CN106244690B - A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin - Google Patents
A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin Download PDFInfo
- Publication number
- CN106244690B CN106244690B CN201610626906.3A CN201610626906A CN106244690B CN 106244690 B CN106244690 B CN 106244690B CN 201610626906 A CN201610626906 A CN 201610626906A CN 106244690 B CN106244690 B CN 106244690B
- Authority
- CN
- China
- Prior art keywords
- salmonella
- detection
- pcr
- kit
- tcps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/10—Enterobacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Engineering & Computer Science (AREA)
- Analytical Chemistry (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of biological technology detection, and in particular to the multiple PCR detection kit of a kind of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin.Include in the kittcpSGenetic test primer,lygDGenetic test primer andflhBinnerGenetic test primer.Kit energy fast high-flux of the invention identifies enteritis, white diarrhea/typhoid fever and Salmonella dublin serotype respectively, it can be used as the householder method of detection of Salmonella traditional serological parting, and the monitoring for these three particular serotype detection of Salmonella and laboratory diagnosis provide a kind of simple and quick, reproducible new method.
Description
Technical field
The invention belongs to field of biological technology detection, and in particular to a kind of Rapid identification Salmonella enteritidis, white diarrhea/chicken wound
The multiple PCR detection kit of cold detection of Salmonella and Salmonella dublin.
Background technique
Salmonellosis is one of Amphixenosis significant on public hygienics, and cause of disease Salmonella is in intestines bar
Cordycepps, egg, domestic animal and meat products are primary vehicles, it can not only cause a variety of livestock and poultries, cause systemic sepsis
And enteritis, it is also used as the pathogen of food origin disease, causes human gastrointestinal scorching and food poisoning.In China, bacillary food
It is by salmonellal there are about 70%~80% in object poisoning.Currently, according to Kauffman-White (K-W) serotype point
Type method, according to detection of Salmonella somatic antigen and the difference of flagellar antigen, the current serotype of detection of Salmonella has 2600 kinds or more, China
292 kinds of different serotypes are had reported, belong to 35 O groups.
Traditional detection method, that is, non-selective and selective enrichment, biochemical characteristic and serological Identification is very laborious, time-consuming,
Need could complete within 4-7 days, other such as antibody testing methods, although quickly, its high false positive makes it unsuitable for conventional detection.This
Outside, low-level pathogen contamination leads to the factors such as " the causing injury " of detection of Salmonella and the interference of the other ingredients of food after food processing,
So that the detection of detection of Salmonella is somewhat limited.Therefore, it is badly in need of some detection methods quickly, special, sensitive, to find in time
Pathogenic bacteria, control pollution and its harm that human health may be generated.
Summary of the invention
For the problems of in the prior art, the purpose of the present invention is to provide a kind of Rapid identification enteritis sramana
Bacterium, the multiple PCR detection kit of white diarrhea/Salmonella gallinarum and Salmonella dublin and its preparation and application.
To achieve the goals above and other related purposes, the present invention adopts the following technical scheme:
The first aspect of the present invention provides a kind of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and all
The multiple PCR detection kit of Berlin detection of Salmonella includes that tcpS genetic test primer, lygD genetic test are drawn in the kit
Object and flhBinner genetic test primer.
Preferably, the tcpS genetic test primer includes nucleotide sequence forward primer as shown in SEQ ID NO.1
With nucleotide sequence reverse primer as shown in SEQ ID NO.2.
Preferably, the lygD genetic test primer includes nucleotide sequence forward primer as shown in SEQ ID NO.3
With nucleotide sequence reverse primer as shown in SEQ ID NO.4.
Preferably, the flhBinner genetic test primer includes nucleotide sequence forward direction as shown in SEQ ID NO.5
Primer and the nucleotide sequence reverse primer as shown in SEQ ID NO.6.
Kit of the invention carries out tcpS gene, lygD gene and flhBinner gene using multiplex PCR detection technique
Detection can analyze and determine whether test object belongs to Salmonella enteritidis, white diarrhea/fowl typhoid sramana according to amplification and detection case
One of bacterium or Salmonella dublin.Therefore, the design of primer is the key that kit of the present invention.
It is detected based on kit of the present invention using round pcr, so can also include in kit
Conventional reagent required for some other PCR, such as: sterile water (ddH2O), dNTP, PCR buffer, rTaq enzyme, sample gene
Group DNA extracts one of common PCR reaction reagents such as reagent or a variety of.Since such PCR common agents can be through market way
Diameter is individually bought or is voluntarily configured, therefore specifically needs which reagent being fitted into kit, can be according to the practical need of client
It configures, for convenience, can also all be fitted into kit.
Kit of the invention can be the primer pair containing independent packaging, be also possible to containing configured containing drawing
The PCR of object pair detects liquid.
PCR detection liquid can be configured voluntarily, can also the general PCR detection liquid directly with commercially available without primer be added and draw
Object obtains.For example, sterile water (ddH can also be contained in the kit2O), dNTP, PCR buffer, rTaq enzyme.This is added
Primer, sample to be examined DNA extract or the sample bacterium solution of invention can be obtained PCR reaction system.
Preferably, positive control can also be contained in the kit.The positive control is to contain tcpS gene, lygD base
Cause or the DNA sample of flhBinner gene expression.
Preferably, negative control can also be contained in the kit.Negative control can for no tcpS gene, lygD gene and
The DNA sample of flhBinner gene expression.
The second aspect of the present invention provides the application method of aforementioned multiple PCR detection kit, includes the following steps:
(1) sample gene group DNA is extracted；
(2) it is loaded: sample gene group DNA, positive control or negative control is separately added into equipped with PCR reaction system
In PCR pipe, corresponding example reaction pipe, positive reaction pipe or negative reaction pipe are obtained, is contained in the PCR reaction system aforementioned
TcpS gene, lygD gene and flhBinner genetic test primer；
(3) PCR reacts: reaction tube is placed in PCR instrument, and loop parameter is arranged, and carries out PCR reaction；
(4) PCR after reaction, analyzes result.
Preferably, the method is the method for non-disease diagnostic purpose.
In step (1), extraction sample gene group DNA is the prior art.
Preferably, in step (3), the condition setting of PCR reaction are as follows: (a) 94 DEG C of 5min；(b)94℃45s；(c)55℃
45s；(d) 72 DEG C of 40s, step (b)~(d) are recycled 30 times, (e) 72 DEG C of 10min.
The third aspect of the present invention provides aforementioned agents box in preparation tcpS gene, lygD gene and flhBinner base
Because of the purposes in testing product.
Preferably, the testing product for respectively detect and screen Salmonella enteritidis, white diarrhea/Salmonella gallinarum or
Person Salmonella dublin.
Compared with prior art, the invention has the following beneficial effects:
The present invention by extensive and in-depth research, find for the first time tcpS gene exist only in enteritis, white diarrhea/typhoid fever and
In these three serotype detection of Salmonella of Dublin, lygD gene is existed only in Salmonella enteritidis, and white diarrhea and fowl typhoid sramana
Bacterium flhB gene lacks intermediate nucleotide fragments compared to other serotype detection of Salmonella flhB, thus, drawn with three pairs of specificity
Object demonstrates tcpS gene, lygD gene and flhBinner gene in different serotypes detection of Salmonella and other thin by round pcr
Distribution in bacterium.Kit energy fast high-flux of the invention identifies that enteritis, white diarrhea/typhoid fever and Dublin serotype are husky respectively
Door bacterium, can be used as the householder method of detection of Salmonella traditional serological parting, and for the monitoring of these three particular serotype detection of Salmonella with
Laboratory diagnosis provides a kind of simple and quick, reproducible new method.
Detailed description of the invention
Fig. 1: hurt to distinguish Salmonella enteritidis, white diarrhea and chicken using tcpS gene, lygD gene and flhBinner gene
The schematic diagram of cold detection of Salmonella and Salmonella dublin；Wherein, tcpS gene exists only in enteritis, white diarrhea/typhoid fever and all cypresses
In these three serotype detection of Salmonella of woods, lygD gene is existed only in Salmonella enteritidis, and white diarrhea and Salmonella gallinarum
FlhB gene lacks intermediate nucleotide fragments (flhBinner), i.e. white diarrhea/chicken compared to other serotype detection of Salmonella flhB
Salmonella typhi cannot amplify flhBinner segment.
Fig. 2: for identification with multi-plex PCR tcpS gene, lygD gene and flhBinner segment in different serotypes detection of Salmonella and
Distribution and clip size picture in other bacteriums；Wherein, swimming lane M are as follows: DL2000Marker；Swimming lane C50041 and C50336:
TcpS gene (882bp), lygD gene (339bp), flhBinner segment (155bp)；Swimming lane S06004,9855 and SG9:
TcpS gene；Swimming lane SL5928:tcpS gene, flhBinner segment；C50041 and C50336 is Salmonella enteritidis, S06004
It is Salmonella Pullorm with 6508, SG9 is Salmonella gallinarum, and SL5928 is Salmonella dublin, and T3 is salmonella uganda,
T9 is Salmonella meleagridis, and T8 is Salmonella anatis, and G2 is Salmonella london, and ZX is Salmonella rissen, and Y7 is Salmonella derby, Y8
For Salmonella typhimurtum, C500 is Salmonella choleraesuis；H37Rv is mycobacterium tuberculosis, and 11168 and 110 be campylobacter jejuni,
S19 is brucella, and EGDe and JS15 are Listeria, and 1314 and 1352 be Escherichia coli.
Fig. 3: for the multiple PCR detection kit sensitivity for identifying enteritis, white diarrhea/typhoid fever and Salmonella dublin；Its
In, swimming lane M are as follows: DL2000Marker；Swimming lane 1,4,7,10,13,16 is Salmonella enteritidis C50041 genome, swimming lane 2,5,8,
11,14,17 be Salmonella Pullorm S06004 genome, and swimming lane 3,6,9,12,15,18 is Dublin SL5928 genome；Swimming
Road 1-3,4-6,7-9,10-12,13-15,16-18 genome concentration be followed successively by 58.5ng/ μ l, 5.85ng/ μ l, 585pg/ μ l,
58.5pg/μl、5.85pg/μl、585fg/μl。
Fig. 4: for the Salmonella enteritidis in the detection of Salmonella sample of PCR identification 1~24 plant of pig farm separation, white diarrhea/fowl typhoid
Detection of Salmonella and Salmonella dublin；Wherein, swimming lane M are as follows: DL2000Marker；Swimming lane 1~24 is the detection of Salmonella of pig farm separation；
The swimming of amplifiable tcpS gene (882bp), lygD gene (339bp), flhBinner segment (155bp) three purpose bands out
Road is Salmonella enteritidis.
Fig. 5: for the Salmonella enteritidis in the detection of Salmonella sample of PCR identification 1~24 plant of chicken house separation, white diarrhea/fowl typhoid
Detection of Salmonella and Salmonella dublin；Wherein, swimming lane M are as follows: DL2000Marker；Swimming lane 1~24 is the detection of Salmonella of chicken house separation；
The swimming of amplifiable tcpS gene (882bp), lygD gene (339bp), flhBinner segment (155bp) three purpose bands out
Road is Salmonella enteritidis, and the swimming lane for only amplifying tcpS gene (882bp) is Salmonella Pullorm.
Fig. 6: for the Salmonella enteritidis in the detection of Salmonella sample of PCR identification 1~11 plant of cattle farm separation, white diarrhea/fowl typhoid
Detection of Salmonella and Salmonella dublin；Wherein, swimming lane M are as follows: DL2000Marker；Swimming lane 1~11 is the detection of Salmonella of cattle farm separation；
The swimming lane of amplifiable tcpS gene (882bp) out, flhBinner segment (155bp) two purpose bands is Salmonella dublin.
Specific embodiment
Before further describing the specific embodiments of the present invention, it should be appreciated that protection scope of the present invention is not limited to down
State specific specific embodiment；It is also understood that term used in the embodiment of the present invention is specific specific in order to describe
Embodiment, rather than limiting the scope of protection of the present invention.
When embodiment provides numberical range, it should be appreciated that except non-present invention is otherwise noted, two ends of each numberical range
Any one numerical value can be selected between point and two endpoints.Unless otherwise defined, the present invention used in all technologies and
Scientific term is identical as the normally understood meaning of those skilled in the art of the present technique.Except specific method, equipment used in embodiment,
Outside material, grasp and record of the invention according to those skilled in the art to the prior art can also be used and this
Any method, equipment and the material of the similar or equivalent prior art of method described in inventive embodiments, equipment, material come real
The existing present invention.
The distribution of 1 bioinformatics method of embodiment identification tcpS gene, lygD gene and flhBinner gene
Software (http://blast.ncbi.nlm.nih.gov/ is compared online using Blastn in NCBI
Blast.cgi) tcpS gene, lygD gene and flhBinner gene, search result is searched in full-length genome database to show
TcpS gene exists only in Salmonella enteritidis, white diarrhea and Salmonella gallinarum and Salmonella dublin, and lygD gene is only
It is present in Salmonella enteritidis, and white diarrhea and Salmonella gallinarum flhB gene are lacked compared to other serotype detection of Salmonella flhB
Few intermediate nucleotide fragments, i.e., do not have flhB intermediate segment flhBinner in white diarrhea and Salmonella gallinarum, according to this three
These three serotype detection of Salmonella can be distinguished (Fig. 1) by the characteristic distributions of a gene.
The preparation of 2 kit of embodiment
Design of primers and synthesis: it respectively using tcpS gene, lygD gene and flhBinner gene as template, designs and divides
Primer is analysed, and according to genomic dna sequence situation, therefrom select optimum detection primer pair, wherein it is complete for tcpS primer amplification
Long sequence (882bp), lygD primer amplification partial sequence (339bp), the non-white diarrhea of flhBinner primer amplification and fowl typhoid are husky
The flhBinner segment of door bacterium, nucleotide sequence are as shown in table 1 below:
Table 1
The nucleotide sequence for the tcpS gene that the tcpS primer can amplify as shown in SEQ ID NO.7, specifically:
ATGTCTATAAGCACCACAATGTCAAATATCAACAGAATACAAAAAGACATTGCTAGTCTACAAAAACA
ACTTTCTGATGAGCAGCGTAAAGAGGCCCAACTTTCAGGAAAAATCAATCAAATAAAGCGTAGCGTCACTAAGTCA
ACGTCTTTAAGCACATTGAATTCCAAAATGTCAGAGATCTCTCGTCATAAAAATGATATTTCAAGATGTAACTCTA
AAAAAGCAGATATTAATAAAAAAATAACAGCAAAAACTGGAGACTTACACCGTTATCAATTACAACTCATTAAAGA
GCAAGAGAATGACCAGAAAAAAAGAATTGCTGCACAGAAGAAACTTGAAAAAGAACAATTAGATTACCAGAAGAAA
ATCACACGAGAATTGAAATCGCAGAAAAGGGCAATATCTCCAAGCCATAAATTCAATCGTCCAGTCATCAACAAAT
CTGATGAGACAGAAGATATTACAGAGAGTTATGATGTTTTTATCTCTCATGCAACAGAAGATAAAGATAGTTTTGT
CCGTCCCCTTGCTGAGTTGTTAAGAGCAAAAGGGATAAATGTATGGTATGACGAATTCTCTTTAGGCTGGGGTAAA
AGTCTACGTAAGACAATCGATTATGGATTAGCAAATTCTCGGTTTGGAGTTGTTGTTTTATCTAAATCCTTTATCA
AAAAGGACTGGACAGAGTATGAATTAAATGGTTTGACTGCTAGAGAGATGAGCGGTGAAAACCAAGTAATACTGCC
TATCTGGCACGAAGTATCTAAATCTGATATTTTAAAATTCAGCCCTACACTAGTAGATAAAATGGCATTAAATACA
TCGATAAATACCATTGATGAAATTGCTGAACAGCTTGAATCATTATTGAAATGA。
The nucleotide sequence for the lygD gene that the lygD primer enough amplifies as shown in SEQ ID NO.8, specifically:
TCACTGATTTTTTAGGCGCTTTTGTGCAGCGAGCATGTTCTGGAAAGCCTCTTTATATAGCTCATTCT
GACCTTTAAGCCGGTCAATGAGTTTTTCTTTCTCAGATTCAGGGAGTATATCAAAAAGGTTTAGTAAATCAGCCTG
TTGTCTGCTCACCATTCGCCAGCCACCACCTTCGAAGTTGTCATCGTAAGTACCAGAAGAACGAACGTAGTTCATT
AGATCGGCCAAATCCGGTCGTAACTCTTCGGGTTTAACTCTCAATAGAACAGAAAATTTTAAGGCCGCATCAGTGT
TGAGAGGTGCCTTACCGTTCAAATAGTGACTGACGGTAGATTGTGTCTCAAAGCCCATAAGATCAGCGGCGATCTC
CTGAGTAAGTTTGAGGTCTCGCTTTTTGGCGTCCCAGATGGCGCGTAAGCGCTGGGTAGCTTCTGGTGGAGCTATT
TCTTCACGTTTTTTTCTCAT。
The nucleotide sequence for the flhBinner gene that the flhBinner primer enough amplifies such as SEQ ID NO.9 institute
Show, specifically:
GCAGCGCCGCATGATGGAAGATGTGCCGAAAGCGGACGTCATTGTCACTAACCCGACGCACTATTCCG
TGGCGCTGCAGTATGACGAAAACAAAATGAGCGCGCCGAAAGTGGTCGCGAAGGGGGCTGGATTAATAGCGCTGCG
CATTCGCGAGATCGGCGCTGAACATCGGGTTCCCACTTTAGAAGCGCCGCCGC。
Above-mentioned each primer pair can be packed individually, can also be made into PCR detection liquid.In the PCR detection liquid, above-mentioned primer exists
Concentration in the final system of multiplex PCR is 80nM.
That is, kit of the invention, can be each primer pair containing above-mentioned independent packaging, be also possible to containing
The configured PCR containing each primer pair detects liquid.
Further, the kit can also contain sterile water (ddH2O), dNTP, PCR buffer, rTaq enzyme, sample
Product extracting genome DNA reagent etc..
3 kit of embodiment detects the special of Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin
Property identification
Using three groups of primer pairs in kit described in embodiment 2, with the base of different serotypes detection of Salmonella and other bacteriums
Because group is respectively template, multiple PCR method detects Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin
Specificity.
PCR reaction system is 2 μ L, 10 × PCR buffer of (25 μ L): dNTP 2.5 μ L, tcpS-F 80nM, tcpS-R
80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, 2 μ L, rTaq enzyme of template
0.25 μ L, ddH2O is mended to 25 μ L.
PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30 circulations；72℃10min.
PCR product carries out 1% agarose gel electrophoresis, and PCR electrophoresis result shows using Salmonella enteritidis genome as template
Swimming lane it is amplifiable go out three bands, respectively tcpS gene (882bp), lygD gene (339bp), flhBinner segment
(155bp)；A band is only expanded using white diarrhea and Salmonella gallinarum genome as the swimming lane of template, is tcpS gene；With all
Berlin detection of Salmonella genome is the swimming lane of template amplifiable two bands, respectively tcpS gene, flhBinner segment (Fig. 2) out.
Show with tcpS, lygD and flhBinner amplimer specific in kit described in embodiment 2, it can be by multiplex PCR side
Whether the unknown bacterium of method Rapid identification is these three serotype detection of Salmonella.
The spirit of 4 kit of embodiment detection Salmonella enteritidis, white diarrhea and Salmonella gallinarum and Salmonella dublin
Quick property identification
It is using three groups of primer pairs in kit described in embodiment 2, Salmonella enteritidis C50041 genome, white diarrhea is husky
Door bacterium S06004 genome and the successively 10 times of dilutions of Salmonella dublin SL5928 genome, respectively using diluted genome as mould
Plate, identification kit detect the sensitivity of Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin.
PCR reaction system is 2 μ L, 10 × PCR buffer of (25 μ L): dNTP 2.5 μ L, tcpS-F 80nM, tcpS-R
80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, 2 μ L, rTaq enzyme of template
0.25 μ L, ddH2O is mended to 25 μ L.
PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30 circulations；72℃10min.
PCR product carries out 1% agarose gel electrophoresis, PCR electrophoresis result show based on tcpS, flhBinner and
The multiple PCR detection kit of flhBinner can detect Salmonella enteritidis genome, the Salmonella Pullorm base of 58.5pg/ μ l
Because of group and Salmonella dublin genome (Fig. 3).
Application of 5 kit of embodiment on pig farm
Using kit in embodiment 2, the detection of Salmonella sample of 24 plants of pig farms separation is detected, can rapidly and accurately be detected respectively
Salmonella enteritidis out.Specific step is as follows:
1) separation of detection of Salmonella
Sample picks up from Jiangsu pig farm, the acquisition of sample, the separation for increasing bacterium and detection of Salmonella and Physiology and biochemistry mirror in this test
It is fixed with reference to built cube method in the prior art (Li Y, et al.Food Control, 2016；Cai Y,et al.Int J
Food Microbiol, 2016), this test, which isolates, identifies 24 plants of detection of Salmonella.
2) Salmonella enteritidis in multiple PCR method detection sample
24 plants of detection of Salmonella are inoculated into LB liquid medium respectively, 37 DEG C of 180rpm are incubated overnight, and next day uses bacterium
Genome extraction kit extracts the genome of each strain bacterium, expands tcpS gene, lygD gene simultaneously by template of genome
With flhBinner segment, PCR reaction system is 2 μ L, 10 × PCR buffer of (25 μ L): dNTP 2.5 μ L, tcpS-F
80nM, tcpS-R 80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, mould
2 μ L, rTaq enzyme of plate 0.25 μ L, ddH2O is mended to 25 μ L.PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30
A circulation；72℃10min.PCR product carries out 1% agarose gel electrophoresis, amplifiable tcpS gene (882bp), lygD base out
Because the swimming lane of (339bp), flhBinner segment (155bp) three purpose bands are Salmonella enteritidis.24 plants of sramana as the result is shown
3 plants are shared in bacterium can be detected simultaneously by this three band, be 9,17 and 21 (Fig. 4) respectively, these detection of Salmonella separation strains are enteritis
Detection of Salmonella.
3) traditional Serotype Identification of detection of Salmonella
The Serotype Identification of 24 plants of detection of Salmonella of this test separation is with reference to built cube method (Li Y, et in the prior art
al.Food Control,2016；Cai Y, et al.Int J Food Microbiol, 2016), serotype identification results table
3 plants of Salmonella enteritidis are shared in bright 24 plants of detection of Salmonella, respectively 9,17 and 21, PCR testing result and serotype identification results are complete
It is complete consistent.
In the present embodiment, using the method for Serotype Identification, the Salmonella enteritidis in 24 plants of detection of Salmonella is screened,
Need at least 2 days time.And use the detection kit of the embodiment of the present invention 2, it is only necessary to 3 hours, can be by 24 plants of sramana
Salmonella enteritidis in bacterium accurately screens, and accuracy is 100%.
Application of 6 kit of embodiment in chicken house
Using kit in embodiment 2, the detection of Salmonella sample of 24 plants of chicken houses separation is detected, can rapidly and accurately detect intestines
Scorching detection of Salmonella and white diarrhea/Salmonella gallinarum.Specific step is as follows:
1) separation of detection of Salmonella
Sample picks up from Jiangsu chicken house, the acquisition of sample, the separation for increasing bacterium and detection of Salmonella and Physiology and biochemistry mirror in this test
It is fixed with reference to built cube method in the prior art (Li Y, et al.Food Control, 2016；Cai Y,et al.Int J
Food Microbiol, 2016), this test, which isolates, identifies 24 plants of detection of Salmonella.
2) Salmonella enteritidis and white diarrhea and Salmonella gallinarum in multiple PCR method detection sample
24 plants of detection of Salmonella are inoculated into LB liquid medium respectively, 37 DEG C of 180rpm are incubated overnight, and next day uses bacterium
Genome extraction kit extracts the genome of each strain bacterium, expands tcpS gene, lygD gene simultaneously by template of genome
With flhBinner segment, PCR reaction system is 2 μ L, 10 × PCR buffer of (25 μ L): dNTP 2.5 μ L, tcpS-F
80nM, tcpS-R 80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, mould
2 μ L, rTaq enzyme of plate 0.25 μ L, ddH2O is mended to 25 μ L.PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30
A circulation；72℃10min.PCR product carries out 1% agarose gel electrophoresis, amplifiable tcpS gene (882bp), lygD base out
Because the swimming lane of (339bp), flhBinner segment (155bp) three purpose bands is Salmonella enteritidis, tcpS gene is only amplified
The swimming lane of (882bp) is Salmonella Pullorm.TcpS base can be detected simultaneously by by sharing 5 plants in 24 plants of detection of Salmonella samples as the result is shown
Cause, lygD gene and flhBinner segment, are 6,8,17,22 and 24 respectively, these detection of Salmonella are Salmonella enteritidis；It is shared
11 plants only detect tcpS gene, are 3,5,7,10,12,13,14,16,18,20 and 21 (Fig. 5) respectively, these detection of Salmonella are
White diarrhea/Salmonella gallinarum.
3) traditional Serotype Identification of detection of Salmonella
The Serotype Identification of 22 plants of detection of Salmonella of this test separation is with reference to built cube method (Li Y, et in the prior art
al.Food Control,2016；Cai Y, et al.Int J Food Microbiol, 2016), serotype identification results table
5 plants of Salmonella enteritidis are shared in bright 22 plants of detection of Salmonella, respectively 6,8,17,22 and 24 share 11 plants of Salmonella Pullorms, respectively
It is 3,5,7,10,12,13,14,16,18,20 and 21, PCR testing result and serotype identification results are completely the same.
In the present embodiment, using the method for Serotype Identification, by 24 plants of detection of Salmonella Salmonella enteritidis and chicken it is white
Dysentery and Salmonella gallinarum screen, and need at least 2 days time.And the detection kit of the embodiment of the present invention 2 is used, only
Need 3 hours, can by 24 plants of detection of Salmonella Salmonella enteritidis and white diarrhea/Salmonella gallinarum accurately screen,
And accuracy is 100%.
Application of 7 kit of embodiment in cattle farm
Using kit in embodiment 2, the detection of Salmonella sample of 11 plants of cattle farms separation is detected, can rapidly and accurately be detected all
These three serotypes of Berlin detection of Salmonella.Specific step is as follows:
1) separation of detection of Salmonella
Sample picks up from Jiangsu cattle farm, the acquisition of sample, the separation for increasing bacterium and detection of Salmonella and Physiology and biochemistry mirror in this test
It is fixed with reference to built cube method in the prior art (Li Y, et al.Food Control, 2016；Cai Y,et al.Int J
Food Microbiol, 2016), this test, which isolates, identifies 11 plants of detection of Salmonella.
2) Salmonella dublin in PCR method detection sample
11 plants of detection of Salmonella are inoculated into LB liquid medium respectively, 37 DEG C of 180rpm are incubated overnight, and next day uses bacterium
Genome extraction kit extracts the genome of each strain bacterium, expands tcpS gene, lygD gene simultaneously by template of genome
With flhBinner segment, PCR reaction system is 2 μ L, 10 × PCR buffer of (25 μ L): dNTP 2.5 μ L, tcpS-F
80nM, tcpS-R 80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, mould
2 μ L, rTaq enzyme of plate 0.25 μ L, ddH2O is mended to 25 μ L.PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30
A circulation；72℃10min.PCR product 1% agarose gel electrophoresis of progress, amplifiable tcpS gene (882bp) out,
The swimming lane of flhBinner segment (155bp) two purpose bands is Salmonella dublin.As the result is shown only 7 in 11 plants of detection of Salmonella
Number sample contains tcpS gene and flhBinner segment (Fig. 6) simultaneously, which is Salmonella dublin.
3) traditional Serotype Identification of detection of Salmonella
The Serotype Identification of 11 plants of detection of Salmonella of this test separation is with reference to built cube method (Li Y, et in the prior art
al.Food Control,2016；Cai Y, et al.Int J Food Microbiol, 2016), serotype identification results table
1 plant of Salmonella dublin is shared in bright 11 plants of detection of Salmonella, is No. 7 separation bacterium, PCR testing result and serotype identification results are complete
Unanimously.
In the present embodiment, using the method for Serotype Identification, the Salmonella dublin in 11 plants of detection of Salmonella is filtered out
Come, needs at least 2 days time.And use the detection kit of the embodiment of the present invention 2, it is only necessary to 3 hours, can be by 11 plants of sand
Salmonella dublin in door bacterium accurately screens, and accuracy is 100%.
In conclusion advantage of the kit of the present invention compared to traditional Serotype Identification method:
Traditional Serotype Identification need to buy specific detection of Salmonella Serotype Identification kit, expensive, complex steps, especially
It separates specific serotype detection of Salmonella (such as Salmonella enteritidis, white diarrhea and Salmonella gallinarum or all cypress in large sample
Woods detection of Salmonella) when, it need to take considerable time (at least two days), and workload is huge, as a result, by visually being judged, thus
There may be human errors；And the detection method of kit of the present invention is easy to operate, cost is very low, and entire qualification process is three
It is can be completed in hour (comprising PCR and agarose gel electrophoresis), and accuracy rate reaches 100%.
Therefore, a kind of Rapid identification Salmonella enteritidis, white diarrhea and Salmonella gallinarum of the invention and Dublin are husky
The multiple PCR detection kit of door bacterium is conducive to the conventional procedures for simplifying detection of Salmonella Serotype Identification, to sieve in great amount of samples
Enteritis, white diarrhea/typhoid fever and Dublin serotype detection of Salmonella is selected to provide a kind of new method of Rapid identification.
The above-described embodiments merely illustrate the principles and effects of the present invention, and is not intended to limit the present invention.It is any ripe
The personage for knowing this technology all without departing from the spirit and scope of the present invention, carries out modifications and changes to above-described embodiment.Cause
This, institute is complete without departing from the spirit and technical ideas disclosed in the present invention by those of ordinary skill in the art such as
At all equivalent modifications or change, should be covered by the claims of the present invention.
Claims (6)
1. the multiplex PCR of a kind of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin detects
Kit includes that tcpS genetic test primer, lygD genetic test primer and flhBinner genetic test are drawn in the kit
Object, the tcpS genetic test primer include nucleotide sequence forward primer and nucleotide sequence as shown in SEQ ID NO.1
The reverse primer as shown in SEQ ID NO.2；The lygD genetic test primer includes nucleotide sequence such as SEQ ID NO.3 institute
The forward primer and nucleotide sequence shown reversely draws as shown in SEQ ID NO.4；The flhBinner genetic test primer packet
It includes nucleotide sequence forward primer as shown in SEQ ID NO.5 and nucleotide sequence reversely draws as shown in SEQ ID NO.6
Object.
2. detection kit according to claim 1, which is characterized in that the kit also contain sterile water, dNTP,
PCR buffer, rTaq enzyme, sample gene group DNA extract one of reagent or a variety of.
3. detection kit according to claim 1, which is characterized in that the kit also contains positive control or feminine gender
One of control is a variety of.
4. the application method of the detection kit as described in claims 1 to 3 any claim, the method are examined for non-disease
The method of disconnected purpose, includes the following steps:
(1) sample gene group DNA is extracted；
(2) it is loaded: sample gene group DNA, positive control or negative control is separately added into the PCR pipe equipped with PCR reaction system
In, corresponding example reaction pipe, positive reaction pipe or negative reaction pipe are obtained, contains claim 1 in the PCR reaction system
Described in tcpS genetic test primer, lygD genetic test primer and flhBinner genetic test primer；
(3) PCR reacts: reaction tube is placed in PCR instrument, and loop parameter is arranged, and carries out PCR reaction；
(4) PCR after reaction, analyzes result.
5. detection kit as described in claims 1 to 3 any claim preparation tcpS gene, lygD gene and
Purposes in flhBinner genetic test product.
6. purposes according to claim 5, which is characterized in that the testing product is husky for detecting respectively and screening enteritis
Door bacterium, white diarrhea/Salmonella gallinarum or Salmonella dublin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610626906.3A CN106244690B (en) | 2016-08-03 | 2016-08-03 | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610626906.3A CN106244690B (en) | 2016-08-03 | 2016-08-03 | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244690A CN106244690A (en) | 2016-12-21 |
| CN106244690B true CN106244690B (en) | 2019-06-18 |
Family
ID=57606145
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610626906.3A Active CN106244690B (en) | 2016-08-03 | 2016-08-03 | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244690B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592241A (en) * | 2019-08-13 | 2019-12-20 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Quadruple fluorescent quantitative PCR (polymerase chain reaction) detection method and detection kit for salmonella |
| CN116121427B (en) * | 2023-03-13 | 2024-01-12 | 中国人民解放军军事科学院军事医学研究院 | Kit for detecting salmonella enteritidis based on fluorescent RPA technology and application thereof |
| CN117987578B (en) * | 2024-04-03 | 2024-07-09 | 北京市动物疫病预防控制中心 | Microfluidic chip for simultaneously detecting pathogenic escherichia coli, salmonella and drug resistance genes and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011212026A (en) * | 2008-07-08 | 2011-10-27 | National Agriculture & Food Research Organization | Quick method for identifying salmonella typhimurium, choleraesuis, enteritidis, dublin, and gallinarum by multiply detecting specific gene |
| CN105648055A (en) * | 2016-01-15 | 2016-06-08 | 江苏省家禽科学研究所 | Multi-PCR detection kit for poultry salmonella and non-diagnostic detection method of poultry salmonella |
-
2016
- 2016-08-03 CN CN201610626906.3A patent/CN106244690B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011212026A (en) * | 2008-07-08 | 2011-10-27 | National Agriculture & Food Research Organization | Quick method for identifying salmonella typhimurium, choleraesuis, enteritidis, dublin, and gallinarum by multiply detecting specific gene |
| CN105648055A (en) * | 2016-01-15 | 2016-06-08 | 江苏省家禽科学研究所 | Multi-PCR detection kit for poultry salmonella and non-diagnostic detection method of poultry salmonella |
Non-Patent Citations (2)
| Title |
|---|
| Amplification of rfbE and fliC genes by polymerase chain reaction for identification and detection of Salmonella serovar Enteritidis, Dublin and Gallinarum-Pullorum;Itoh Y等;《Microbiol Immunol》;19971231;第41卷(第10期);第791-794页 * |
| 肠炎沙门氏菌的分离鉴定与特异性检测方法的建立;陆广富;《中国博士学位论文全文数据库（电子期刊）农业科技辑》;20130430(第4期);D050-11 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244690A (en) | 2016-12-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11725252B2 (en) | PCR detection kit for rapidly identifying Salmonella of specific serotypes | |
| Zandi et al. | Typing of Toxigenic Isolates of Clostridium perfringens by Multiplex PCR in Ostrich. | |
| CN106244690B (en) | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin | |
| CN101613745B (en) | Staphylococcus aureus multiple PCR-MIX rapid detection kit and detection method thereof | |
| Zhou et al. | Multiple PCR assay based on the cigR gene for detection of Salmonella spp. and Salmonella Pullorum/Gallinarum identification | |
| CN115786543A (en) | Multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum | |
| CN109957622A (en) | It is a kind of detect duck infectious serositis RPA-LFD visualizing agent box and its application | |
| CN106086209B (en) | A kind of PCR detection kit of Rapid identification white diarrhea and Salmonella gallinarum | |
| CN109913565A (en) | A kind of kit for detecting vibrio parahaemolytious, primer pair, probe and method | |
| CN108330176B (en) | PCR detection kit for rapidly identifying pullorum/salmonella gallinarum | |
| CN104342496B (en) | A kind of quick detection, identify that Liszt belongs to the method for bacterium | |
| CN109337995A (en) | The PCR detection method and kit of bacillus tularense and its subspecies | |
| CN109136396A (en) | A kind of specific detection primer and detection kit of clostridium welchii disease | |
| CN104531860B (en) | A kind of molecular detecting method of Shigella and its application | |
| AU2019100071A4 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
| CN105331677B (en) | For multiplex PCR detection primer sets, kit and the detection method of the salmonella and Shigella in food | |
| CN106244691A (en) | A kind of based on the method for Salmonella in microdroplet digital pcr method fast quantification examination Fructus Fragariae Ananssae | |
| CN105734165A (en) | Aeromonas schubertii specific primer and application thereof in turbot farming process | |
| CN104561263A (en) | Rapid detection kit and detection method for clostridium botulinum B employing loop-mediated isothermal gene amplification | |
| CN105755156A (en) | Specific primer of Aeromonas salmonicida and application thereof to turbot culture process | |
| CN106636428A (en) | PCR (Polymerase Chain Reaction) method for quickly detecting and identifying serratia | |
| CN105986029B (en) | Liquid chip method for identifying pig source food source bacteria | |
| CN105112406B (en) | To Hafnia alvei G5897, G5898, G5900 special nucleotide and its application | |
| CN109251990A (en) | A kind of primer sets, purposes, the kit comprising the primer sets and its detection method of the detection salmonella based on nest-type PRC | |
| CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |