CN106244690A - A kind of Rapid identification Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and the multiple PCR detection kit of Salmonella dublin - Google Patents
A kind of Rapid identification Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and the multiple PCR detection kit of Salmonella dublin Download PDFInfo
- Publication number
- CN106244690A CN106244690A CN201610626906.3A CN201610626906A CN106244690A CN 106244690 A CN106244690 A CN 106244690A CN 201610626906 A CN201610626906 A CN 201610626906A CN 106244690 A CN106244690 A CN 106244690A
- Authority
- CN
- China
- Prior art keywords
- salmonella
- gene
- primer
- pcr
- tcps
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/689—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for bacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/02—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving viable microorganisms
- C12Q1/04—Determining presence or kind of microorganism; Use of selective media for testing antibiotics or bacteriocides; Compositions containing a chemical indicator therefor
- C12Q1/10—Enterobacteria
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/686—Polymerase chain reaction [PCR]
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Toxicology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to field of biological technology detection, be specifically related to a kind of Rapid identification Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and the multiple PCR detection kit of Salmonella dublin.Described test kit includestcpSGene test primer,lygDGene test primer andflhBinnerGene test primer.The test kit energy fast high-flux of the present invention identifies enteritis, Pullorum Disease/typhoid fever and Salmonella dublin serotype respectively, can be as the householder method of salmonella traditional serological typing, and monitoring and the laboratory diagnosis for these three particular serotype salmonella provides a kind of simple and quick, reproducible new method.
Description
Technical field
The invention belongs to field of biological technology detection, be specifically related to a kind of Rapid identification Salmonella enteritidis, Pullorum Disease/chicken wound
Cold salmonella and the multiple PCR detection kit of Salmonella dublin.
Background technology
Salmonellosis is one of Amphixenosis significant on public hygienics, and its cause of disease Salmonella is in intestinal bar
Cordycepps, egg, domestic animal and meat products are primary vehicle, and it not only can cause multiple livestock and poultry, causes systemic sepsis
And enteritis, it is also possible to as the pathogen of food origin disease, cause human gastrointestinal scorching and alimentary toxicosis.In China, bacillary food
In thing poisoning, there are about 70%～80% is by salmonellal.At present, divide according to Kauffman-White (K-W) serotype
Type method, according to salmonella somatic antigen and the difference of flagellar antigen, the current serotype of salmonella has more than 2600 kinds, China
It has been reported 292 kinds of different serotypes, belong to 35 O groups.
Traditional detection method is the most non-selective and selective enrichment, biochemical characteristic and serological Identification are very laborious, time-consuming,
Needing within 4-7 days, just can complete, other is such as antibody testing method, although quickly, but its high false positive makes it unsuitable for conventional sense.This
Outward, low-level pathogen contamination, cause the factor such as " the causing injury " of salmonella and the interference of other composition of food after food processing,
The detection making salmonella is somewhat limited.Therefore, it is badly in need of some quick, special, sensitive detection methods, to find in time
Pathogenic bacterium, control the harm polluted and may produce health.
Summary of the invention
For the problem in the presence of prior art, it is an object of the invention to provide a kind of Rapid identification enteritis sramana
Bacterium, Pullorum Disease/Salmonella gallinarum and the multiple PCR detection kit of Salmonella dublin and preparation thereof and application.
To achieve these goals and other relevant purposes, the present invention adopts the following technical scheme that
A first aspect of the present invention, it is provided that a kind of Rapid identification Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and all
The multiple PCR detection kit of Berlin salmonella, described test kit includes that tcpS gene test primer, lygD gene test are drawn
Thing and flhBinner gene test primer.
Preferably, described tcpS gene test primer includes nucleotide sequence forward primer as shown in SEQ ID NO.1
With nucleotide sequence reverse primer as shown in SEQ ID NO.2.
Preferably, described lygD gene test primer includes nucleotide sequence forward primer as shown in SEQ ID NO.3
With nucleotide sequence reverse primer as shown in SEQ ID NO.4.
Preferably, described flhBinner gene test primer includes nucleotide sequence forward as shown in SEQ ID NO.5
Primer and nucleotide sequence reverse primer as shown in SEQ ID NO.6.
The test kit of the present invention uses multiplex PCR detection technique to carry out tcpS gene, lygD gene and flhBinner gene
Detection, can analyze according to amplification and detection case and judge to detect whether object belongs to Salmonella enteritidis, Pullorum Disease/fowl typhoid sramana
One of bacterium or Salmonella dublin.Therefore, the design of primer is the key of test kit of the present invention.
Round pcr is used to detect, so test kit can also include based on test kit of the present invention
Conventional reagent required for some other PCR, such as: sterilized water (ddH2O), dNTP, PCR buffer, rTaq enzyme, sample gene
One or more in the conventional PCR reaction reagents such as group DNA extraction reagent.Owing to this type of PCR common agents all can be through way, market
Footpath is individually buied or configures voluntarily, the most specifically needs which reagent is fitted into test kit, can be according to the actual need of client
Configure, for convenience, it is possible to be all fitted into test kit.
The test kit of the present invention, can be the primer pair containing independent packaging, it is also possible to be containing configured containing drawing
The PCR of thing pair detects liquid.
Described PCR detection liquid can configure voluntarily, it is possible to directly adds with the commercially available detection liquid of the universal PC R without primer and draws
Thing obtains.Such as, described test kit can also contain sterilized water (ddH2O), dNTP, PCR buffer, rTaq enzyme.Add this
Primer, sample DNA extract to be checked or the sample bacterium solution of invention can obtain PCR reaction system.
Preferably, described test kit also can contain positive control.Described positive control is containing tcpS gene, lygD base
Cause or the DNA sample of flhBinner gene expression.
Preferably, described test kit also can contain negative control.Negative control can be without tcpS gene, lygD gene and
The DNA sample of flhBinner gene expression.
A second aspect of the present invention, it is provided that the using method of aforementioned multiple PCR detection kit, comprises the steps:
(1) sample gene group DNA is extracted；
(2) sample-adding: sample gene group DNA, positive control or negative control are separately added into equipped with PCR reaction system
In PCR pipe, it is thus achieved that corresponding example reaction pipe, positive reaction pipe or negative reaction pipe, containing aforementioned in described PCR reaction system
TcpS gene, lygD gene and flhBinner gene test primer；
(3) PCR reaction: reaction tube is placed in PCR instrument, arranges loop parameter, carries out PCR reaction；
(4) after PCR reaction terminates, analysis result.
Preferably, described method is the method for non-diseases diagnostic purpose.
In step (1), extracting sample gene group DNA is prior art.
Preferably, in step (3), the condition setting of PCR reaction is: (a) 94 DEG C of 5min；(b)94℃45s；(c)55℃
45s；D () 72 DEG C of 40s, step (b)～(d) circulate 30 times, (e) 72 DEG C of 10min.
A third aspect of the present invention, it is provided that aforementioned agents box is at preparation tcpS gene, lygD gene and flhBinner base
Because of the purposes in detection product.
Preferably, described detection product for detect and screen respectively Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum or
Person Salmonella dublin.
Compared with prior art, there is advantages that
The present invention by extensively in-depth study, find first tcpS gene exist only in enteritis, Pullorum Disease/typhoid fever and
In the these three serotype salmonella of Dublin, lygD gene exists only in Salmonella enteritidis, and Pullorum Disease and fowl typhoid sramana
Bacterium flhB gene lacks the nucleotide fragments of centre compared to other serotype salmonella flhB, thus, draw with three pairs of specificitys
Thing demonstrates tcpS gene, lygD gene and flhBinner gene by round pcr, and at different serotypes salmonella and other is thin
Distribution in bacterium.The test kit energy fast high-flux of the present invention identifies that enteritis, Pullorum Disease/typhoid fever and Dublin serotype are husky respectively
Door bacterium, can as the householder method of salmonella traditional serological typing, and be these three particular serotype salmonella monitoring and
Laboratory diagnosis provides a kind of simple and quick, reproducible new method.
Accompanying drawing explanation
Fig. 1: for utilizing tcpS gene, lygD gene and flhBinner gene to distinguish Salmonella enteritidis, Pullorum Disease and chicken wound
Cold salmonella and the schematic diagram of Salmonella dublin；Wherein, tcpS gene exists only in enteritis, Pullorum Disease/typhoid fever and all cypresses
In woods these three serotype salmonella, lygD gene exists only in Salmonella enteritidis, and Pullorum Disease and Salmonella gallinarum
FlhB gene lacks the nucleotide fragments (flhBinner) of centre, i.e. Pullorum Disease/chicken compared to other serotype salmonella flhB
Salmonella typhi can not amplify flhBinner fragment.
Fig. 2: for identification with multi-plex PCR tcpS gene, lygD gene and flhBinner fragment at different serotypes salmonella and
Distribution in other antibacterial and clip size picture；Wherein, swimming lane M is: DL2000Marker；Swimming lane C50041 and C50336:
TcpS gene (882bp), lygD gene (339bp), flhBinner fragment (155bp)；Swimming lane S06004,9855 and SG9:
TcpS gene；Swimming lane SL5928:tcpS gene, flhBinner fragment；C50041 and C50336 is Salmonella enteritidis, S06004
Being Salmonella Pullorm with 6508, SG9 is Salmonella gallinarum, and SL5928 is Salmonella dublin, and T3 is salmonella uganda,
T9 is Salmonella meleagridis, and T8 is Salmonella anatis, and G2 is Salmonella london, and ZX is Salmonella rissen, and Y7 is Salmonella derby, Y8
For Salmonella typhimurtum, C500 is Salmonella choleraesuis；H37Rv is mycobacterium tuberculosis, and 11168 and 110 is campylobacter jejuni,
S19 is brucella, EGDe and JS15 is Listerella, and 1314 and 1352 is escherichia coli.
Fig. 3: for identifying enteritis, Pullorum Disease/typhoid fever and the multiple PCR detection kit sensitivity of Salmonella dublin；Its
In, swimming lane M is: DL2000Marker；Swimming lane 1,4,7,10,13,16 is Salmonella enteritidis C50041 genome, swimming lane 2,5,8,
11,14,17 is Salmonella Pullorm S06004 genome, and swimming lane 3,6,9,12,15,18 is Dublin SL5928 genome；Swimming
Road 1-3,4-6,7-9,10-12,13-15,16-18 genome concentration be followed successively by 58.5ng/ μ l, 5.85ng/ μ l, 585pg/ μ l,
58.5pg/μl、5.85pg/μl、585fg/μl。
Fig. 4: identify the Salmonella enteritidis in the salmonella sample that 1～24 strain pig farms separate, Pullorum Disease/fowl typhoid for PCR
Salmonella and Salmonella dublin；Wherein, swimming lane M is: DL2000Marker；The salmonella that swimming lane 1～24 separates for pig farm；
Amplifiable go out tcpS gene (882bp), lygD gene (339bp), the swimming of band of flhBinner fragment (155bp) three entry
Road is Salmonella enteritidis.
Fig. 5: identify the Salmonella enteritidis in the salmonella sample that 1～24 strain chicken houses separate, Pullorum Disease/fowl typhoid for PCR
Salmonella and Salmonella dublin；Wherein, swimming lane M is: DL2000Marker；The salmonella that swimming lane 1～24 separates for chicken house；
Amplifiable go out tcpS gene (882bp), lygD gene (339bp), the swimming of band of flhBinner fragment (155bp) three entry
Road is Salmonella enteritidis, and the swimming lane only amplifying tcpS gene (882bp) is Salmonella Pullorm.
Fig. 6: identify the Salmonella enteritidis in the salmonella sample that 1～11 strain cattle farms separate, Pullorum Disease/fowl typhoid for PCR
Salmonella and Salmonella dublin；Wherein, swimming lane M is: DL2000Marker；The salmonella that swimming lane 1～11 separates for cattle farm；
The amplifiable tcpS of going out gene (882bp), the swimming lane of band of flhBinner fragment (155bp) two entry are Salmonella dublin.
Detailed description of the invention
Before further describing the specific embodiment of the invention, it should be appreciated that protection scope of the present invention is not limited to down
State specific specific embodiments；It is also understood that the term used in the embodiment of the present invention is specific concrete in order to describe
Embodiment rather than in order to limit the scope of the invention.
When embodiment provides numerical range, it should be appreciated that unless the present invention is otherwise noted, two ends of each numerical range
Between point and two end points, any one numerical value all can be selected for.Unless otherwise defined, in the present invention use all technology and
The same meaning that scientific terminology and those skilled in the art of the present technique are generally understood that.Except in embodiment use concrete grammar, equipment,
Outside material, according to those skilled in the art's grasp to prior art and the record of the present invention, it is also possible to use and this
Any method, equipment and the material of the prior art that the method described in inventive embodiments, equipment, material are similar or equivalent comes real
The existing present invention.
Embodiment 1 bioinformatics method identifies tcpS gene, lygD gene and the distribution of flhBinner gene
Blastn online comparison software (http://blast.ncbi.nlm.nih.gov/ is used in NCBI
Blast.cgi) searching for tcpS gene, lygD gene and flhBinner gene in full-length genome data base, Search Results shows
TcpS gene exists only in Salmonella enteritidis, Pullorum Disease and Salmonella gallinarum and Salmonella dublin, and lygD gene is only
It is present in Salmonella enteritidis, and Pullorum Disease and Salmonella gallinarum flhB gene lack compared to other serotype salmonella flhB
Nucleotide fragments in the middle of few, does not i.e. have flhB intermediate segment flhBinner in Pullorum Disease and Salmonella gallinarum, according to this three
These three serotype salmonella can be distinguished (Fig. 1) by the characteristic distributions of individual gene.
The preparation of embodiment 2 test kit
Design of primers and synthesis: respectively with tcpS gene, lygD gene and flhBinner gene as template, design and divide
Analysis primer, and according to genomic dna sequence situation, therefrom selects optimum detection primer pair, and wherein, it is complete for tcpS primer amplification
Long sequence (882bp), lygD primer amplification partial sequence (339bp), the non-Pullorum Disease of flhBinner primer amplification and fowl typhoid are husky
The flhBinner fragment of door bacterium, its nucleotide sequence is as shown in table 1 below:
Table 1
The nucleotide sequence of the tcpS gene that described tcpS primer can amplify as shown in SEQ ID NO.7, particularly as follows:
ATGTCTATAAGCACCACAATGTCAAATATCAACAGAATACAAAAAGACATTGCTAGTCTACAAAAACAACTTTCTGA
TGAGCAGCGTAAAGAGGCCCAACTTTCAGGAAAAATCAATCAAATAAAGCGTAGCGTCACTAAGTCAACGTCTTTAA
GCACATTGAATTCCAAAATGTCAGAGATCTCTCGTCATAAAAATGATATTTCAAGATGTAACTCTAAAAAAGCAGAT
ATTAATAAAAAAATAACAGCAAAAACTGGAGACTTACACCGTTATCAATTACAACTCATTAAAGAGCAAGAGAATGA
CCAGAAAAAAAGAATTGCTGCACAGAAGAAACTTGAAAAAGAACAATTAGATTACCAGAAGAAAATCACACGAGAAT
TGAAATCGCAGAAAAGGGCAATATCTCCAAGCCATAAATTCAATCGTCCAGTCATCAACAAATCTGATGAGACAGAA
GATATTACAGAGAGTTATGATGTTTTTATCTCTCATGCAACAGAAGATAAAGATAGTTTTGTCCGTCCCCTTGCTGA
GTTGTTAAGAGCAAAAGGGATAAATGTATGGTATGACGAATTCTCTTTAGGCTGGGGTAAAAGTCTACGTAAGACAA
TCGATTATGGATTAGCAAATTCTCGGTTTGGAGTTGTTGTTTTATCTAAATCCTTTATCAAAAAGGACTGGACAGAG
TATGAATTAAATGGTTTGACTGCTAGAGAGATGAGCGGTGAAAACCAAGTAATACTGCCTATCTGGCACGAAGTATC
TAAATCTGATATTTTAAAATTCAGCCCTACACTAGTAGATAAAATGGCATTAAATACATCGATAAATACCATTGATG
AAATTGCTGAACAGCTTGAATCATTATTGAAATGA。
The nucleotide sequence of the lygD gene that described lygD primer enough amplifies as shown in SEQ ID NO.8, particularly as follows:
TCACTGATTTTTTAGGCGCTTTTGTGCAGCGAGCATGTTCTGGAAAGCCTCTTTATATAGCTCATTCTGACCTTTAA
GCCGGTCAATGAGTTTTTCTTTCTCAGATTCAGGGAGTATATCAAAAAGGTTTAGTAAATCAGCCTGTTGTCTGCTC
ACCATTCGCCAGCCACCACCTTCGAAGTTGTCATCGTAAGTACCAGAAGAACGAACGTAGTTCATTAGATCGGCCAA
ATCCGGTCGTAACTCTTCGGGTTTAACTCTCAATAGAACAGAAAATTTTAAGGCCGCATCAGTGTTGAGAGGTGCCT
TACCGTTCAAATAGTGACTGACGGTAGATTGTGTCTCAAAGCCCATAAGATCAGCGGCGATCTCCTGAGTAAGTTTG
AGGTCTCGCTTTTTGGCGTCCCAGATGGCGCGTAAGCGCTGGGTAGCTTCTGGTGGAGCTATTTCTTCACGTTTTTT
TCTCAT。
The nucleotide sequence such as SEQ ID NO.9 institute of the flhBinner gene that described flhBinner primer enough amplifies
Show, particularly as follows:
GCAGCGCCGCATGATGGAAGATGTGCCGAAAGCGGACGTCATTGTCACTAACCCGACGCACTATTCCGTGGCGCTGC
AGTATGACGAAAACAAAATGAGCGCGCCGAAAGTGGTCGCGAAGGGGGCTGGATTAATAGCGCTGCGCATTCGCGAG
ATCGGCGCTGAACATCGGGTTCCCACTTTAGAAGCGCCGCCGC。
Above-mentioned each primer is to can individually pack, it is also possible to is made into PCR and detects liquid.In described PCR detection liquid, above-mentioned primer exists
Concentration in the final system of multiplex PCR is 80nM.
It is to say, the test kit of the present invention, can be each primer pair containing above-mentioned independent packaging, it is also possible to be containing
The PCR containing each primer pair configured detects liquid.
Further, described test kit can also contain sterilized water (ddH2O), dNTP, PCR buffer, rTaq enzyme, sample
Product extracting genome DNA reagent etc..
Embodiment 3 test kit detects the special of Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and Salmonella dublin
Property identify
Use three groups of primers pair in test kit described in embodiment 2, with the base of different serotypes salmonella He other antibacterial
Because group is respectively template, multiple PCR method detection Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and Salmonella dublin
Specificity.
PCR reaction system is (25 μ L): dNTP 2 μ L, 10 × PCR buffer 2.5 μ L, tcpS-F 80nM, tcpS-R
80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, template 2 μ L, rTaq enzyme
0.25 μ L, ddH2O mends to 25 μ L.
PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30 circulations；72℃10min.
PCR primer carries out 1% agarose gel electrophoresis, and PCR electrophoresis result shows with Salmonella enteritidis genome as template
Swimming lane amplifiable go out three bands, respectively tcpS gene (882bp), lygD gene (339bp), flhBinner fragment
(155bp)；With Pullorum Disease and Salmonella gallinarum genome, the swimming lane as template only expands a band, for tcpS gene；With all
Berlin salmonella genome be the swimming lane of template amplifiable go out two bands, respectively tcpS gene, flhBinner fragment (Fig. 2).
Show, with tcpS, lygD and flhBinner amplimer specific in test kit described in embodiment 2, multiplex PCR side to be passed through
Whether method Rapid identification the unknown antibacterial is these three serotype salmonella.
Embodiment 4 test kit detection Salmonella enteritidis, Pullorum Disease and Salmonella gallinarum and the spirit of Salmonella dublin
Quick property is identified
Use three groups of primers pair in test kit described in embodiment 2, by Salmonella enteritidis C50041 genome, Pullorum Disease sand
Door bacterium S06004 genome and Salmonella dublin SL5928 genome 10 times of dilutions successively, respectively with the genome that dilutes as mould
Plate, identification kit detection Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and the susceptiveness of Salmonella dublin.
PCR reaction system is (25 μ L): dNTP 2 μ L, 10 × PCR buffer 2.5 μ L, tcpS-F 80nM, tcpS-R
80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, template 2 μ L, rTaq enzyme
0.25 μ L, ddH2O mends to 25 μ L.
PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30 circulations；72℃10min.
PCR primer carries out 1% agarose gel electrophoresis, PCR electrophoresis result show based on tcpS, flhBinner and
The multiple PCR detection kit of flhBinner can detect the Salmonella enteritidis genome of 58.5pg/ μ l, Salmonella Pullorm base
Because of group and Salmonella dublin genome (Fig. 3).
The application on pig farm of embodiment 5 test kit
Use test kit in embodiment 2, detect the salmonella sample that 24 strain pig farms separate, can detect the most respectively
Go out Salmonella enteritidis.Specifically comprise the following steps that
1) separation of salmonella
In this test, sample picks up from pig farm, Jiangsu, the collection of sample, increasing bacterium and the separation of salmonella and Physiology and biochemistry mirror
Fixed with reference in prior art method for building up (Li Y, et al.Food Control, 2016；Cai Y,et al.Int J
Food Microbiol, 2016), this test is divided into from identifying 24 strain salmonella.
2) Salmonella enteritidis in multiple PCR method detection sample
24 strain salmonella are inoculated in LB fluid medium respectively, 37 DEG C of 180rpm incubated overnight, next day, use antibacterial
Genome extracts test kit and extracts the genome of each strain antibacterial, expands tcpS gene, lygD gene with genome for template simultaneously
With flhBinner fragment, PCR reaction system is (25 μ L): dNTP 2 μ L, 10 × PCR buffer 2.5 μ L, tcpS-F
80nM, tcpS-R 80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, mould
Plate 2 μ L, rTaq enzyme 0.25 μ L, ddH2O mends to 25 μ L.PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30
Individual circulation；72℃10min.PCR primer carries out 1% agarose gel electrophoresis, amplifiable go out tcpS gene (882bp), lygD base
Because the swimming lane of (339bp), the band of flhBinner fragment (155bp) three entry is Salmonella enteritidis.Result shows 24 strain sramana
Having 3 strains in bacterium and can be detected simultaneously by this three band, be 9,17 and 21 (Fig. 4) respectively, these salmonella separation strains are enteritis
Salmonella.
3) traditional Serotype Identification of salmonella
The Serotype Identification of the 24 strain salmonella that this test separates is with reference to method for building up (Li Y, et in prior art
al.Food Control,2016；Cai Y, et al.Int J Food Microbiol, 2016), serotype identification results table
Having 3 strain Salmonella enteritidis, respectively 9,17 and 21 in bright 24 strain salmonella, PCR testing result is complete with serotype identification results
Complete consistent.
In the present embodiment, the method using Serotype Identification, the Salmonella enteritidis in 24 strain salmonella is screened,
Need the time of at least 2 days.And use the detection kit of the embodiment of the present invention 2, it is only necessary to and 3 hours, can be by 24 strain sramana
Salmonella enteritidis in bacterium accurately screens, and accuracy is 100%.
Embodiment 6 test kit is in the application of chicken house
Use test kit in embodiment 2, detect the salmonella sample that 24 strain chicken houses separate, intestinal can be detected rapidly and accurately
Scorching salmonella and Pullorum Disease/Salmonella gallinarum.Specifically comprise the following steps that
1) separation of salmonella
In this test, sample picks up from Jiangsu chicken house, the collection of sample, increasing bacterium and the separation of salmonella and Physiology and biochemistry mirror
Fixed with reference in prior art method for building up (Li Y, et al.Food Control, 2016；Cai Y,et al.Int J
Food Microbiol, 2016), this test is divided into from identifying 24 strain salmonella.
2) Salmonella enteritidis and Pullorum Disease and Salmonella gallinarum in multiple PCR method detection sample
24 strain salmonella are inoculated in LB fluid medium respectively, 37 DEG C of 180rpm incubated overnight, next day, use antibacterial
Genome extracts test kit and extracts the genome of each strain antibacterial, expands tcpS gene, lygD gene with genome for template simultaneously
With flhBinner fragment, PCR reaction system is (25 μ L): dNTP 2 μ L, 10 × PCR buffer 2.5 μ L, tcpS-F
80nM, tcpS-R 80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, mould
Plate 2 μ L, rTaq enzyme 0.25 μ L, ddH2O mends to 25 μ L.PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30
Individual circulation；72℃10min.PCR primer carries out 1% agarose gel electrophoresis, amplifiable go out tcpS gene (882bp), lygD base
Because the swimming lane of (339bp), the band of flhBinner fragment (155bp) three entry is Salmonella enteritidis, only amplify tcpS gene
(882bp) swimming lane is Salmonella Pullorm.Result shows that having 5 strains in 24 strain salmonella samples can be detected simultaneously by tcpS base
Cause, lygD gene and flhBinner fragment, be 6,8,17,22 and 24 respectively, and these salmonella are Salmonella enteritidis；Total
11 strains only detect tcpS gene, are 3,5,7,10,12,13,14,16,18,20 and 21 (Fig. 5) respectively, and these salmonella are
Pullorum Disease/Salmonella gallinarum.
3) traditional Serotype Identification of salmonella
The Serotype Identification of the 22 strain salmonella that this test separates is with reference to method for building up (Li Y, et in prior art
al.Food Control,2016；Cai Y, et al.Int J Food Microbiol, 2016), serotype identification results table
Bright 22 strain salmonella have 5 strain Salmonella enteritidis, respectively 6,8,17,22 and 24, has 11 strain Salmonella Pullorm, respectively
Being 3,5,7,10,12,13,14,16,18,20 and 21, PCR testing result is completely the same with serotype identification results.
In the present embodiment, the method using Serotype Identification, by white to the Salmonella enteritidis in 24 strain salmonella and chicken
Dysentery and Salmonella gallinarum screen, and need the time of at least 2 days.And use the detection kit of the embodiment of the present invention 2, only
Need 3 hours, the Salmonella enteritidis in 24 strain salmonella and Pullorum Disease/Salmonella gallinarum accurately can be screened,
And accuracy is 100%.
The application in cattle farm of embodiment 7 test kit
Use test kit in embodiment 2, detect the salmonella sample that 11 strain cattle farms separate, can detect all rapidly and accurately
Berlin salmonella these three serotype.Specifically comprise the following steps that
1) separation of salmonella
In this test, sample picks up from cattle farm, Jiangsu, the collection of sample, increasing bacterium and the separation of salmonella and Physiology and biochemistry mirror
Fixed with reference in prior art method for building up (Li Y, et al.Food Control, 2016；Cai Y,et al.Int J
Food Microbiol, 2016), this test is divided into from identifying 11 strain salmonella.
2) Salmonella dublin in PCR method detection sample
11 strain salmonella are inoculated in LB fluid medium respectively, 37 DEG C of 180rpm incubated overnight, next day, use antibacterial
Genome extracts test kit and extracts the genome of each strain antibacterial, expands tcpS gene, lygD gene with genome for template simultaneously
With flhBinner fragment, PCR reaction system is (25 μ L): dNTP 2 μ L, 10 × PCR buffer 2.5 μ L, tcpS-F
80nM, tcpS-R 80nM, lygD-F 80nM, lygD-R 80nM, flhBinner-F 80nM, flhBinner-R 80nM, mould
Plate 2 μ L, rTaq enzyme 0.25 μ L, ddH2O mends to 25 μ L.PCR program is 94 DEG C of 5min；94 DEG C of 45s, 55 DEG C of 45s, 72 DEG C of 40s, 30
Individual circulation；72℃10min.PCR primer carries out 1% agarose gel electrophoresis, amplifiable go out tcpS gene (882bp),
The swimming lane of the band of flhBinner fragment (155bp) two entry is Salmonella dublin.Result shows in 11 strain salmonella only 7
Number sample is simultaneously containing tcpS gene and flhBinner fragment (Fig. 6), and this salmonella is Salmonella dublin.
3) traditional Serotype Identification of salmonella
The Serotype Identification of the 11 strain salmonella that this test separates is with reference to method for building up (Li Y, et in prior art
al.Food Control,2016；Cai Y, et al.Int J Food Microbiol, 2016), serotype identification results table
Having 1 strain Salmonella dublin in bright 11 strain salmonella, be No. 7 and separate bacterium, PCR testing result is complete with serotype identification results
Unanimously.
In the present embodiment, the method using Serotype Identification, the Salmonella dublin in 11 strain salmonella is filtered out
Come, need the time of at least 2 days.And use the detection kit of the embodiment of the present invention 2, it is only necessary to and 3 hours, can be husky by 11 strains
Salmonella dublin in door bacterium accurately screens, and accuracy is 100%.
In sum, test kit of the present invention is compared to the advantage of tradition Serotype Identification method:
Tradition Serotype Identification need to buy specific salmonella Serotype Identification test kit, expensive, complex steps, especially
It separates specific serotype salmonella (such as Salmonella enteritidis, Pullorum Disease and Salmonella gallinarum or all cypresses in large sample
Woods salmonella) time, need to take considerable time (at least two days), and workload is huge, its result is to be judged by naked eyes, thus
There may be personal error；And the detection method of test kit of the present invention is simple to operate, cost is the lowest, and whole qualification process is three
(comprising PCR and agarose gel electrophoresis) can be completed in hour, and rate of accuracy reached is to 100%.
Therefore, a kind of Rapid identification Salmonella enteritidis, Pullorum Disease and Salmonella gallinarum and the Dublin of the present invention are husky
The multiple PCR detection kit of door bacterium, is conducive to simplifying the conventional procedures of salmonella Serotype Identification, for sieving in great amount of samples
Enteritis, Pullorum Disease/typhoid fever and Dublin serotype salmonella is selected to provide the new method of a kind of Rapid identification.
The principle of above-described embodiment only illustrative present invention and effect thereof, not for limiting the present invention.Any ripe
Above-described embodiment all can be modified under the spirit and the scope of the present invention or change by the personage knowing this technology.Cause
This, have usually intellectual such as complete with institute under technological thought without departing from disclosed spirit in art
All equivalences become are modified or change, and must be contained by the claim of the present invention.
Claims (10)
1. the multiplex PCR detection of a Rapid identification Salmonella enteritidis, Pullorum Disease/Salmonella gallinarum and Salmonella dublin
Test kit, described test kit includes that tcpS gene test primer, lygD gene test primer and flhBinner gene test are drawn
Thing.
Detection kit the most according to claim 1, it is characterised in that described tcpS gene test primer includes nucleotide
Sequence forward primer as shown in SEQ ID NO.1 and nucleotide sequence reverse primer as shown in SEQ ID NO.2.
Detection kit the most according to claim 1, it is characterised in that described lygD gene test primer includes nucleotide
Sequence forward primer as shown in SEQ ID NO.3 and nucleotide sequence reverse primer as shown in SEQ ID NO.4.
Detection kit the most according to claim 1, it is characterised in that described flhBinner gene test primer includes
Nucleotide sequence forward primer as shown in SEQ ID NO.5 and nucleotide sequence reverse primer as shown in SEQ ID NO.6.
Detection kit the most according to claim 1, it is characterised in that described test kit possibly together with sterilized water, dNTP,
One or more in PCR buffer, rTaq enzyme, sample gene group DNA extraction reagent.
Detection kit the most according to claim 1, it is characterised in that described test kit is possibly together with positive control or feminine gender
One or more in comparison.
7. the using method of the detection kit as described in claim 1～6 any claim, comprises the steps:
(1) sample gene group DNA is extracted；
(2) sample-adding: sample gene group DNA, positive control or negative control are separately added into the PCR pipe equipped with PCR reaction system
In, it is thus achieved that corresponding example reaction pipe, positive reaction pipe or negative reaction pipe, containing claim 1 in described PCR reaction system
Described in tcpS gene test primer, lygD gene test primer and flhBinner gene test primer；
(3) PCR reaction: reaction tube is placed in PCR instrument, arranges loop parameter, carries out PCR reaction；
(4) after PCR reaction terminates, analysis result.
Method the most according to claim 7, it is characterised in that described method is the method for non-diseases diagnostic purpose.
9. the detection kit as described in claim 1～6 any claim preparation tcpS gene, lygD gene and
Purposes in flhBinner gene test product.
Purposes the most according to claim 9, it is characterised in that described detection product is for detecting respectively and screening enteritis
Salmonella, Pullorum Disease/Salmonella gallinarum or Salmonella dublin.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610626906.3A CN106244690B (en) | 2016-08-03 | 2016-08-03 | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201610626906.3A CN106244690B (en) | 2016-08-03 | 2016-08-03 | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN106244690A true CN106244690A (en) | 2016-12-21 |
| CN106244690B CN106244690B (en) | 2019-06-18 |
Family
ID=57606145
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201610626906.3A Active CN106244690B (en) | 2016-08-03 | 2016-08-03 | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN106244690B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592241A (en) * | 2019-08-13 | 2019-12-20 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Quadruple fluorescent quantitative PCR (polymerase chain reaction) detection method and detection kit for salmonella |
| CN116121427A (en) * | 2023-03-13 | 2023-05-16 | 中国人民解放军军事科学院军事医学研究院 | Kit for detecting salmonella enteritidis based on fluorescent RPA technology and application thereof |
| CN117987578A (en) * | 2024-04-03 | 2024-05-07 | 北京市动物疫病预防控制中心 | Microfluidic chip for simultaneously detecting pathogenic escherichia coli, salmonella and drug resistance genes and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011212026A (en) * | 2008-07-08 | 2011-10-27 | National Agriculture & Food Research Organization | Quick method for identifying salmonella typhimurium, choleraesuis, enteritidis, dublin, and gallinarum by multiply detecting specific gene |
| CN105648055A (en) * | 2016-01-15 | 2016-06-08 | 江苏省家禽科学研究所 | Multi-PCR detection kit for poultry salmonella and non-diagnostic detection method of poultry salmonella |
-
2016
- 2016-08-03 CN CN201610626906.3A patent/CN106244690B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2011212026A (en) * | 2008-07-08 | 2011-10-27 | National Agriculture & Food Research Organization | Quick method for identifying salmonella typhimurium, choleraesuis, enteritidis, dublin, and gallinarum by multiply detecting specific gene |
| CN105648055A (en) * | 2016-01-15 | 2016-06-08 | 江苏省家禽科学研究所 | Multi-PCR detection kit for poultry salmonella and non-diagnostic detection method of poultry salmonella |
Non-Patent Citations (2)
| Title |
|---|
| ITOH Y等: "Amplification of rfbE and fliC genes by polymerase chain reaction for identification and detection of Salmonella serovar Enteritidis, Dublin and Gallinarum-Pullorum", 《MICROBIOL IMMUNOL》 * |
| 陆广富: "肠炎沙门氏菌的分离鉴定与特异性检测方法的建立", 《中国博士学位论文全文数据库（电子期刊）农业科技辑》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110592241A (en) * | 2019-08-13 | 2019-12-20 | 中国农业科学院上海兽医研究所(中国动物卫生与流行病学中心上海分中心) | Quadruple fluorescent quantitative PCR (polymerase chain reaction) detection method and detection kit for salmonella |
| CN116121427A (en) * | 2023-03-13 | 2023-05-16 | 中国人民解放军军事科学院军事医学研究院 | Kit for detecting salmonella enteritidis based on fluorescent RPA technology and application thereof |
| CN116121427B (en) * | 2023-03-13 | 2024-01-12 | 中国人民解放军军事科学院军事医学研究院 | Kit for detecting salmonella enteritidis based on fluorescent RPA technology and application thereof |
| CN117987578A (en) * | 2024-04-03 | 2024-05-07 | 北京市动物疫病预防控制中心 | Microfluidic chip for simultaneously detecting pathogenic escherichia coli, salmonella and drug resistance genes and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN106244690B (en) | 2019-06-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Cai et al. | Nonculture molecular techniques for diagnosis of bacterial disease in animals: a diagnostic laboratory perspective | |
| Leite et al. | Comparison of fecal DNA extraction kits for the detection of Mycobacterium avium subsp. paratuberculosis by polymerase chain reaction | |
| Ritzmann et al. | Prevalence of Mycoplasma suis in slaughter pigs, with correlation of PCR results to hematological findings | |
| Betancor et al. | Random amplified polymorphic DNA and phenotyping analysis of Salmonella enterica serovar Enteritidis isolates collected from humans and poultry in Uruguay from 1995 to 2002 | |
| Nucera et al. | Comparison of API 20E and invA PCR for identification of Salmonella enterica isolates from swine production units | |
| Ahsani et al. | Clostridium perfringens isolate typing by multiplex PCR | |
| Deng et al. | Comparison of MALDI-TOF MS, gene sequencing and the Vitek 2 for identification of seventy-three clinical isolates of enteropathogens | |
| US11725252B2 (en) | PCR detection kit for rapidly identifying Salmonella of specific serotypes | |
| Afshari et al. | Genotyping of Clostridium perfringens isolated from broiler meat in northeastern of Iran | |
| Zhou et al. | Multiple PCR assay based on the cigR gene for detection of Salmonella spp. and Salmonella Pullorum/Gallinarum identification | |
| CN106244690B (en) | A kind of multiple PCR detection kit of Rapid identification Salmonella enteritidis, white diarrhea/Salmonella gallinarum and Salmonella dublin | |
| Jawad et al. | Outer membrane protein C (ompC) gene as the target for diagnosis of Salmonella species isolated from human and animal sources | |
| CN109957622A (en) | It is a kind of detect duck infectious serositis RPA-LFD visualizing agent box and its application | |
| CN115786543A (en) | Multiplex PCR detection kit for identifying and distinguishing salmonella pullorum and salmonella gallinarum | |
| Tsai et al. | Development of a multiplex polymerase chain reaction to detect five common Gram‐negative bacteria of aquatic animals | |
| CN106086209B (en) | A kind of PCR detection kit of Rapid identification white diarrhea and Salmonella gallinarum | |
| CN109337995B (en) | PCR detection method and kit for eubacterium terrae and subspecies thereof | |
| AU2019100071A4 (en) | Pcr detection kit for rapidly identifying salmonella of specific serotypes | |
| CN108330176B (en) | PCR detection kit for rapidly identifying pullorum/salmonella gallinarum | |
| CN102312013B (en) | Primers and probes for detecting 89K pathogenicity island genes of Streptococcus suis serotype 2, real-time fluorescence quantitative PCR method and kit thereof | |
| CN108048586A (en) | A kind of detection method of ox kind Brucella sp attenuated vaccine strain S19 | |
| CN105112406B (en) | To Hafnia alvei G5897, G5898, G5900 special nucleotide and its application | |
| CN111733266A (en) | PCR detection kit for rapidly detecting salmonella and identifying pullorum/typhoid salmonella and application thereof | |
| CN105154439B (en) | To Hafnia alvei G5902, G5903, G5904, G5906 special nucleotide sequence | |
| Wang et al. | Salmonella typing in New South Wales: current methods and application of improved epidemiological tools |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |