection kit for Palimam serogroup virus | |
| CN115747361A (en) | Real-time fluorescent MIRA and MIRA-LFD primer group for detecting streptococcus iniae and detection method | |
| CN113265488B (en) | RPA-LFD primer, probe and kit for jointly detecting epidemic hemorrhagic disease virus and palieimia serogroup virus | |
| Jiang et al. | Rapid on-the-spot detection of Edwardsiella piscicida using recombinase polymerase amplification with lateral flow | |
| CN109666750B (en) | Multiplex real-time fluorescence PCR detection primer probe set and detection method for identifying streptococcus suis and pasteurella multocida | |
| CN105861742A (en) | Specific detection target sequence for DENV type I-III, standard plasmid molecule, and detection kit for DENV type I-III | |
| CN105154438B (en) | To Hafnia alvei G5907, G5908, G5913, nucleotide special G5916 and its application | |
| CN115011711B (en) | Kit and method for visually detecting Edwardsiella ictaluri of zebra fish source | |
| CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence | |
| CN108753999B (en) | Nucleic acid, kit and detection method for detecting salmonella paratyphi of pigeon |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |