CN112029668A - Xylaria industris strain and sclerotium cultivation method thereof - Google Patents

Abstract

The invention belongs to the field of edible and medicinal fungi, and particularly relates to a Xylaria industris strain and a sclerotium cultivation method thereof. The sclerotium of the xylaria striata is rich in important components (mannitol and adenosine) which are used for measuring the medicinal value of the xylaria striata in pharmacopoeia, and the content of the sclerotium of the xylaria striata is higher than that of a plurality of edible and medicinal fungi reported at present.

Description

Xylaria industris strain and sclerotium cultivation method thereof

Technical Field

The invention belongs to the field of edible and medicinal fungi, and particularly relates to a Xylaria industris strain and a sclerotium cultivation method thereof.

Background

The 2015 patent application of longitudinal stripe Xylaria (Xylaria striata) belongs to Xylariaceae (Xylariaceae), Xylaria (Xylaria) fungi [1] - [3], southwest university of science and technology, yellow and permanent, thunderpest, Yuan-Ching and the like shows that: the xylaria longipes sporophore or alcohol extract has obvious sedative-hypnotic effect, can be used for treating nervous system diseases such as insomnia, anxiety or convulsion, and has good effect. 2019 of Yuan Shijun, Hexinsheng, Yuan Xiaohong, and the like, of the southwest science and technology university, applied for patent "a method for producing a longitudinal striated xylaria sporocarp by using a liquid culture medium", invented is a method for producing the longitudinal striated xylaria sporocarp directly by using the liquid culture medium, and the method has the advantages of simple process, easy implementation and high fungus production efficiency.

There are many kinds of fungi belonging to the genus xylaria, but the research on the fungi belonging to the genus xylaria is relatively late, and 61 kinds of fungi have been reported so far. Most fungi of the genus xylaria have good medical and health care effects, and particularly sclerotium is a traditional Chinese medicine component, and the main chemical components of the sclerotium are active substances such as polysaccharides, nucleosides, cyclic peptides and carboxylic acids, and secondary metabolites such as terpenes, sterols, alkaloids and polyketides. Among them, Xylaria nigripes is the most studied and famous fungus of the genus Xylaria at present, has medicinal and edible values, and is marketed medicines such as capsule for protecting the age and capsule for protecting the life, capsule for black ginseng and the like at present. Xylaria nigripes sclerotia is called Wuling ginseng and is a very expensive traditional Chinese medicine [4 ].

Summary of The Invention

The invention provides a longitudinal stripe xylaria strain and a sclerotium cultivation method thereof, and sclerotium of the strain can be used as a traditional Chinese medicine 'Wuling ginseng'.

The strain xylaria longilineans (xylaria striata) is obtained by field separation and is collected from the forest of the Makechu small seventy Lang community in the Biji town of West mountain area of Kunming, Yunnan province. The strain is subjected to morphological analysis, ITS molecular identification and sclerotium cultivation, is named as Xylaria longissima (YK-4) and belongs to the family of Xylariaceae (Xylariaceae), and the fungus of the genus Xylaria (Xylaria). In 11 days 6 months in 2020, the strain is preserved in China general microbiological culture Collection center (CGMCC), and the preservation number is as follows: CGMCC No. 19660.

The invention provides xylaria striata (xylaria striata), which has the main morphological characteristics and biological characteristics as follows:

the strain is cultured on a PDA-enriched culture medium at 25 ℃ in the dark, and mycelia are white and aerial mycelia are abundant;

the young period of the stroma is yellow-white, the stroma becomes black after being yellow along with the continuous deepening of the growth color, the top end of the stroma is yellow-white, rod-shaped and dense in clusters, and has 1-2 level branches, the 1 st level branch is forked, and the 2 nd level branch is simultaneously divided into 2-11 small branches from one top end to form a general branch (see figure 1);

the stroma has obvious gray alternate longitudinal stripes, the tip is sharp and thin, and the tip is sterile;

sclerotium is strip-shaped or dripping-shaped, the surface is black, and the inner mushroom is white and compact.

According to the invention, the Xylaria longissima strain is collected from Xylaria longissima sporocarp under the forest, and pure cultured mycelia are obtained through tissue separation.

According to the invention, the xylaria longilineans can grow on various mother culture mediums, wherein a PDA-enriched medium (200 g/L of potato, 20g/L of glucose, 20g/L of agar, 3g/L of monopotassium phosphate and 3g/L of peptone, and the pH value is 6.5) is taken as an optimal medium.

According to the invention, the xylaria longilineans is collected from xylaria longilineans sporocarp under forest and is subjected to tissue separation to obtain pure cultured mycelium.

The invention provides a strain of xylaria longipes comprising the ITS sequence SEQ ID No. 3, or having more than 97.0% (e.g. 97.0%, 97.1%, 97.2%, 97.3%, 97.4%, 97.5%, 97.6%, 97.7%, 97.8%, 97.9%, 98.0%, 98.1%, 98.2%, 98.3%, 98.4%, 98.5%, 98.6%, 98.7%, 98.8%, 98.9%, 99.0%, 99.1%, 99.2%, 99.3%, 99.4%, 99.5%, 99.6%, 99.7%, 99.8%, 99.9%) identity to SEQ ID No. 3.

The invention provides a xylaria striata, based on the dry weight of sclerotium, the content of mannitol in the sclerotium is 9.0% -11.7%, which is 2 times of that of wild termitomyces albuminosus, and is obviously higher than wild tricholoma matsutake, bolete and the like; based on the dry weight of sclerotium, the content of adenosine in sclerotium is 0.028% -0.034%, which is higher than 0.023% of the content of adenosine in the wild cordyceps sinensis larva period.

The invention also provides a sclerotium cultivation formula (wt%) of Xylaria striata YK-4: 78% of miscellaneous wood chips, 10% of soil, 5% of rice, 5% of wheat bran, 1% of sugar and 1% of gypsum, and the biological efficiency of the method for cultivating sclerotia by adopting the formula reaches 12.15%, which is the highest level reported at present.

Effects of the invention

The sclerotium of the xylaria striata is rich in important components (mannitol and adenosine) which are used for measuring the medicinal value of the xylaria striata in pharmacopoeia, and the content of the sclerotium of the xylaria striata is higher than that of a plurality of edible and medicinal fungi reported at present.

Brief description of the drawings

In order to more clearly describe the technical solution of the present invention, the following brief description is provided with reference to the accompanying drawings. It should be apparent that these drawings depict only some specific embodiments of the invention herein. The present invention includes, but is not limited to, the following figures:

FIG. 1 shows artificially cultivated longitudinal striated Carlstonia longipes.

Examples

In order to further understand the present invention, the following will clearly and completely describe the technical solutions of the present invention with reference to the specific embodiments of the present invention. It is to be understood that the described embodiments are part, and not all, of the present invention. All variations that can be made by a person skilled in the art on the basis of the embodiments of the invention without inventive step fall within the scope of the invention as claimed.

Example 1

Isolation and preservation of strains

Inoculating the collected wild Xylaria longissima strain into an enriched PDA culture medium in a superclean workbench by a tissue isolation method, carrying out dark culture at a constant temperature of 25 ℃, culturing for 6 days, observing and recording every day, removing polluted culture dishes, and selecting culture dishes with excellent growth vigor as mother seeds. Cut out a hypha square with a length and width of 0.8cm, put into a centrifuge tube filled with sterile distilled water, and store at 4 ℃.

Molecular characterization of Strain YK-4

Adding YK-4 hyphae into a centrifuge tube, and adding a proper amount of liquid nitrogen to grind the hyphae; the extraction method refers to the steps of fungal DNA extraction kit (novel rapid plant genome DNA extraction kit, Bio Take Corporation); and (3) PCR amplification: using genomic DNA of YK-4 as a template, using a forward primer ITS4 (5'-TCCTCCGCTTATTGATATGC-3', SEQ ID NO:1) and a reverse primer ITS5 (5'-GGAAGTAAAAGTCGTAACAAGG-3', SEQ ID NO: 2); the primers were synthesized by Biotechnology engineering (Shanghai) Inc.

PCR reaction system

Reaction procedure

Denaturation at 95 ℃ for 5min, and circulation under 94 ℃ for 30s, annealing at 56 ℃ for 45s, extension at 72 ℃ for 1min, and extension at 72 ℃ for 10min after 35 cycles. After the reaction was completed, detection was performed by 1.0% agarose gel electrophoresis.

Agarose gel electrophoresis method

Weighing lg agarose powder, adding the agarose powder into a conical flask for preparing gel, adding 100ml of 1 XTAE electrophoresis buffer solution, and heating and melting the agarose powder in a microwave oven;

cooling to about 65 ℃, adding nucleic acid dye, mixing uniformly, and pouring into a rubber plate inserted by a comb in advance;

thirdly, after the glue is cooled and solidified, pulling up the comb;

adding 1 XTAE buffer solution into the electrophoresis tank, spotting, and performing electrophoresis for about 30min under the voltage and current of 220V/180A;

and fifthly, observing the PCR product by using a gel imaging system.

ITS sequence sequencing of YK-4 Strain

PCR products with clear target bands are subjected to tapping purification and then sent to Shanghai biological engineering technology company Limited for sequencing, and the ITS sequences of the YK-4 strain are compared and analyzed by using DNAMAN software, MEGA6.0 software and NCBI database online software (https:// blast.

Sequencing

The obtained sequencing result is artificially corrected to obtain a 591bp sequence:

TCCGTAGGTGAACCTGCGGAGGGATCATTAAAGAGTTATCATAACTCCCAAACCCATGTGAACCTACCTTTGTTGCCTCGGCAGGTCTGCAGCTTACCCTGTGAGACCCTACCCTGTAGGGACCTTACCTGGTAGTTGCGGGTAAAGCCTGCCGGTGGTCTACTAAACTCTGTTTACTATGTTATTCTGAATAATATAACTAAATAAGTTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCATTAGTATTCTAGTGGGCATGCCTGTTCGAGCGTCATTTCAACCCTTAAGCCCTTGTTGCTTAGCGTTGGGAGCTTACAGAAACCCTCTGTAGTTCCTTAAAGTTAGTGGCAGAGTTGGTTTCACACTCTAGACGTAGTAAATTTTATCTCGCCTATAGATGAACCGGCCCCTTGCCGTAAAACCCCTTAATTTTTAAAGGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGCCGGAAGGAA(SEQ ID NO:3)

comparative analysis

The ITS sequence of the YK-4 strain is subjected to BLAST comparison in an NCBI database, and the ITS sequence of the YK-4 strain is found to have the highest total score, coverage rate and similarity, respectively 989%, 99% and 96.95%, with Xylaria striata (Xylaria striata) with the accession number GU300089.1, and the strain is identified as the Xylaria striata.

Example 2

Screening of culture formula of sclerotium

Formula 1: 78% of miscellaneous wood dust, 20% of soil, 1% of sugar and 1% of gypsum

And (2) formula: 78% of miscellaneous wood dust, 10% of soil, 5% of rice, 5% of wheat bran, 1% of sugar and 1% of gypsum

And (3) formula: 98% of rice grain culture medium, 1% of gypsum and 1% of sugar

And (4) formula: 78% of corncobs, 20% of soil, 1% of sugar and 1% of gypsum.

The culture materials with the 4 formulas are respectively bottled, wherein the height of each bottle of the culture materials is 6cm, and the average wet weight of each bottle is 100 g. Autoclaving at 121 deg.C for 2 hr, cooling, inoculating, and keeping the inoculum size consistent. The culture conditions were placed in an incubator for culture: culturing at 25 deg.C in dark, culturing with culture medium water content of 65% and indoor culturing humidity of 60%. The results showed that formulation 2 was the most biologically efficient and the growth maturation time was the shortest (see table 1 below).

Table 1:

remarking: biological efficiency is the ratio of the dry weight of the compost to the fresh weight of tremella aurantialba produced.

Determination of active substances of strains

Determination of mannitol

Weighing 0.4g of a sample according to the determination [5] of wuling capsule mannitol in 2015 pharmacopoeia, adding 20ml of water, weighing, heating and refluxing for 2 hours in a water bath pot, taking out and cooling, complementing the weight loss, shaking uniformly and filtering, taking a subsequent filtrate as a sample storage solution, weighing 2ml of the sample storage solution, placing in an iodine bottle, precisely adding 50ml of sodium (potassium) periodate solution, heating for 15 minutes in the water bath pot, taking out and cooling, adding 10ml of potassium iodide test solution, sealing a plug, placing for 5 minutes, titrating by sodium thiosulfate titration solution (0.02mol/L), adding 1ml of starch indicator solution when the endpoint is near, continuing to titrate until blue color disappears, and correcting the titration result by a blank test.

The results show that the content of sclerotium mannitol of the strain YK-4 of the Xylaria longipes (Xylaria striata) reaches 11.7 percent, is 2 times of that of wild termitomyces albuminosus, and is obviously higher than that of fungi such as wild tricholoma matsutake, boletus nigricans and the like [6 ].

Determination of adenosine

Referring to a determination method [5] of adenosine in a pharmacopoeia wuling capsule of 2015 edition, octadecylsilane chemically bonded silica is used as a filling agent; methanol-0.04 mol/L potassium dihydrogen phosphate solution (10: 90) is used as a mobile phase; the detection wavelength is 260nm, and the number of theoretical plates is not less than 2000 calculated according to adenosine peaks. Preparing reference solution, precisely weighing appropriate amount of adenosine reference, and adding water to obtain solution containing adenosine 20 μ g per 1 ml. Measuring by accurately sucking 10 μ l of each of the reference solution and the stock solution of the sample under the item of mannitol respectively, injecting into liquid chromatograph, and measuring.

The results show that the adenosine content in sclerotium of strain YK-4 of Xylaria striata (Xylaria striata) is 0.034%, which is higher than that in the season of wild Cordyceps sinensis larva by 0.023% [7 ].

Reference to the literature

[1] Guo Lin, Chinese mycology (volume fifty-nine), xylaria [ M ]. Beijing, scientific Press, 1992.4-8.

[2] Kong and Xiaolan, 2000, China Macro fungi [ M ]. Zheng, Henan science Press, 2000: 570-575.

[3]Linnaeus C.Flora svecica exhibens plantas per regnum Sueciae crescentes,1745,2.Salvii,Stockholm。

[4] The research progress of Naoshaofeng, Caoyao, Yanglinrey, Zhouyimao, Lirongchun, medicinal xylaria (J) edible medicinal fungi, 2019,27(02) 106 + 111.

[5] Chinese pharmacopoeia [ S ]. one part 2015.

[6] Hushuqin, Zhi Yi, Zhouyao, Shiying, Liu Zhi Ming, colorimetry to determine the mannitol content [ J ] in 15 kinds of edible fungi.

[7] Lu Weijie, Tang Yongfan, Gao Ruan HPLC method to determine the adenosine and cordycepin [ J ] in Cordyceps militaris and common edible fungi, modern medicine and clinical, 2011,26(04): 313-.

SEQUENCE LISTING

<110> Yunan bacterium Vision Biotechnology Co., Ltd

<120> Xylaria industriae strain and sclerotium cultivation method thereof

<130> SPI203422-43

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 20

<212> DNA

<213> Forward primer

<400> 1

tcctccgctt attgatatgc 20

<210> 2

<211> 22

<212> DNA

<213> reverse primer

<400> 2

ggaagtaaaa gtcgtaacaa gg 22

<210> 3

<211> 591

<212> DNA

<213> Artificial sequence

<400> 3

tccgtaggtg aacctgcgga gggatcatta aagagttatc ataactccca aacccatgtg 60

aacctacctt tgttgcctcg gcaggtctgc agcttaccct gtgagaccct accctgtagg 120

gaccttacct ggtagttgcg ggtaaagcct gccggtggtc tactaaactc tgtttactat 180

gttattctga ataatataac taaataagtt aaaactttca acaacggatc tcttggttct 240

ggcatcgatg aagaacgcag cgaaatgcga taagtaatgt gaattgcaga attcagtgaa 300

tcatcgaatc tttgaacgca cattgcgccc attagtattc tagtgggcat gcctgttcga 360

gcgtcatttc aacccttaag cccttgttgc ttagcgttgg gagcttacag aaaccctctg 420

tagttcctta aagttagtgg cagagttggt ttcacactct agacgtagta aattttatct 480

cgcctataga tgaaccggcc ccttgccgta aaacccctta atttttaaag gttgacctcg 540

gatcaggtag gaatacccgc tgaacttaag catatcaaaa gccggaagga a 591

Claims (8)

1. A strain of xylaria longilineata (xylaria striata) having the following main morphological and biological characteristics:

the strain is cultured on a PDA-enriched culture medium at 25 ℃ in the dark, and mycelia are white and aerial mycelia are abundant;

the young period of the stroma is yellow-white, the stroma becomes black after being yellow along with the continuous deepening of the growth color, the top end of the stroma is yellow-white, rod-shaped and dense in clusters, and has 1-2 level branches, the 1 st level branch is forked, and the 2 nd level branch is simultaneously divided into 2-11 small branches from one top end to form a general branch;

the stroma has obvious gray alternate longitudinal stripes, the tip is sharp and thin, and the tip is sterile;

sclerotium is strip-shaped or dripping-shaped, the surface is black, and the inner mushroom is white and compact.

2. A Xylaria industrii strain as claimed in claim 1, which is a pure cultured mycelium obtained by tissue isolation from Xylaria industrii sporocarp under forest.

3. The strain of Xylaria industriae of claim 1 or 2, wherein the PDA-enriched medium comprises potato 200g/L, glucose 20g/L, agar 20g/L, potassium dihydrogen phosphate 3g/L, peptone 3g/L, and pH 6.5.

4. A strain of Xylaria industrii having a sclerotium content of mannitol of 9.0% to 11.7% relative to the dry weight of the sclerotium and an adenosine content of 0.028 to 0.034%.

5. A strain of Xylaria longissima comprising the ITS sequence SEQ ID NO 3 or having more than 97.0% (preferably 97.5%, 98.0%, 98.5%, 99.0%, 99.5%, even 99.9%) identity to SEQ ID NO 3.

6. A longitudinal stripe xylaria strain YK-4 with preservation number of CGMCC No. 19660.

7. A sclerotium breeding method of a strain of xylinum longipes according to any of the preceding claims, comprising the step of breeding in the following sclerotium breeding formula: 78% of miscellaneous wood chips, 10% of soil, 5% of rice, 5% of wheat bran, 1% of sugar and 1% of gypsum.

8. A sclerotium cultivation method as claimed in claim 7, wherein the biological efficiency is up to 12.15%.

Images