CN115786543A

CN115786543A - Multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum

Info

Publication number: CN115786543A
Application number: CN202210968388.9A
Authority: CN
Inventors: 焦新安; 熊丹; 袁理; 潘志明; 宋丽; 康喜龙; 孟闯; 顾丹
Original assignee: Yangzhou University
Current assignee: Yangzhou University
Priority date: 2022-08-12
Filing date: 2022-08-12
Publication date: 2023-03-14

Abstract

The invention belongs to the field of biotechnology detection, and particularly relates to a multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum. The kit comprises a stn gene detection primer, an I137_14445 gene detection primer and a ybgL gene detection primer, can be used for quickly, accurately identifying and distinguishing the salmonella pullorum and the salmonella gallinarum in a high-flux manner, can replace the traditional complex procedures of serological typing, biochemical identification and the like of the salmonella gallinarum, and provides a novel method which is simple, quick and good in repeatability for monitoring and laboratory diagnosis of the salmonella pullorum and the salmonella gallinarum.

Description

Multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum

Technical Field

The invention belongs to the field of biotechnology detection, and particularly relates to a multiplex PCR detection kit for rapidly identifying and distinguishing salmonella pullorum and salmonella gallinarum.

Background

The salmonellosis is one of infectious diseases with important significance in public health, pathogenic salmonella of the salmonellosis belongs to enterobacteriaceae, eggs, livestock and meat products are main transmission media, and various livestock and poultry diseases can be caused to cause systemic septicemia and enteritis. Pullorum disease and typhoid fever are respectively caused by salmonella pullorum disease and salmonella gallinarum, and salmonella pullorum disease mainly infects chicks of 2-3 weeks, which causes white diarrhea and has high disease death rate, and the chicken infected by the chicken in the past has low disease death rate, but can carry poison for a long time to expel toxin. The salmonella gallinarum can cause diseases to both chicks and adult chickens and is characterized by causing anemia, leukocytosis and bleeding. Therefore, pullorum/typhoid salmonella is a serious harmful bacterium in the chicken industry in China. At present, according to a Kauffman-White (K-W) serotype classification method, according to different salmonella thalli antigens and flagellum antigens, the current serotypes of salmonella are more than 2650, and 292 different serotypes are reported in China and belong to 35O groups.

The traditional detection method, namely nonselective and selective enrichment, biochemical property and serological identification, is labor-consuming and time-consuming, the salmonella pullorum and the salmonella gallinarum can be distinguished only by additional biochemical reaction and can be completed in 4-7 days, and other methods such as an antibody detection method are rapid, but the high false positive rate of the antibody detection method makes the antibody detection method unsuitable for conventional detection. Therefore, rapid, specific and sensitive detection methods are urgently needed, and salmonella pullorum and salmonella gallinarum are discovered in time, which has great significance for effective prevention and control of pullorum and salmonella gallinarum.

Disclosure of Invention

Aiming at the problems in the prior art, the invention aims to provide a multiplex PCR detection kit for rapidly identifying and distinguishing salmonella pullorum and salmonella gallinarum, and preparation and application thereof.

In order to achieve the above objects and other related objects, the present invention adopts the following technical solutions:

the invention provides a multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum, which comprises detection primers of a stn gene, an I137_14445 gene and a ybgL gene, wherein the detection primers of the stn gene, the I137_14445 gene and the ybgL gene comprise a forward primer with nucleotide sequences shown as SEQ ID No.1, SEQ ID No.3 and SEQ ID No.5 and a reverse primer with nucleotide sequences shown as SEQ ID No.2, SEQ ID No.4 and SEQ ID No. 6.

The kit adopts a multiplex PCR detection technology to detect stn gene, I137_14445 gene and ybgL gene, and can analyze and judge whether the detected object belongs to salmonella pullorum or salmonella gallinarum according to the amplification and detection conditions. Therefore, the design of the primer is the key of the kit of the invention.

The kit according to the present invention is detected by using PCR technology, so the kit may further include other conventional reagents required for PCR, such as: sterile water (ddH) ₂ O), dNTP, PCR buffer, rTaq enzyme, a sample genome DNA extraction reagent and the like. Since the common PCR reagents can be purchased separately or configured by themselves through the market, the reagents can be assembled into the kit according to the actual needs of customers, and can be assembled into the kit for convenience.

The kit of the present invention may contain a primer set packaged independently, or may contain a prepared PCR detection solution containing a primer set.

The PCR detection solution can be prepared by self or can be obtained by directly adding primers into a general PCR detection solution which is commercially available and does not contain the primers. For example, the kit may further contain sterile water (ddH) ₂ O), dNTP, PCR buffer, rTaq enzyme. Add into the hairAnd obtaining a PCR reaction system by using a clear primer and a DNA extract of a sample to be detected or a sample bacterial liquid.

Preferably, the kit may further comprise a positive control. The positive control is a DNA sample containing a salmonella pullorum or salmonella gallinarum genome.

Preferably, the kit may further comprise a negative control. The negative control may be a DNA sample of non-pullorum/salmonella typhi.

In a second aspect of the present invention, there is provided a method for using the aforementioned PCR detection kit for rapidly identifying and differentiating salmonella pullorum and salmonella gallinarum, comprising the steps of:

(1) Extracting sample genome DNA;

(2) Sample adding: respectively adding the sample genome DNA and a positive control or a negative control into a PCR tube provided with a PCR reaction system to obtain a corresponding sample reaction tube, a corresponding positive reaction tube or a corresponding negative reaction tube, wherein the PCR reaction system contains the stn gene, the I137_14445 gene and the ybgL gene detection primer;

(3) And (3) PCR reaction: the reaction tube is arranged on a PCR instrument, and circulation parameters are set for carrying out PCR reaction;

(4) After the PCR reaction was completed, the results were analyzed.

Preferably, the method is a method for non-disease diagnostic purposes.

In the step (1), the extraction of the genomic DNA of the sample is the prior art.

Preferably, in step (3), the conditions of the PCR reaction are set as: (a) 94 ℃ for 3min; (b) 94 ℃ for 40s; (c) 53 ℃ for 30s; (d) 60s at 72 ℃,30 cycles of steps (b) to (d), and (e) 10min at 72 ℃.

In a third aspect of the invention, the application of the kit in preparing the detection products of the stn gene, the I137_14445 gene and the ybgL gene is provided.

Preferably, the detection product is used for detecting and screening salmonella pullorum and salmonella gallinarum respectively.

Compared with the prior art, the invention has the following beneficial effects:

through extensive and intensive research, the invention discovers for the first time that the I137_14445 gene does not exist in salmonella gallinarum but exists in salmonella pullorum and other serotypes; compared with the ybgL gene of the salmonella gallinarum and other serotype salmonella, the ybgL gene of the salmonella pullorum lacks a nucleotide sequence of 68bp inside; the stn gene serves as an internal reference gene of the multiplex PCR. Thus, the distribution of the I137-14445 gene and the ybgL gene in different serotypes of Salmonella and other bacteria was verified by multiplex PCR with specific primers. The kit disclosed by the invention can be used for quickly identifying and distinguishing the salmonella pullorum and the salmonella gallinarum in a high-throughput manner, can replace the traditional salmonella serological typing, biochemical identification and other complex procedures, and provides a simple, quick and good-repeatability new method for monitoring and laboratory diagnosis of the salmonella pullorum and the salmonella gallinarum.

Drawings

FIG. 1: the schematic diagram of identifying and distinguishing the salmonella pullorum and the salmonella gallinarum by using the I137_14445 gene and the ybgL gene; wherein SP is salmonella pullorum, and SG is salmonella gallinarum. The I137_14445 gene is not present in the salmonella gallinarum, and compared with the salmonella gallinarum and other serotype salmonella ybgL genes, the salmonella pullorum ybgL gene lacks a nucleotide sequence of 68bp inside, namely the salmonella pullorum cannot amplify a ybgL fragment, wherein a red arrow indicates a primer position.

FIG. 2: identifying distribution pictures of the stn gene, the I137_14445 gene and the ybgL gene in different serotypes of salmonella and other bacteria for multiplex PCR; wherein lane M is: DL2000 Marker; pullorum is Salmonella pullorum, and S.Gallinarum is Salmonella gallinarum. The experiment detects 75 salmonella strains which contain 29 different serotypes and 43 non-salmonella strains including brucella, mycobacterium tuberculosis, staphylococcus aureus, campylobacter jejuni, campylobacter coli, escherichia coli, shigella and listeria monocytogenes. The size of stn gene amplification band is 731bp, the size of I137_14445 gene amplification band is 525bp, and the size of ybgL gene amplification band is 307bp.

FIG. 3: PCR detection kit for respectively identifying salmonella pullorum and salmonella gallinarumDegree; wherein (A) lane M is: DL2000 Marker;

lanes

1, 3, 5, 7, 9 are salmonella pullorum S06004 genome,

lanes

2, 4, 6, 8, 10 are salmonella gallinarum SG9 genome; lanes 1-2, 3-4, 5-6, 7-8, 9-10 have genomic concentrations of, in order, 21.4 ng/. Mu.l, 2.14 ng/. Mu.l, 214 pg/. Mu.l, 21.4 pg/. Mu.l, 2.14 pg/. Mu.l. (B) Lane M is: DL2000 Marker;

lanes

1, 3, 5, 7, 9 are salmonella pullorum S06004 bacteria,

lanes

2, 4, 6, 8, 10 are salmonella gallinarum SG9 bacteria; lanes 1-2, 3-4, 5-6, 7-8, 9-10 with a bacterial content of 10 ⁵ CFU、10 ⁴ CFU、10 ³ CFU、10 ² CFU、10 ¹ CFU。

Detailed Description

Before the present embodiments are further described, it is to be understood that the scope of the invention is not limited to the particular embodiments described below; it is also to be understood that the terminology used in the examples is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention.

When numerical ranges are given in the examples, it is understood that both endpoints of each of the numerical ranges and any value therebetween can be selected unless the invention otherwise indicated. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In addition to the specific methods, devices, and materials used in the examples, any methods, devices, and materials similar or equivalent to those described in the examples may be used in the practice of the invention in addition to the specific methods, devices, and materials used in the examples, in keeping with the knowledge of one skilled in the art and with the description of the invention.

Example 1 bioinformatics method to identify the distribution of I137-14445 Gene and ybgL Gene

Searching the I137_14445 gene and the ybgL gene in a complete genome database by using Blastn online comparison software (http:// blast.ncbi.nlm.nih.gov/blast.cgi) in NCBI, wherein the search result shows that the I137_14445 gene does not exist in the salmonella gallinarum and only exists in the salmonella gallinarum and other serotype salmonella; compared with the ybgL genes of the salmonella gallinarum and other serological salmonella typhi, the inside of the ybgL gene of the salmonella pullorum lacks a nucleotide sequence of 68bp, namely the salmonella pullorum can not amplify a ybgL fragment, and the two serosubtypes of the salmonella can be identified and distinguished according to the distribution characteristics of the two genes (figure 1).

EXAMPLE 2 preparation of the kit

Designing and synthesizing a primer: primers were designed and analyzed using stn, I137-14445 gene and ybgL gene as templates, respectively. Wherein the stn gene template sequence is shown as SEQ ID NO.7, the I137_14445 gene template sequence is shown as SEQ ID NO.8, the ybgL gene template sequence is shown as SEQ ID NO.9, and the details are as follows

SEQ ID NO.7：

TTGTTAATCCTGTTGTCTCGCTATCACTGGCAACCAGATAGTAAAGACCGCGCCTTTACCCTCAATACTTTTCACCTTAATCGCGCCGCCATGCTGTTCGATGATATTTTGCACCACAGCCAGCCCCAGGCCTGTCCCGTCAGCTTTGGTCGTAAAATAAGGCGTAAAAATCGCCTCCAGCTGATCCGGGGCGATCCCTTTCCCGCTATCGGTAACAGTGATGATAACGCGGTCGGTCCCACTTTCTTTTGCCTCTACGCTAATCGTTCCCTGGCGGCCAATCGCATGAATAGCGTTCAGGTACAGATTCAACAGCACCTGAGTCAGCCTGTCCGGGTCAGCCTGAATACGCTTAAGCGTCTCATTCGCCGTGAATCTCAACTGAATCTCTCTGCTTTGGGCATCCTGACTGACCAGATTCAGGGAGTGAGTAATAATATCATTGAGGTTAACCGTCTGGAGCGTCAGATGCGCGGGCTTTACCAGTTCGAGCAATTCGCTTACCACCCGGTTCAAACGGTCGGCCTCTTTGGCCATCACCTGCGCCAGTTCATGCGACTCGCCGCCGGCAGGCGTGCGCTCGGCAAAGTATTTCGCCAGCCCTTTGATGGACGAGAGCGGGTTACGAATTTCGTGCGCGACGCCCGCCGCCAGATGCCCCATCGCCACCAGCTTTTCTTTACGCTTCATTGCATCAAGCAGTTCTCTGTGCGAGCGCTGATAACGCTGATGCCAAAAAAACGCCAGTAA

SEQ ID NO.8：

TCATGATGTCGCCCCTGCGTCCTTAAACGCGCAGTTCAGGGCATCGCAGGTGTAGCGATTCATCTGCAGTCCCCCGTAATCATCAATATACCCCACCCACAGCGTCCGGGTTTCTGCCGGCAGAACAGCCTTTAAAGGCAGGTTCCCCAGGGGCGGTACCATCACGCCCTCGCGGAAACCGCTGAGCCTGTGGCTACGGTCTGCTCCCAGCCACGCCACAGTGATGTAGTACGGCGTCGGGTTTCTGAGGGTCAGATGTCCCGCATTCCGCTCAGCAGTCAGCTTTCTTTCCGGCTGGTCACTGCTGCTTCTGATAATGGCTTTCGGACGGTAAAACAGTTTCAGCTGGCTCTGCATGGCCAGTTGCAGAACGTTGTCGTCTTCTGGCTTCGGGGGAACGCCCCGCACGTTAAGCCAGAACAGTGTTTCCCTGTCCTGAGGGAGCTTATCTGTCAGCCCGCGAACCTGGGTGATGCGGACCTGGGATTTCTGTCCGGCATCAATACGCTGCAGCGGCGGCAGCGCCATCAGCGCATCGGTTCTCACCCCGTCAGCGTCCGTCACCCAGGACTGCGCCAGGAACGGCGTGGTTTTGTCATCGTTATTCAGCGTGATGGCCACCGTTTTCTGCGGCGCATCCATGATAATACGGGTCCGGTCAACATTGACGGCCGCCGGGCTGTACTGGCTCCATGCTGCCGCCAGTGCGAGTAAAATCACACGGCTTCTTCTGCTGTTTTTCAC

SEQ ID NO.9：

ATGAACATTGATTTAAATGCGGATGTGGGCGAAGGCTGCGCCAGCGACAGCGAATTATTAACGCTGGTCTCCTCCGCCAATATCGCCTGTGGTTTTCACGCCGGTGATGCGCAAACCATGCTGACCAGCGTGCGCGAGGCGCTGAAAAACGGCGTGGCGATCGGCGCGCATCCCAGCTTTCCGGATCGGGATAATTTTGGGCGGACGGCGATGGCTTTGCCGCCGGAAACGGTATACGCCCAGACGCTGTACCAAATCGGCGCGCTGGGGGCGATTGTTCAGGCGCAAGGCAGCGTGATGCGCCATGTCAAACCGCACGGTATGCTCTATAACCAGGCGGCGAAAGATCCCCATCTGGCACAGGCGATTGCGAAAGCGGTACACGACTATGATCCGTCACTGATACTGGTTGGACTGGCGGGAAGTGAGCTGATCCGGGCCGGTGAGCGCCATCGCCTGGTGACGCGGCAGGAGGTGTTTGCCGATCGCGGCTATCAGGCCGACGGTAGCCTGGTGCCGCGCATGCAACCTGGCGCGCTGATTCACGACGAAGAGCAGGCGCTGGCGCAAACGCTGGATATGGTACAAGCCGGGAGAGTGAAAAGCGTTACTGGCGTGTGGACGACTGTCACGGCGCAAACGGTGTGCATTCATGGCGACGGCGAGTATGCGCTTGCATTCGCTCGCAGGTTACGCGCCGCGTTCAATGCGCGTAATATACACGTTATTGCCTGA

According to the genomic DNA sequence condition, selecting the optimal detection primer pair, wherein the stn amplifies a partial sequence (731 bp), the I137_14445 primer amplifies a partial sequence (525 bp), and the ybgL primer amplifies an intermediate fragment (307 bp) of the ybgL gene of the salmonella pullorum, and the nucleotide sequences of the intermediate fragment are shown in the following table 1:

TABLE 1

The primer pair can be packaged independently or can be prepared into PCR detection solution. In the PCR detection solution, 40nM stn F/R, 80nM I137_14445F/R and 80nM ybgL F/R were used as the amount of the above primer pair.

That is, the kit of the present invention may contain the primer set packaged separately or may contain a PCR detection solution containing the primer set.

Further, the kit may further compriseFungus water (ddH) ₂ O), dNTP, PCR buffer, rTaq enzyme, sample genomic DNA extraction reagent, and the like.

Example 3 specific identification of the kit for detecting Salmonella pullorum and Salmonella gallinarum

The three pairs of primers in the kit described in example 2 are adopted, genomes of different serotypes of salmonella and other bacteria are respectively used as templates, and the distribution characteristics of the I137_14445 gene and the ybgL gene in different bacteria are identified by a multiplex PCR method.

The PCR reaction system was (25. Mu.L): dNTP 2. Mu.L, 10 XPCR buffer 2.5. Mu.L, stn-F40nM, stn-R40nM, I137 \/u 14445-F80nM, I137 \/u 14445-R80nM, ybgL-F80nM, ybgL-R80 nM, template 2. Mu.L, rTaq enzyme 0.25. Mu.L, ddH ₂ And O is supplemented to 25 mu L.

The PCR program is 94 ℃ for 3min; 40s at 94 ℃, 30s at 53 ℃, 60s at 72 ℃ and 30 cycles; 10min at 72 ℃.

Carrying out 1% agarose gel electrophoresis on the PCR product, wherein the result of the PCR electrophoresis shows that two bands can be amplified in a lane which takes the salmonella pullorum genome as a template, and the two bands are stn gene (731 bp) and I137_14445 gene (525 bp); two bands, stn gene (731 bp) and ybgL fragment (307 bp), were amplified in lanes using Salmonella gallinarum genome as template (FIG. 2). It is shown that whether the unknown bacteria are salmonella pullorum or salmonella gallinarum can be rapidly identified by the multiplex PCR method by using the specific stn, I137_14445 and ybgL amplification primers in the kit described in example 2.

Example 4 sensitivity identification of kit for detecting Salmonella pullorum and Salmonella gallinarum

Adopting three pairs of primers in the kit of the embodiment 2, sequentially diluting the salmonella pullorum S06004 genome and the salmonella gallinarum SG9 genome by 10 times respectively, and using the diluted genomes as templates to detect the sensitivity of the salmonella pullorum and salmonella gallinarum genome DNA by using the identification kit; washing the salmonella pullorum S06004 bacterial liquid and the salmonella gallinarum SG9 bacterial liquid for 3 times by PBS, sequentially diluting by 10 times respectively, and detecting the sensitivity of the bacterial numbers of the salmonella pullorum and the salmonella gallinarum by using an identification kit by taking the diluted bacteria as templates.

The PCR products were subjected to 1% agarose gel electrophoresis, and the results of the PCR electrophoresis showed that 21.4pg/μ L (FIG. 3A) and 100CFU (FIG. 3B) of Salmonella pullorum and Salmonella gallinarum could be detected by the stn, I137-14445, and ybgL-based multiplex PCR detection kit.

Example 5 application of the kit to Chicken farms

By adopting the reagent kit in the embodiment 2, the salmonella separated from 24 chicken farms can be detected, and the salmonella pullorum and the salmonella gallinarum can be quickly and accurately detected. The method comprises the following specific steps:

1) Isolation of Salmonella

In the test, a sample is collected from a chicken farm in Jiangsu, and the collection, enrichment, separation and physiological and biochemical identification of the salmonella refer to a method (Li Y, et al. Food Control,2016 Cai Y, et al. Int J Food Microbiol, 2016) established in the prior art, and 24 strains of the salmonella are separated and identified in the test.

2) Multiple PCR method for detecting salmonella pullorum and salmonella gallinarum in sample

Respectively inoculating 24 strains of salmonella into an LB liquid culture medium, culturing overnight at 37 ℃ and 180rpm, extracting the genome of each strain of salmonella by using a bacterial genome extraction kit the next day, amplifying stn gene, I137_14445 gene and ybgL gene by taking the genome as a template, and carrying out PCR (25 mu L) reaction system: dNTP 2. Mu.L, 10 XPCR buffer 2.5. Mu.L, stn-F40nM, stn-R40nM, I137 \/u 14445-F80nM, I137 \/u 14445-R80nM, ybgL-F80nM, ybgL-R80 nM, template 2. Mu.L, rTaq enzyme 0.25. Mu.L, ddH ₂ And O is supplemented to 25 mu L. PCR program is 94 ℃ for 3min; 40s at 94 ℃, 30s at 53 ℃, 60s at 72 ℃ and 30 cycles; 10min at 72 ℃. Performing 1% agarose gel electrophoresis on the PCR product to amplify two target bands of stn gene (731 bp) and I137_14445 gene (525 bp) from Salmonella pullorum, and amplifyingThe lanes from the two bands of interest of the stn gene (731 bp) and the ybgL fragment (307 bp) are Salmonella gallinarum. The result shows that 10 total salmonella strains in 24 salmonella samples can simultaneously detect the stn gene and the I137_14445 gene which are Ch4, ch5, ch9, ch10, ch11, ch12, ch16, ch17, ch18 and Ch24 respectively, and the salmonella is the salmonella pullorum; the stn gene and the ybgL gene, ch22 and Ch23, were detected in 2 strains in total, and these are Salmonella gallinarum (Table 2).

TABLE 2

3) Traditional serotype identification of salmonella

The serotype identification of 24 salmonella strains separated in the test refers to a method (Li Y, et al. Food Control,2016, cai Y, et al. Int J Food Microbiol, 2016) established in the prior art, and distinguishes salmonella pullorum and salmonella gallinarum through dulcitol fermentation and ornithine decarboxylation experiments, and the serotype identification and biochemical identification results show that 10 salmonella pullorum are totally contained in 24 salmonella strains, namely Ch4, ch5, ch9, ch10, ch11, ch12, ch16, ch17, ch18 and Ch24; there were 2 strains of salmonella gallinarum, ch22 and Ch23, respectively. The PCR detection result is completely consistent with the serotype identification and biochemical reaction results.

In this example, the method of serotype identification and biochemical experiment identification is adopted to screen out salmonella pullorum and salmonella gallinarum from the 24 salmonella strains, which takes at least 2 days. By adopting the detection kit of the embodiment 2 of the invention, the salmonella pullorum and the salmonella gallinarum in the 24 salmonella strains can be accurately screened out only in 3 hours, and the accuracy is 100%.

In conclusion, compared with the traditional serotype identification method, the kit disclosed by the invention has the advantages that:

the conventional serotype identification needs to purchase a specific salmonella serotype identification kit, is expensive and complicated in steps, and particularly needs to spend a large amount of time (at least two days) and huge workload when specific salmonella serotypes (such as salmonella pullorum and salmonella gallinarum) are separated from a large sample, but the conventional salmonella serotype identification kit cannot distinguish salmonella pullorum and salmonella gallinarum, and needs to perform biochemical reactions such as dulcitol fermentation and ornithine decarboxylation, so that the result is judged by naked eyes, and artificial errors exist; the detection method of the kit is simple to operate and low in cost, has no requirement on the existence form of bacteria (including single bacterial colony, frozen bacterial liquid or fresh bacterial liquid), can finish the whole identification process within three hours (including PCR and agarose gel electrophoresis), and has the accuracy rate of 100%.

Therefore, the multiplex PCR detection kit for rapidly identifying and distinguishing the salmonella pullorum and the salmonella gallinarum is beneficial to simplifying the traditional step of salmonella serotype identification, and provides a new method for rapidly identifying the salmonella pullorum and the salmonella gallinarum in a large number of samples.

The foregoing embodiments are merely illustrative of the principles and utilities of the present invention and are not intended to limit the invention. Any person skilled in the art can modify or change the above-mentioned embodiments without departing from the spirit and scope of the present invention. Accordingly, it is intended that all equivalent modifications or changes which may be made by those skilled in the art without departing from the spirit and scope of the present invention as defined in the appended claims.

Claims

1. A multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum comprises detection primers of stn gene, I137_14445 gene and ybgL gene, wherein the detection primers of stn gene, I137_14445 gene and ybgL gene comprise forward primers with nucleotide sequences shown as SEQ ID No.1, SEQ ID No.3 and SEQ ID No.5 and reverse primers with nucleotide sequences shown as SEQ ID No.2, SEQ ID No.4 and SEQ ID No. 6.

2. The detection kit according to claim 1, wherein the kit further comprises one or more of sterile water, dNTP, PCR buffer, rTaq enzyme, and a sample genomic DNA extraction reagent.

3. The test kit of claim 1, wherein the kit further comprises one or more of a positive control or a negative control.

4. The detection kit of claim 3, wherein the positive control is a DNA sample containing a genome of Salmonella pullorum or Salmonella typhi.

5. The test kit of claim 3, wherein the negative control is a DNA sample of non-pullorum/Salmonella gallinarum.

6. The method of using the test kit according to any one of claims 1 to 5, comprising the steps of:

(1) Extracting sample genome DNA;

(2) Sample adding: adding the sample genome DNA and the positive control or the negative control into a PCR tube provided with a PCR reaction system respectively to obtain a corresponding sample reaction tube, a corresponding positive reaction tube or a corresponding negative reaction tube, wherein the PCR reaction system contains the stn gene, the I137_14445 gene and the ybgL gene detection primer in the claim 1;

(4) After the PCR reaction was completed, the results were analyzed.

7. The method of claim 6, wherein the method is a method for non-disease diagnostic purposes.

8. The method according to claim 6, wherein in the step (3), the conditions of the PCR reaction are set as follows: (a) 94 ℃ for 3min; (b) 94 ℃ for 40s; (c) 53 ℃ for 30s; (d) 60s at 72 ℃,30 cycles of steps (b) to (d), and (e) 10min at 72 ℃.

9. Use of the test kit according to any one of claims 1 to 5 for the preparation of a test product for the stn gene, the I137_14445 gene and the ybgL gene.

10. The use according to claim 9, wherein the test product is used for the detection and differentiation of salmonella pullorum and salmonella gallinarum, respectively.