CN110257259B - Endophytic fungus capable of improving photosynthesis of schima superba - Google Patents
Endophytic fungus capable of improving photosynthesis of schima superba Download PDFInfo
- Publication number
- CN110257259B CN110257259B CN201910585044.8A CN201910585044A CN110257259B CN 110257259 B CN110257259 B CN 110257259B CN 201910585044 A CN201910585044 A CN 201910585044A CN 110257259 B CN110257259 B CN 110257259B
- Authority
- CN
- China
- Prior art keywords
- schima superba
- strain
- endophytic fungus
- photosynthesis
- fusarium
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01N—PRESERVATION OF BODIES OF HUMANS OR ANIMALS OR PLANTS OR PARTS THEREOF; BIOCIDES, e.g. AS DISINFECTANTS, AS PESTICIDES OR AS HERBICIDES; PEST REPELLANTS OR ATTRACTANTS; PLANT GROWTH REGULATORS
- A01N63/00—Biocides, pest repellants or attractants, or plant growth regulators containing microorganisms, viruses, microbial fungi, animals or substances produced by, or obtained from, microorganisms, viruses, microbial fungi or animals, e.g. enzymes or fermentates
- A01N63/30—Microbial fungi; Substances produced thereby or obtained therefrom
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/14—Fungi; Culture media therefor
- C12N1/145—Fungal isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/645—Fungi ; Processes using fungi
- C12R2001/77—Fusarium
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Health & Medical Sciences (AREA)
- Zoology (AREA)
- Biotechnology (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Microbiology (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Mycology (AREA)
- Dentistry (AREA)
- Botany (AREA)
- Environmental Sciences (AREA)
- Medicinal Chemistry (AREA)
- Tropical Medicine & Parasitology (AREA)
- Plant Pathology (AREA)
- Biomedical Technology (AREA)
- Pest Control & Pesticides (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- Agronomy & Crop Science (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an endophytic fungus capable of improving photosynthesis of schima superba, wherein the endophytic fungus MJ49 is fusarium (Fusarium)Fusarium sp.) The culture medium is registered and preserved in China general microbiological culture Collection center (CGMCC) at 8/4 in 2019, and the preservation number is CGMCC No. 17478. The strain is obtained by separating and purifying the stems of the schima superba, and can obviously improve the photosynthesis of the schima superba, thereby promoting the growth of plants.
Description
Technical Field
The invention belongs to the field of microorganisms, and particularly relates to endophytic fungi capable of improving photosynthesis of schima superba.
Background
The schima superba is an important fire-proof tree species in the south of China, has the characteristics of high quality growth promotion, good afforestation effect, strong adaptability and the like, and is one of main timbers in collective forest areas in the south of China. At present, reports about influences of endophytic fungi on the growth of the schima superba are blank, and the invention screens the endophytic fungi with obvious promoting effect on the growth of the schima superba for enriching the influences of the endophytic fungi on the growth of forest trees.
Disclosure of Invention
The invention aims to provide an endophytic fungus capable of improving photosynthesis of schima superba.
In order to achieve the purpose, the invention adopts the following technical scheme:
an endophytic fungus for improving photosynthesis of Schizophyllum hybridum, wherein the endophytic fungus MJ49 is Fusarium (Fusarium culmorum (Fr.) pers.) (Fusarium culmorum)Fusarium sp.) Has been registered and preserved in China general microbiological culture Collection center at 4 month and 8 months in 2019, and the preservation number is CGMCC number 17478, deposit address: xilu No.1 Hospital No. 3, North Chen, Chaoyang, China. MJ49 has rapid growth speed on PDA, and has vigorous aerial mycelium, flocculence, white to rose red color, and yellow aerial mycelium region sometimes appearing in the middle of old colony, and mycelium has separation and branch; the large microspore has a sickle shape, is gradually thinned towards two ends, has obvious podocytes, and has 3-5 partitions in most spores.
The strain provided by the invention is obtained by separating and purifying the stem of the schima superba, can be prepared into bacterial liquid, and is used for planting schima superba seedlings in a manner of rhizosphere soil pouring or direct seedling inoculation.
The preparation method of the bacterial liquid comprises the following steps: inoculating the strain into liquid culture medium, culturing for 72 hr in shaking table at constant temperature, and diluting the obtained culture solution with sterile water to 5.5 × 106L-1And (5) obtaining the product. The formula of the liquid culture medium is as follows: peptone 5.0g, Yeast extract powder 2.0g, glucose (C)6H12O6•H2O) 20.0g, potassium dihydrogen phosphate (KH)2PO4) 1.0g, magnesium sulfate (MgSO)4•7H2O) 0.5g, ultra pure water 1000ml, pH 6.2-6.6.
Inoculating the bacterial liquid prepared by the endophytic fungi to the seedlings of the schima superba by a pouring method, wherein when the seedlings are inoculated for 120 days, the initial fluorescence (Fo) of the plants treated by the strain MJ49 is reduced by 3.1 percent compared with that of the plants treated by a control; the strain MJ49 treated plants showed a 13% increase in maximal fluorescence (Fm) over the control treatment; the strain MJ49 treated plants showed a 17% increase in variable fluorescence (Fv) over the control treatment; the Fv/Fm value of the strain MJ49 treated plant is improved by 4 percent compared with that of the control treatment; compared with the Fv/F0 value treated by the contrast, the plant treated by the strain MJ49 is improved by 22 percent, and the endophytic strain is proved to be capable of improving the photosynthesis of the schima superba so as to promote the growth of the plant.
Drawings
FIG. 1 is a colony morphology map of the resulting endophytic fungus MJ 49.
Detailed Description
In order to make the present invention more comprehensible, the technical solutions of the present invention are further described below with reference to specific embodiments, but the present invention is not limited thereto.
Example 1 isolation of an endophytic fungus from Schima superba
1. Main instrument equipment
An ultra-clean workbench SW-CJ-1FD, a constant-temperature incubator HH.B11-II, a constant-temperature culture oscillator zwwy-211B, a ten-thousandth balance AR1140, a full-automatic vertical sterilizer LMQ.C-4060, an ultra-pure water machine P60-CW and the like.
2. Primary reagents and culture media
Reagent: 15% sodium hypochlorite, 75% absolute ethyl alcohol, a primer PAGE 11-59bp OD 1-2, a DNA electrophoresis loading buffer, a GoodViewTM nucleic acid dye, a 2 xtap PCR MasterMix, a fungus DNA extraction kit and a DNA purification recovery kit.
Culture medium: (1) improving a martin agar culture medium: peptone 5.0g, Yeast extract powder 2.0g, glucose (C)6H12O6•H2O) 20.0g, potassium dihydrogen phosphate (KH)2PO4) 1.0g, magnesium sulfate (MgSO)4•7H2O) 0.5g, agar 15.0g, and ultrapure water 1000ml, pH 6.2-6.6.
(2) Improving a martin liquid culture medium: peptone 5.0g, Yeast extract powder 2.0g, glucose (C)6H12O6•H2O) 20.0g, potassium dihydrogen phosphate (KH)2PO4) 1.0g, magnesium sulfate (MgSO)4•7H2O) 0.5g, ultra pure water 1000ml, pH 6.2-6.6.
3. Isolation of endophytic fungi
(1) Adopting a tissue separation method, washing the woody lotus stems by running water, drying in the shade and then carrying out tissue surface disinfection in a super clean bench, wherein the operation flow is as follows: and (3) sterilizing with 75% absolute ethyl alcohol → cleaning with sterile water for 2-3 times → sterilizing with 15% sodium hypochlorite → cleaning with sterile water for 2-3 times. Cutting phloem of the sterilized stem with sterile blade, cutting into 2mm × 2mm, placing on improved Martin agar culture medium, and culturing at 28 deg.C in dark place.
(2) And (3) verification of the disinfection effect: and (3) coating sterile water for cleaning the sample in the last step of disinfection on an unused improved Martin agar culture medium, and culturing at a constant temperature of 28 ℃ for 4-7 days, wherein if no thallus grows out, the product is disinfected completely. And (3) adopting a tissue blotting method, slightly rolling the sterilized sample tissue on an unused improved Martin agar culture medium or tightly adhering to the culture medium, standing for 5min, taking away the sample tissue as a control, and culturing at the constant temperature of 28 ℃ for 4-7 d, wherein the sample tissue is sterilized if no thallus grows out. Each control was repeated 3 times.
4. Purification of endophytic fungi
After the tissue material is cultured for 3-5 days, hyphae with good growth of bacterial colonies around the tissue are picked by an inoculating needle, the hyphae are respectively purified on a new improved Martin agar culture medium by a scribing method, the strains are placed in a constant temperature incubator upside down, and the strains are cultured for 4-7 days at a constant temperature and in a dark place. And repeatedly purifying for 3-4 times to obtain the purified strain. Inoculating the purified strain into slant culture medium, and storing at 4 deg.C.
5. DNA extraction and identification of Schima superba endophytic fungi
5.1 extraction of Total DNA of Strain
Activating test strains by using an improved Martin agar culture medium, and extracting the total DNA of the strains by using an OMEGA genome DNA extraction kit (D3485-01).
5.2 PCR amplification of 18S rDNA of Strain
The ITS sequences are amplified by using fungus 18S rDNA universal primers ITS1 (5 '-TCCGTAGGTGAACCTGCGG-3') and ITRS4 (5 '-TCCTCCGCTTATTGATATGC-3') as positive and negative primers.
25 μ l PCR amplification reaction:
and (3) PCR reaction conditions:
5.3 PCR product recovery
Detecting the PCR amplification product by 1% agarose gel electrophoresis, cutting a target band, purifying and recovering by using a Tiangen recovery kit (DP 214-03), and sequencing.
5.4 Strain 18S rDNA sequence analysis
And submitting the obtained ITS rDNA sequence to an NCBI database for sequence comparison analysis, selecting a sequence with homology of more than 99 percent with Genbank, and preliminarily determining the genus of the strain.
The 18S rDNA full sequence is:
TGCGGAGGGATCATTACCGAGTTTACAACTCCCAAACCCCTGTGAACATACCAATTGTTGCCTCGGCGGATCAGCCCGCTCCCGGTAAAACGGGACGGCCCGCCAGAGGACCCCTAAACTCTGTTTCTATATGTAACTTCTGAGTAAAACCATAAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCTCGGGTTTGGTGTTGGGGATCGGCGAGCCCTTGCGGCAAGCCGGCCCCGAAATCTAGTGGCGGTCTCGCTGCAGCTTCCATTGCGTAGTAGTAAAACCCTCGCAACTGGTACGCGGCGCGGCCAAGCCGTTAAACCCCCAACTTCTGAATGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAAGCATATCAAAAGCCGGGAGGAAA。
example 2
Preparing bacterial liquid: inoculating the activated endophytic fungi into 40mL improved Martin liquid culture medium, and culturing on constant temperature shaking table for 72h (28 deg.C, 160 r.min)-1). Counting the number of spores by a blood counting method, diluting the cultured bacterial liquid into 5.5 × 10 by a tenfold dilution method by sterile water6L-1。
The test adopts a soil culture pot experiment, the seedlings of the schima superba selected in the test are 1-year-old seedlings, the average seedling height is 20cm, the average ground diameter is 3.0mm, and the test is provided by scientific research institute of forestry in Fujian province. And selecting the schima superba seedlings with consistent growth vigor for planting in plastic pots with the diameter of 15cm and the height of 10cm on 3 months and 3 days in 2016. The soil required by the test is uniformly mixed and weighed, and each pot is filled with red heart soil with the same amount (4 kg). After one month of recovery growth, inoculation is started at 3 days 4 months 4 in 2016, and 100mL of strain spore solution with equal concentration is continuously applied to the rhizosphere soil of the schima superba for 3 days. Each inoculum treatment was repeated 4 times and blanked with distilled water.
Chlorophyll fluorescence parameters were measured in the clear and cloudy morning (8: 00-11: 00) after inoculation at 60 d, 90 d, 120d using an Os-5p model portable pulse modulated chlorophyll fluorometer (Opti-science, usa). And selecting the leaves which are completely unfolded on the sunward branches and basically consistent in growth, carrying out dark adaptation for 25-30 min by using a dark reaction clamp, and then measuring the initial fluorescence (F0), the maximum fluorescence (Fm) and the maximum photochemical efficiency (Fv/Fm) of the leaves to be detected. And the potential photochemical efficiencies of variable fluorescence (Fv) and PS II (Fv/F0) were calculated. Each treatment was measured 3-4 times, and the average value was taken. The results are shown in Table 1.
TABLE 1 initial fluorescence (F) of Homalomena seedlings by endophytic fungio) Maximum fluorescence (F)m) Variable fluorescence (F)v) Maximum photochemical efficiency (F)v/Fm) And potential photochemical efficiency (F)v/F0) Influence of (2)
As can be seen from table 1, strain MJ49 treated plants showed a 3.1% reduction in initial fluorescence (Fo) when inoculated for 120d compared to control treatment; the strain MJ49 treated plants showed a 13% increase in maximal fluorescence (Fm) over the control treatment; the strain MJ49 treated plants showed a 17% increase in variable fluorescence (Fv) over the control treatment; the Fv/Fm value of the strain MJ 49-treated plant is improved by 4 percent compared with that of the control-treated plant; compared with the Fv/F0 value of the control treatment, the value of the plant treated by the strain MJ49 is improved by 22 percent, and the strain MJ49 is proved to be capable of improving the photosynthesis of the schima superba.
The above description is only a preferred embodiment of the present invention, and all equivalent changes and modifications made in accordance with the claims of the present invention should be covered by the present invention.
SEQUENCE LISTING
<110> Fujian agriculture and forestry university
<120> an endophytic fungus capable of improving photosynthesis of schima superba
<130> 3
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 19
<212> DNA
<213> Artificial
<400> 1
tccgtaggtg aacctgcgg 19
<210> 2
<211> 20
<212> DNA
<213> Artificial
<400> 2
tcctccgctt attgatatgc 20
<210> 3
<211> 547
<212> DNA
<213> Artificial
<400> 3
tgcggaggga tcattaccga gtttacaact cccaaacccc tgtgaacata ccaattgttg 60
cctcggcgga tcagcccgct cccggtaaaa cgggacggcc cgccagagga cccctaaact 120
ctgtttctat atgtaacttc tgagtaaaac cataaataaa tcaaaacttt caacaacgga 180
tctcttggtt ctggcatcga tgaagaacgc agcaaaatgc gataagtaat gtgaattgca 240
gaattcagtg aatcatcgaa tctttgaacg cacattgcgc ccgccagtat tctggcgggc 300
atgcctgttc gagcgtcatt tcaaccctca agccctcggg tttggtgttg gggatcggcg 360
agcccttgcg gcaagccggc cccgaaatct agtggcggtc tcgctgcagc ttccattgcg 420
tagtagtaaa accctcgcaa ctggtacgcg gcgcggccaa gccgttaaac ccccaacttc 480
tgaatgttga cctcggatca ggtaggaata cccgctgaac ttaagcatat caaaagccgg 540
gaggaaa 547
Claims (2)
1. An endophytic fungus capable of improving photosynthesis of schima superba, which is characterized in that: the endophytic fungus MJ49 is Fusarium (F.) (Fusarium sp.) The culture medium is registered and preserved in China general microbiological culture Collection center (CGMCC) at 8/4 in 2019, and the preservation number is CGMCC No. 17478.
2. Use of the endophytic fungus of claim 1 for enhancing photosynthesis of schima superba in schima superba seedling planting.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910585044.8A CN110257259B (en) | 2019-07-01 | 2019-07-01 | Endophytic fungus capable of improving photosynthesis of schima superba |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201910585044.8A CN110257259B (en) | 2019-07-01 | 2019-07-01 | Endophytic fungus capable of improving photosynthesis of schima superba |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN110257259A CN110257259A (en) | 2019-09-20 |
| CN110257259B true CN110257259B (en) | 2020-11-13 |
Family
ID=67923607
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201910585044.8A Active CN110257259B (en) | 2019-07-01 | 2019-07-01 | Endophytic fungus capable of improving photosynthesis of schima superba |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN110257259B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103173360B (en) * | 2013-03-05 | 2014-07-30 | 福建农林大学 | Endophytic fungus increasing casuarina equisetifolia chlorophyll content |
-
2019
- 2019-07-01 CN CN201910585044.8A patent/CN110257259B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN110257259A (en) | 2019-09-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110200018B (en) | Optimal DSE inoculation amount for promoting plant rooting | |
| CN113881571B (en) | Method for rapidly separating and quantitatively detecting banana fusarium wilt and application | |
| CN110343619B (en) | Endophytic fungus capable of promoting height and ground diameter growth of schima superba seedlings in low-phosphorus environment | |
| CN112574894B (en) | Nematicidal Israeli fungus and application thereof | |
| CN111084011B (en) | Endophytic fungus capable of enhancing activity of casuarina equisetifolia acid phosphatase in low-phosphorus environment | |
| CN106929433B (en) | Phosphate solubilizing penicillium and application thereof | |
| CN106635839B (en) | Method for separating fuscoporia longata from soil | |
| CN110257259B (en) | Endophytic fungus capable of improving photosynthesis of schima superba | |
| CN111373899A (en) | Method for promoting growth and development of plant seedlings by soaking seeds with dark-color endophytic fungi | |
| CN111004727B (en) | Endophytic fungus Z1 for increasing biomass of casuarina equisetifolia in high-salt environment | |
| CN114032182B (en) | Fungus with functions of antagonizing pathogenic bacteria of garlic root rot and promoting growth | |
| CN114164123B (en) | Endophytic fungus S24 capable of promoting growth of China fir | |
| CN110560469A (en) | Method for restoring uranium-cadmium combined polluted soil by using uranium-cadmium-resistant fungi enhanced plants | |
| CN111394256B (en) | Efficient large-scale production and transportation linkage production method for deep-color endophytic fungus liquid | |
| CN110257258B (en) | Endophytic fungus capable of promoting phosphorus absorption of schima superba | |
| CN115851479A (en) | Bacterium with antagonistic effect on botrytis cinerea and application thereof | |
| CN111040956B (en) | Endophytic fungus Y6 for enhancing oxidation resistance of casuarina equisetifolia in high-salt environment | |
| CN114292759A (en) | Fusarium oxysporum with effect of preventing and treating continuous cropping obstacle of tobacco | |
| EP3982736A1 (en) | Inoculum, a method of preparing inoculum and a method of biotization of american blueberry | |
| CN110894474B (en) | Endophytic fungus capable of promoting phosphorus absorption of casuarina equisetifolia in low-phosphorus environment | |
| CN115851447B (en) | Endophytic colletotrichum gloeosporioides S28 for promoting phosphorus absorption of fir plants | |
| CN114317371B (en) | Rice blast biocontrol growth promoting bacteria and application thereof | |
| CN109370953B (en) | Juemina rhizobium JYN6 and application thereof | |
| CN110964666B (en) | Endophytic fungus J12 for promoting growth of casuarina equisetifolia in low-phosphorus environment | |
| CN109337847B (en) | Cassia rhizobium TXR2 and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |