CN110343619B - Endophytic fungus capable of promoting height and ground diameter growth of schima superba seedlings in low-phosphorus environment - Google Patents
Endophytic fungus capable of promoting height and ground diameter growth of schima superba seedlings in low-phosphorus environment Download PDFInfo
- Publication number
- CN110343619B CN110343619B CN201910584574.0A CN201910584574A CN110343619B CN 110343619 B CN110343619 B CN 110343619B CN 201910584574 A CN201910584574 A CN 201910584574A CN 110343619 B CN110343619 B CN 110343619B
- Authority
- CN
- China
- Prior art keywords
- schima superba
- phosphorus
- low
- seedlings
- growth
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
Abstract
The invention discloses an endophytic fungus capable of promoting the height and the ground diameter of a seedling of a schima superba under a low-phosphorus environment, wherein MG37 is botryococcus (A)Botryosphaeria sp.) The culture medium has been registered and preserved in China general microbiological culture Collection center (CGMCC) at 8/4 in 2019, and the preservation number is CGMCC No. 17477. The strain is obtained by separating and purifying the roots of the schima superba, can relieve the restriction of phosphorus stress conditions on the growth of the height and the ground diameter of seedlings of the schima superba, and can promote the growth of the height and the ground diameter of the seedlings of the schima superba in a low-phosphorus environment so as to promote the growth of the plants.
Description
Technical Field
The invention belongs to the field of microorganisms, and particularly relates to endophytic fungi capable of promoting the height and the ground diameter of a schima superba seedling to increase in a low-phosphorus environment.
Background
Phosphorus is one of three essential nutrients for plant growth and development, and the lack of phosphorus affects the metabolic processes of plant photosynthesis, matter energy conversion and other vital activities. The soil in south China is generally lack of phosphorus, and the phosphorus in the soil almost exists in an invalid phosphorus mode, so that the part which can be absorbed and utilized by plants is few. Under the low-phosphorus environment, plants can self-evolve a series of response mechanisms to relieve the restriction of insufficient supply of phosphorus on the growth of the plants, such as increasing the absorption and utilization efficiency of available phosphorus in the environment, reducing the consumption of phosphorus in the life process, accelerating the cyclic utilization of the phosphorus and the like.
The schima superba has various excellent characteristics of optimizing forest stand structure, improving soil fertility and the like, so that the planting area of China is continuously enlarged, and the schima superba is an important fire-proof, greening and timber tree species in China. In recent years, due to the increasing demand of the market for the schima superba, the schima superba artificial forest is over developed, and the yield of the schima superba forest is continuously reduced due to the extensive operation mode of the schima superba artificial forest. In addition, because the soil in south China is generally lack of phosphorus, the available phosphorus content for plants to absorb and utilize is very low. Phosphorus is one of three nutrient elements required by plant growth and development, and the insufficient supply of phosphorus hinders the metabolic process of the growth of the schima superba, so that the quality of the schima superba is poor, the yield of forest stand is reduced, and the development scale of artificial schima superba forests is severely limited. Therefore, the method improves the yield and quality of the schima superba forest, solves the problem of low yield and low efficiency of the schima superba forest, and particularly solves the problem that the low-phosphorus environment restricts the growth of schima superba, which is the biggest challenge in the current artificial schima superba forest management process.
Scholars at home and abroad have screened various endophytic fungi with growth promoting and phosphorus removing effects from plants, but the current research mainly focuses on screening related strains of gramineae plants, and the research on woody plants, particularly screening and identifying the endophytic fungi of schima superba is rarely reported. Screening endophytic fungi beneficial to the growth and stress resistance of the schima superba from tissue organs of the schima superba, establishing a schima superba-endophytic fungi symbiotic system so as to obtain the endophytic fungi capable of promoting the growth of the schima superba and improving the stress resistance of the schima superba under low phosphorus stress, and providing data basis and reference basis for enriching strain information of the endophytic fungi of woody plants and for operating and manufacturing biological bacterial fertilizers for artificial forests of the schima superba.
Disclosure of Invention
The invention aims to provide endophytic fungi capable of promoting the height and the ground diameter of a seedling of a schima superba under a low-phosphorus environment.
In order to achieve the purpose, the invention adopts the following technical scheme:
an endophytic fungus for promoting the growth of seedlings and ground diameter of Lobelia procumbens in low-phosphorus environment, wherein the endophytic fungus MG37 is grape-seat cavity fungus: (Botryosphaeria sp.) The culture medium is registered and preserved in China general microbiological culture Collection center (CGMCC) at 8/4 in 2019, and the preservation number is CGMCC 17477. When MG37 was cultured on potato glucose medium (PDA medium), the initial colony became white and the aerial mycelia became luxuriantThe conidiophore is colorless, smooth and thin-walled, has no partition, and has a size of 23.5 +/-2.1 × 5.8.8 +/-0.5 mu m, the optimum temperature for conidiophore formation is about 26-28 ℃, when the temperature reaches above 15 ℃, the conidiophore of the grape-vine-cavity bacterium is nearly spherical, the top of the ascospore shell has a small hole after the ascospore grows mature, and the ascospore contains a long rod-shaped and double-layer-membrane ascospore, and the ascospore contains 8 ascospores, and the ascospore is colorless, has no partition, is nearly fusiform in an oval shape, is widest at the middle or near 1/3 position, and has a size of about 27.3 +/-4.1 × 17.1.1 +/-1.75 mu m.
The strain provided by the invention is obtained by separating and purifying the roots of the schima superba, can be prepared into bacterial liquid, and is used for planting schima superba seedlings in a low-phosphorus environment in a mode of rhizosphere soil pouring or direct seedling inoculation.
The preparation method of the bacterial liquid comprises inoculating the strain into liquid culture medium, culturing for 72 hr with shaking table at constant temperature, and diluting the obtained culture liquid with sterile water to 5.5 × 106L-1And (5) obtaining the product. The formula of the liquid culture medium is as follows: peptone 5.0g, Yeast extract powder 2.0g, glucose (C)6H12O6•H2O) 20.0g, potassium dihydrogen phosphate (KH)2PO4) 1.0g, magnesium sulfate (MgSO)4•7H2O) 0.5g, ultra pure water 1000ml, pH 6.2-6.6.
The strain obtained by the invention can relieve the restriction of phosphorus stress conditions on the growth of plant seedlings and ground diameters, and can promote the growth of the height and ground diameter of the schima superba seedlings in a low-phosphorus environment, thereby promoting the growth of plants.
Drawings
FIG. 1 is a colony morphology of the resulting endophytic fungus MG 37.
Detailed Description
In order to make the present invention more comprehensible, the technical solutions of the present invention are further described below with reference to specific embodiments, but the present invention is not limited thereto.
Example 1 isolation of an endophytic fungus from Schima superba
1. Main instrument equipment
An ultra-clean workbench SW-CJ-1FD, a constant-temperature incubator HH.B11-II, a constant-temperature culture oscillator zwwy-211B, a ten-thousandth balance AR1140, a full-automatic vertical sterilizer LMQ.C-4060, an ultra-pure water machine P60-CW and the like.
2. Primary reagents and culture media
Reagent: 15% sodium hypochlorite, 75% absolute ethyl alcohol, a primer PAGE 11-59bp OD 1-2, DNA electrophoresis loadingbuffer, GoodViewTM nucleic acid dye, 2 xtap PCR MasterMix, a fungus DNA extraction kit and a DNA purification and recovery kit.
Culture medium: (1) improving a martin agar culture medium: peptone 5.0g, Yeast extract powder 2.0g, glucose (C)6H12O6•H2O) 20.0g, potassium dihydrogen phosphate (KH)2PO4) 1.0g, magnesium sulfate (MgSO)4•7H2O) 0.5g, agar 15.0g, and ultrapure water 1000ml, pH 6.2-6.6.
(2) Improving a martin liquid culture medium: peptone 5.0g, Yeast extract powder 2.0g, glucose (C)6H12O6•H2O) 20.0g, potassium dihydrogen phosphate (KH)2PO4) 1.0g, magnesium sulfate (MgSO)4•7H2O) 0.5g, ultra pure water 1000ml, pH 6.2-6.6.
(3) Tricalcium phosphate inorganic phosphorus medium (NBRIP): glucose (C)6H12O6•H2O) 10.0 g, ammonium sulfate ((NH)4)2SO4) 0.5g magnesium sulfate (MgSO)4•7H2O) 0.3 g, sodium chloride (NaCl) 0.3 g, potassium chloride (KCl) 0.3 g, ferrous sulfate (FeSO)4•7H2O) 0.03 g, manganese sulfate (MnSO)4•4H2O) 0.03 g, tricalcium phosphate (Ca)3(PO4)2) 5.0g, agar 18.0g, and distilled water 1000ml, and the pH is 7.0-7.5.
3. Isolation of endophytic fungi
(1) Adopting a tissue separation method, washing the roots of the schima superba by running water, drying in the shade, and then carrying out tissue surface disinfection in a super clean bench, wherein the operation flow is as follows: and (3) sterilizing with 75% absolute ethyl alcohol → cleaning with sterile water for 2-3 times → sterilizing with 15% sodium hypochlorite → cleaning with sterile water for 2-3 times. Cutting off phloem of the sterilized root with sterile blade, cutting into 2mm × 2mm, placing on improved Martin agar culture medium, and culturing at 28 deg.C in dark place.
(2) And (3) verification of the disinfection effect: and (3) coating sterile water for cleaning the sample in the last step of disinfection on an unused improved Martin agar culture medium, and culturing at a constant temperature of 28 ℃ for 4-7 days, wherein if no thallus grows out, the product is disinfected completely. And (3) adopting a tissue blotting method, slightly rolling the sterilized sample tissue on an unused improved Martin agar culture medium or tightly adhering to the culture medium, standing for 5min, taking away the sample tissue as a control, and culturing at the constant temperature of 28 ℃ for 4-7 d, wherein the sample tissue is sterilized if no thallus grows out. Each control was repeated 3 times.
4. Purification of endophytic fungi
After the tissue material is cultured for 3-5 days, hyphae with good growth of bacterial colonies around the tissue are picked by an inoculating needle, the hyphae are respectively purified on a new Martin agar culture medium by a scribing method, the Martin agar culture medium is inverted into a constant temperature incubator, and the Martin agar culture medium is cultured for 4-7 days at a constant temperature and in a dark place. And repeatedly purifying for 3-4 times to obtain the purified strain. Inoculating the purified strain into slant culture medium, and storing at 4 deg.C.
5. Screening for endophytic fungi
(1) Primary screening by a flat plate: inoculating the activated strain on the improved Martin agar culture medium to NBRIP culture medium by three-point inoculation method, and culturing at 28 deg.C for 7 d. Each strain is repeated three times, and strains with the phosphate-solubilizing capability are primarily screened according to the size of a transparent ring in a flat plate.
(2) And (3) shaking a flask for re-screening: 40ml NBRIP liquid medium (containing no agar) was added to a 100ml Erlenmeyer flask and sterilized at high temperature (115 ℃ C., 20 min) for use. The activated strain on the modified Martin agar medium is inoculated into NBRIP liquid medium and cultured for 7d (28 ℃, 180r min-1) by shaking. Sucking 1.5ml of bacterial liquid by using a sterile pipettor, centrifuging the bacterial liquid in a centrifugal tube for 10min (4 ℃, 10000r min < -1 >), taking supernatant, and measuring the effective P content in the bacterial liquid by using a molybdenum blue colorimetric method to obtain the target bacterial strain. Each strain was replicated 3 times, and NBRIP liquid medium without inoculation was used as a control.
6. DNA extraction and characterization of endophytic fungi
6.1 extraction of Total DNA of Strain
Activating test strains by using an improved Martin agar culture medium, and extracting the total DNA of the strains by using an OMEGA genome DNA extraction kit (D3485-01).
6.2 PCR amplification of 18S rDNA of Strain
The ITS sequences are amplified by using fungus 18S rDNA universal primers ITS1 (5 '-TCCGTAGGTGAACCTGCGG-3') and ITRS4 (5 '-TCCTCCGCTTATTGATATGC-3') as positive and negative primers.
25 μ l PCR amplification reaction:
and (3) PCR reaction conditions:
6.3 PCR product recovery
Detecting the PCR amplification product by 1% agarose gel electrophoresis, cutting a target band, purifying and recovering by using a Tiangen recovery kit (DP 214-03), and sequencing.
6.4 Strain 18S rDNA sequence analysis
And submitting the obtained ITS rDNA sequence to an NCBI database for sequence comparison analysis, selecting a sequence with homology of more than 99 percent with Genbank, and preliminarily determining the genus of the strain.
18S rDNA full sequence:
TCGGGCTCGGCCGATCCTCCCACCCTTTGTGTACCTACCTCTGTTGCTTTGGCGGGCCGCGGTCCTCCGCGGCCGCCCCCCTCCCCGGGGGGTGGCCAGCGCCCGCCAGAGGACCATCAAACTCCAGTCAGTAAACGATGCAGTCTGAAAAACATTTAATAAACTAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTCCGAAGGGCATGCCTGTTCGAGCGTCATTACAACCCTCAAGCTCTGCTTGGTATTGGGCACCGTCCTTTGCGGGCGCGCCTCAAAGACCTCGGCGGTGGCGTCTTGCCTCAAGCGTAGTAGAACATACATCTCGCTTCGGAGCGCAGGGCGTCGCCCGCCGGACGAACCTTCTGAACTTTTCTCAAGGTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTTAAGCATATCAATAAGCCGGAGGAAA。
example 2
Preparing bacterial liquid: inoculating the activated phosphate solubilizing bacteria into 40mL improved Martin liquid culture medium, and culturing on constant temperature shaking table for 72h (28 ℃, 160 r.min)-1) Counting the number of spores by a blood counting method, diluting the cultured bacterial liquid into 5.5 × 10 by a tenfold dilution method by sterile water6L-1。
The test adopts a soil culture pot experiment, the seedlings of the schima superba selected in the test are annual seedlings, the average seedling height is 20cm, the average ground diameter is 3.0mm, and the test is provided by scientific research institute of forestry in Fujian province. And selecting the schima superba seedlings with consistent growth vigor for planting in plastic pots with the diameter of 15cm and the height of 10cm on 3 months and 3 days in 2016. The soil required by the experiment is uniformly mixed and weighed, and equal amount (4 kg) of yellow core soil is put into each pot, and the nutrient content in the soil is shown in table 1. After one month of recovery growth, inoculation is started at 3 days 4 months 4 in 2016, and 100mL of bacterial liquid with equal concentration is applied to the rhizosphere soil of the schima superba for 3 consecutive days. Each inoculum treatment was repeated 4 times and blanked with distilled water.
Table 1 unit of soil nutrient status of the substrate: mg/kg
Low phosphorus stress: according to preliminary experiments and related data, KH is used2PO44 phosphorus treatments, 3 replicates each, were designed for phosphate fertilizer, normal stress (16 mg/kg), mild stress (8 mg/kg), moderate stress (4 mg/kg) and severe stress (0 mg/kg). And (3) performing a low-phosphorus stress test at 18 days 4 months in 2016, periodically supplementing potassium fertilizer, nitrogen fertilizer and other trace elements after the stress test to meet the requirements of the growth of the seedlings of the schima superba on nutrient elements, and respectively determining the growth indexes of all the seedlings of the schima superba when the seedlings of the schima superba are stressed to 15 days, 30 days, 45 days, 60 days, 90 days and 120 days.
Measuring the height and the ground diameter of the seedling: the height of the seedling is measured by a steel ruler, and the breast diameter is measured by a digital display vernier caliper. The results are shown in Table 2.
TABLE 2 influence of endophytic fungal infection on the height and diameter growth of seedlings of Schima superba under low phosphorus stress
As can be seen from table 2, the seedling height of the MG37 strain was increased by 13.8%, 25.4%, 28.3% and 48.7% compared with the control treatment under 4 different phosphorus supply conditions, and the difference from the control treatment under 4 stress conditions was significant (P < 0.05); the ground diameter of the strain MG37 treated by the strain is increased by 1.5%, 1.3%, 3.0% and 5.1% respectively compared with that of the control treatment, and the difference between the strain MG37 treated by the strain and the control treatment under severe stress reaches a significant level (P < 0.05). The strain MG37 can relieve the restriction of phosphorus stress conditions on the growth of plant seedlings and ground diameters, and can promote the growth of the plant seedlings and the ground diameters of the schima superba seedlings in a low-phosphorus environment.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fujian agriculture and forestry university
<120> an endophytic fungus capable of promoting the height and the ground diameter growth of a seedling of a schima superba under a low-phosphorus environment
<130>3
<160>3
<170>PatentIn version 3.3
<210>1
<211>19
<212>DNA
<213>Artificial
<400>1
tccgtaggtg aacctgcgg 19
<210>2
<211>20
<212>DNA
<213>Artificial
<400>2
tcctccgctt attgatatgc 20
<210>3
<211>543
<212>DNA
<213>Artificial
<400>3
tcgggctcgg ccgatcctcc caccctttgt gtacctacct ctgttgcttt ggcgggccgc 60
ggtcctccgc ggccgccccc ctccccgggg ggtggccagc gcccgccaga ggaccatcaa 120
actccagtca gtaaacgatg cagtctgaaa aacatttaat aaactaaaac tttcaacaac 180
ggatctcttg gttctggcat cgatgaagaa cgcagcgaaa tgcgataagt aatgtgaatt 240
gcagaattca gtgaatcatc gaatctttga acgcacattg cgccctttgg tattccgaag 300
ggcatgcctg ttcgagcgtc attacaaccc tcaagctctg cttggtattg ggcaccgtcc 360
tttgcgggcg cgcctcaaag acctcggcgg tggcgtcttg cctcaagcgt agtagaacat 420
acatctcgct tcggagcgca gggcgtcgcc cgccggacga accttctgaa cttttctcaa 480
ggttgacctc ggatcaggta gggatacccg ctgaacttaa gcatatcaat aagccggagg 540
aaa 543
Claims (2)
1. An endophytic fungus MG37 capable of promoting the height and the ground diameter of a seedling of a schima superba under a low-phosphorus environment, which is characterized in that: the endophytic fungus MG37 is Staphylococus (A. botrytis:)Botryosphaeria sp.) The culture medium is registered and preserved in China general microbiological culture Collection center (CGMCC) at 8/4 in 2019, and the preservation number is CGMCC 17477.
2. The use of the endophytic fungus MG37 for promoting the height and the ground diameter growth of a schima superba seedling in a low-phosphorus environment according to claim 1 in the cultivation of the schima superba seedling.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910584574.0A CN110343619B (en) | 2019-07-01 | 2019-07-01 | Endophytic fungus capable of promoting height and ground diameter growth of schima superba seedlings in low-phosphorus environment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910584574.0A CN110343619B (en) | 2019-07-01 | 2019-07-01 | Endophytic fungus capable of promoting height and ground diameter growth of schima superba seedlings in low-phosphorus environment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110343619A CN110343619A (en) | 2019-10-18 |
| CN110343619B true CN110343619B (en) | 2020-08-14 |
Family
ID=68177738
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910584574.0A Active CN110343619B (en) | 2019-07-01 | 2019-07-01 | Endophytic fungus capable of promoting height and ground diameter growth of schima superba seedlings in low-phosphorus environment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110343619B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN110894474B (en) * | 2019-12-25 | 2021-06-01 | 福建农林大学 | Endophytic fungus capable of promoting phosphorus absorption of casuarina equisetifolia in low-phosphorus environment |
| CN114437945A (en) * | 2022-03-01 | 2022-05-06 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Hypocrea vinifera MB1 and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1996030502A1 (en) * | 1995-03-30 | 1996-10-03 | Novo Nordisk A/S | Alkaline lipolytic enzyme |
| CN104774955B (en) * | 2015-04-25 | 2016-01-20 | 中华人民共和国北京出入境检验检疫局 | The detection method of a kind of grape seat chamber bacterium |
| CN105695336B (en) * | 2015-12-18 | 2018-10-19 | 漯河医学高等专科学校 | The indigo pigment Botryosphaeria fungi of one plant of production and its printing and dyeing application |
-
2019
- 2019-07-01 CN CN201910584574.0A patent/CN110343619B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110343619A (en) | 2019-10-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103275891B (en) | Endophyte and application thereof | |
| CN113943660B (en) | Talaromyces fungus NJAU-L8 for preventing and controlling continuous cropping soil-borne blight and application thereof | |
| CN104805019B (en) | One plant of endogenetic fungus that can promote aleurite montana Nutrient Absorption | |
| CN116103158B (en) | Disease-resistant growth-promoting mortierella alpina, microbial inoculum containing same and application thereof | |
| CN110343619B (en) | Endophytic fungus capable of promoting height and ground diameter growth of schima superba seedlings in low-phosphorus environment | |
| CN111084011B (en) | Endophytic fungus capable of enhancing activity of casuarina equisetifolia acid phosphatase in low-phosphorus environment | |
| CN106929433B (en) | Phosphate solubilizing penicillium and application thereof | |
| CN112342144A (en) | Aspergillus flavus strain and application thereof | |
| CN110257258B (en) | Endophytic fungus capable of promoting phosphorus absorption of schima superba | |
| CN114164123B (en) | Endophytic fungus S24 capable of promoting growth of China fir | |
| CN111004727B (en) | Endophytic fungus Z1 for increasing biomass of casuarina equisetifolia in high-salt environment | |
| CN114231425A (en) | Phosphorus-dissolving potassium-solubilizing bacterium Aspergillus niger Z8 and application thereof | |
| CN113151008B (en) | Method for improving nutrient utilization efficiency of watermelons by utilizing endophytic fungi | |
| CN115725419A (en) | Phosphorus-dissolving blueberry endophytic trichoderma and application thereof | |
| CN112375691B (en) | Penicillium purpurogenum, application of penicillium purpurogenum as phosphate solubilizing fungus and application of penicillium purpurogenum in promoting growth of corn | |
| CN111040956B (en) | Endophytic fungus Y6 for enhancing oxidation resistance of casuarina equisetifolia in high-salt environment | |
| CN111394256B (en) | Efficient large-scale production and transportation linkage production method for deep-color endophytic fungus liquid | |
| CN104126508A (en) | Rapid mycorrhization method of orchid aseptic seedlings | |
| CN110894474B (en) | Endophytic fungus capable of promoting phosphorus absorption of casuarina equisetifolia in low-phosphorus environment | |
| CN110257259B (en) | Endophytic fungus capable of improving photosynthesis of schima superba | |
| CN102250786B (en) | Inorganic phosphorus dissolving bacterium capable of improving chlorophyll content of eucalyptus | |
| CN115851447B (en) | Endophytic colletotrichum gloeosporioides S28 for promoting phosphorus absorption of fir plants | |
| CN111647516A (en) | Aspergillus RSOPA18 and application thereof in promoting growth of mango seedlings | |
| CN110964666B (en) | Endophytic fungus J12 for promoting growth of casuarina equisetifolia in low-phosphorus environment | |
| AU2020103947A4 (en) | Trichoderma viride, microbial agent, biological fertilizer and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |