CN111893178A - Genetic reference material for alpha thalassemia gene detection and preparation method thereof - Google Patents
Genetic reference material for alpha thalassemia gene detection and preparation method thereof Download PDFInfo
- Publication number
- CN111893178A CN111893178A CN202010860247.6A CN202010860247A CN111893178A CN 111893178 A CN111893178 A CN 111893178A CN 202010860247 A CN202010860247 A CN 202010860247A CN 111893178 A CN111893178 A CN 111893178A
- Authority
- CN
- China
- Prior art keywords
- gene
- genetic reference
- reference substance
- genetic
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/795—Porphyrin- or corrin-ring-containing peptides
- C07K14/805—Haemoglobins; Myoglobins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/80—Vectors or expression systems specially adapted for eukaryotic hosts for fungi
- C12N15/81—Vectors or expression systems specially adapted for eukaryotic hosts for fungi for yeasts
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/905—Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Abstract
The invention relates to the technical field of biology, and particularly discloses a genetic reference substance for alpha thalassemia gene detection and a preparation method thereof. The genetic reference substance is a yeast cell with a genetic reference substance gene required for detecting the alpha thalassemia gene inserted into the URA3 gene. According to the invention, yeast cells are selected as background and carrier of genetic mutation, and by utilizing the advantages of convenient preservation and culture, simple genetic operation, high homologous recombination efficiency, convenient counting and calculation of genome DNA copy number and the like, the genetic reference substance for alpha thalassemia gene detection is prepared by targeting the URA3 gene in combination with the CRISPR/Cas9 technology, and can achieve consistency with human cell sample treatment operation through protoplast.
Description
Technical Field
The invention relates to the technical field of biology, in particular to a genetic reference material for alpha thalassemia gene detection and a preparation method thereof.
Background
Thalassemia is the most common genetic disease with the greatest harm in southern areas of China, and an effective treatment method for the thalassemia is not available, so that the development of a gene diagnosis technology for clinical and prevention becomes a first choice measure, and the thalassemia has important clinical significance. The gene detection is increasingly becoming the gold standard for diagnosing the thalassemia, and the genetic reference substance is indispensable for the gene detection, can provide negative and positive controls for the gene detection experiment, and ensures the accuracy and reliability of the experiment result. The genetic reference substance of the thalassemia can be used for negative and positive quality control products of gene detection of the thalassemia, and daily quality control and performance evaluation of a detection process, so that an experimental basis is further laid for the research of gene diagnosis and screening technology of the thalassemia.
The genetic detection standards which are commonly used at present are as follows: (1) pathological tissues obtained by patient operation and puncture, and patient peripheral blood samples containing circulating tumor cells; (2) immortalized cell lines derived from patients with genetic diseases and tumors, and commercial cell lines; cell lines obtained by genetic engineering, etc.; (3) recombinant plasmid containing mutation site and nearby sequence or PCR product (4). Analyzing the advantages and the disadvantages of the existing genetic reference standard, the patient sample is found to be closest to the form of the detection sample and has a definite genetic background, but because the sample quantity is precious, the acquisition is inconvenient, the uniformity is not good, and the standard cannot be prepared in a large quantity; the cell sample is also relatively close to the form of a clinical sample, the pretreatment and extraction methods are similar, but the requirement on establishing and storing conditions of an immortalized cell line is high, the construction and screening process of a genetically modified cell line is complex, and homozygous and heterozygous mutation types need to be distinguished; the plasmid and PCR product construction process is simple and quick, is not limited by rare mutation samples, but the higher copy number concentration of the samples easily causes diffusion and pollution among different genotypes, and causes false positive of experimental results; also, synthetic DNA samples are readily available and are not limited by rare mutant samples. But the difference from clinical samples is large, and the quantitative determination of the value is difficult.
Disclosure of Invention
In view of the above, the present invention aims to provide a genetic reference substance for detecting α thalassemia genes, which uses yeast cells as genetic background, is convenient to store and culture, is simple in genetic operation, and simultaneously is easy to count the yeast cells, homozygous mutant individuals can be directly obtained by modifying haploid yeast cells, different genetic types can be obtained by fusing haploid or diploid yeast cells, and a standard substance of the genetic reference substance with precise ratio can be obtained by mixing different proportions of wild haploid yeast and mutant type in a counting manner;
it is another object of the present invention to provide a method for producing the above-mentioned reference substance, which is efficient in homologous recombination.
In order to achieve the purpose, the invention provides the following technical scheme:
a genetic reference material for alpha thalassemia gene detection is a yeast cell with a genetic reference material gene required by alpha thalassemia gene detection inserted into a URA3 gene.
According to the invention, yeast cells are selected as background and carrier of genetic mutation, and by utilizing the advantages of convenient preservation and culture, simple genetic operation, high homologous recombination efficiency, convenient counting and calculation of genome DNA copy number and the like, the genetic reference substance for alpha thalassemia gene detection is prepared by targeting the URA3 gene in combination with the CRISPR/Cas9 technology, and can achieve consistency with human cell sample treatment operation through protoplast.
Preferably, the genetic reference material gene required for the alpha thalassemia gene detection can be selected according to actual detection requirements, such as preparation of negative standard or standard with different mutation ratio, and the like, and in the specific embodiment of the invention, the genetic reference material gene is thalassemia gene alpha 1 and/or thalassemia gene alpha 2, and the two genes are inserted simultaneously or alternatively according to different copy number types.
Preferably, the yeast cell of the present invention is a Saccharomyces cerevisiae cell, and in the present embodiment Saccharomyces cerevisiae W303-1A is selected.
The engineered yeast species (i.e., the genetic reference material of the present invention) was maintained at-80 ℃ with 20% glycerol. The extraction and use of the genome DNA can be carried out after the snail enzyme is used for enzymolysis of the yeast cell wall. The gene mutation standard products with different mutation ratios can be prepared by protoplast processing, counting and mixing of the yeast.
Therefore, the invention also provides application of the genetic reference substance in preparing alpha thalassemia gene standard products with different mutation ratios or application in preparing a kit for detecting alpha thalassemia genes.
In addition, the invention also provides a preparation method of the genetic reference substance, which comprises the steps of utilizing a CRISPR/Cas9 gene editing system to break the URA3 gene in a yeast cell, and then inserting the gene of the genetic reference substance required by the detection of the alpha thalassemia gene at the broken position by constructing an upstream homologous arm and a downstream homologous arm.
Preferably, the preparation method comprises the following steps:
step 1, searching a PAM sequence in URA3 gene in a yeast cell as a guide RNA target site, and taking a 20-base sequence at the upstream of the PAM sequence as a protospacer sequence; designing two reverse complementary primers according to a protobeacons sequence, wherein one primer sequence is the protobeacons sequence, forming a completely complementary double-stranded DNA by the two reverse complementary primers, and assembling the double-stranded DNA with a first carrier in an enzyme digestion manner to obtain a guide RNA plasmid;
designing an upstream and a downstream homology arms based on a guide RNA target site, inserting the upstream and the downstream homology arms into a multiple cloning site of a second vector in a molecular cloning mode, wherein an enzyme cutting site is required to be reserved between the upstream and the downstream homology arms for connecting a genetic reference substance gene required by alpha thalassemia gene detection;
designing upstream and downstream amplification primers according to the genetic reference substance gene, adding the reserved enzyme cutting sites at two ends of the amplification primers, amplifying by using a template containing the genetic reference substance gene to obtain the genetic reference substance gene with the reserved enzyme cutting sites, and inserting the genetic reference substance gene into a second vector in an enzyme cutting mode;
and 2, transferring the plasmid for expressing the Cas9, the guide RNA plasmid and the second vector inserted with the homology arm and the genetic reference substance gene into a yeast cell for homologous recombination, and then verifying after culturing to obtain the genetic reference substance.
In a specific embodiment of the invention, the PAM sequence is 371-373bp sequence of URA3 gene (SEQ ID NO: 1) in yeast cells, and the protospacers sequence is 351-370bp sequence.
In the process of preparing the genetic reference substance, three nucleotide RNA target sites of protospacers + PAM in URA3 gene are selected, and the result shows that only the target site determined by the invention has higher editing efficiency of 30 percent, and the editing efficiency of the other two target sites is only 13 percent and 0 percent, which indicates that the nucleotide RNA target site determined by the invention and the nucleotide RNA plasmid prepared by the nucleotide RNA target site have higher editing efficiency and can provide homologous recombination efficiency in the process of preparing the genetic reference substance.
In the preparation process, the plasmid for expressing Cas9 can be used independently, or the sequence for expressing Cas9 can be inserted into a first vector and is expressed together with a guide RNA plasmid, so that the method is more convenient and quicker, for example, a commercial shuttle vector p425-Sap-TEF1p-Cas9-CYC1t-2xSap is adopted as the first vector in the specific embodiment of the invention;
in a specific embodiment of the invention, the second vector is the commercial vector pBluescript (i.e., PSK plasmid), the multiple cloning site of which is shown in FIG. 1.
When the invention is used for verifying the single clone, the URA3 gene of the yeast can be selected as an amplification upstream primer, and the genetic reference substance gene knocked into the yeast cell can be selected as an amplification downstream primer, and PCR identification is carried out by Taq enzyme.
The genetic reference substance and the preparation method thereof have the following advantages:
1. the gene operation of yeast cells is simpler and faster, and the culture and DNA extraction methods are simple and easy to implement;
2. the genetically modified yeast cell can be stably inherited, amplified and stored;
3. the yeast cells are easy to count, homozygous mutation individuals can be directly obtained by modifying the haploid yeast cells, and different genetic types can be obtained by fusing the haploid or diploid yeast cells;
4. yeast cells can accommodate larger fragments of exogenous DNA, including artificially synthesized chromosomes;
5. the haploid yeast wild and mutant can be mixed in different proportions to obtain a standard substance with accurate proportion in a counting mode;
6. the preparation process has high homologous recombination efficiency by selecting a proper guide RNA target site.
Drawings
FIG. 1 shows a multiple cloning site map of the commercial vector pBluescript.
Detailed Description
The invention discloses a genetic reference material for alpha thalassemia gene detection and a preparation method thereof, and a person skilled in the art can realize the genetic reference material by appropriately improving process parameters by referring to the content. It is expressly intended that all such similar substitutes and modifications which would be obvious to one skilled in the art are deemed to be included in the invention. While the genetic reference materials and methods of making the same of the present invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the art that variations or appropriate modifications and combinations of the promoters and strains described herein may be made to implement and utilize the techniques of the present invention without departing from the spirit, scope and spirit of the invention.
Regarding the selection of the safe site of the s.cerevisiae genome, the URA3 gene encodes orotidine-5 phosphate decarboxylase, which is a key enzyme in the process of yeast RNA pyrimidine nucleotide synthesis. If orotidine-5 phosphate decarboxylase is inactivated, the yeast cannot grow and shows uridine or uracil auxotrophy and 5-FOA acid-resistant phenotype. Therefore, URA3 gene is widely used as a nutritional deficiency screening marker in yeast molecular genetics research. As long as the medium is supplemented with uridine or uracil in the medium, the yeast can grow normally; knocking out URA3 gene and inserting exogenous fragment into it will not affect normal growth of yeast, so URA3 is selected as safe site for insertion of exogenous gene. The total length of URA3 gene is 804bp, and the sequence is shown as SEQID NO. 1.
The CRISPR/Cas9 gene editing system can efficiently mediate site-directed DNA double strand breaks, usually activates repair of a non-homologous end joining mechanism (NHEJ) in cells, and introduces non-target insertions, deletions and other mutations (indels), which is widely used for gene knockout. The DNA double-strand break can also be repaired by a homologous recombination mechanism, and when a single-strand or double-strand target gene recombination template is introduced, the specific knock-in mutation can be realized to obtain a genetic reference substance.
The invention is further illustrated by the following examples.
Example 1: selection and design of guide RNA target sites
1) Selection and design of guide RNA target sites
Three gRNAs targeting URA3 were designed at http:// crispr. dbcls. jp/website, guide RNA target sites as follows:
URA-g1: cattacgaatgcacacggtgTGG (351-373 bp in SEQ ID NO:1, PAM for upper case base and protospacers for lower case base);
URA-g2: gttagcagaattgtcatgcaAGG (447-469 bp in SEQ ID NO:1, PAM for upper case base and protospacers for lower case base);
URA-g3: gaagagatgaaggttacgatTGG (569-591 bp in SEQ ID NO:1, PAM for upper case base and protospacers for lower case base);
two reverse complementary primers are designed according to the guide RNA target site, protective bases are added at two ends of the primers, and the sequences of the primers are as follows (the protective bases are three bases at the 5' end):
URA-g1F：+5’ATCcattacgaatgcacacggtg3’
URA-g1R：-5’aacCACCGTGTGCATTCGTAATG 3’
URA-g2F：+5’ATCgttagcagaattgtcatgca 3’
URA-g2R：-5’aacTGCATGACAATTCTGCTAAC 3’
URA-g3F：+5’ATCgaagagatgaaggttacgat 3’
URA-g3R：-5’aacATCGTAACCTTCATCTCTTC 3’
the two ends of the primer are filled to match with the sapI enzyme cutting nick of the p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector. The reverse complementary primers were annealed (20 ul in the annealing system: 2. mu.l of 10xNEB buffer, 5. mu.l of each 100. mu. M F/R) for 5min at 95 ℃ and then slowly cooled to room temperature.
Connecting the p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector digested by the SapI with an annealing product (10 mul of a connecting system contains 10xT4 ligase buffer 1 mul, 50ng of the digestion vector and 1ul of the annealing product) to transform escherichia coli, identifying and obtaining positive clones, extracting the plasmid gRNA1-p425-Sap-TEF1p-Cas9-CYC1t-2xSap by using the kit for a subsequent step, and randomly breaking DNA double strands at the 351-373 position of the gene after transforming the w303-1a yeast. The recombination and repair can be carried out at the gap by the existence of the recombination template in the system after the fracture, thereby achieving the effect of knocking in the target gene.
2) Verification of editing efficiency
Transforming the successfully constructed plasmid into saccharomyces cerevisiae W303-1A by a LiAc method, selecting 5-10 single colonies from each plate, boiling and cracking the single colonies in 0.2% SDS, amplifying URA3 gene, performing electrophoresis detection on a small amount of PCR products, sequencing the positively amplified clones to verify the editing efficiency, and performing gene editing when deletion, insertion, code shift and the like are caused in a gRNA targeting and identifying region, wherein the result is shown in Table 1.
TABLE 1
| Efficiency of editing | |
| URA-g1 | 30％ |
| URA-g2 | 0 |
| URA-g3 | 13％ |
According to the method, URA3-gRNA1 with high editing efficiency is selected for follow-up research according to the rule that the colony growth quantity is in inverse proportion to the editing efficiency.
Example 2: construction of Saccharomyces cerevisiae homologous recombination template
Designing homologous arms based on a targeting cleavage site of a Cas9 system, respectively connecting the upstream homologous arm and the downstream homologous arm into a multiple cloning site region of a pBluescript vector through a molecular cloning method of restriction enzyme digestion or a recombination mode of the homologous arms, and reserving an enzyme digestion site between homologous sequences for connecting a knock-in sequence. The successfully constructed recombinant template is subjected to enzyme digestion or PCR amplification to obtain a double-chain homologous recombination template containing upstream and downstream homologous arms and a target sequence.
Designing homologous arms of a targeting cutting site (guide RNA target site) based on a Cas9 system, wherein the upstream homologous arm is 134bp (214-347 bp in SEQ ID NO: 1), the downstream homologous arm is 141bp (386-526 bp in SEQ ID NO: 1), the upstream homologous arm and the downstream homologous arm are obtained by amplification through amplification primers respectively, then the upstream homologous arm and the downstream homologous arm are respectively connected into EcoRV and NotI enzyme cutting sites of a multiple cloning site region of a pBluescript vector (PSK plasmid) through a molecular cloning method, and a recombinant universal vector PSK-up-down plasmid containing the yeast homologous arm is obtained after successful identification. The amplification primers of the upstream and downstream homology arms are as follows:
F-g1up:5’ggcacagttaagccgctaaagg3’
R-g1up:5’gcccattctgctattctgtatacacc3’
F-g1down:5’AGTTCTAGAGCGGCCGCttgttagcggtttgaagcagg3’
R-g1down:5’ACCGCGGTGGCGGCCGCtgtcgctcttcgcaatgtcaa3’
wherein, vector homology (capitalized base) is added at two ends of an amplification primer of a downstream homology arm, and the vector homology (capitalized base) is inserted into a multiple cloning site in a homologous recombination mode.
When the genetic reference substance gene to be knocked in is amplified, enzyme cutting sites such as EcoRI, XmaI, SmaI, BamHI, XbaI and the like (positioned between the upstream and downstream homologous arms) can be selected, proper enzyme cutting sites and protective bases are added at two ends of an amplification primer, and the amplified fragment is connected into a universal vector inserted into the homologous arms through recombination and enzyme cutting. For example, the EcoRI & XbaI enzymatic cleavage site was used to ligate the genetic reference material gene into a universal vector into which the homology arms had been inserted, using primers for the genetic reference material gene:
F:cgGAATTC[NNNNNNNNNNNNNNNNN]
R:gcTCTAGA[NNNNNNNNNNNNNNNNN]
wherein NN … … N refers to primer sequence on genetic reference substance gene, and is determined according to selected gene, wherein lower case base is protective base, and upper case base is enzyme cutting site;
specifically, taking preparation of a thalassemia gene mutation type plasmid, such as construction of an alpha-thalassemia gene mutation plasmid as an example, by adopting an enzyme digestion connection and recombination method, target genes alpha 1 and alpha 2, namely genetic reference substance genes are sequentially connected into a yeast homologous arm-containing recombinant universal vector psk-up-down plasmid which is digested by corresponding enzyme digestion, firstly, construction of a type with a small copy number is completed, and a type with a large copy number can be constructed on the basis of the former plasmid, so that a required alpha-thalassemia copy number variation type plasmid standard product can be obtained. Wherein the enzyme cutting sites mainly adopted are SmaI, BamHI, ECORI, XbaI, SpeI and the like, and the enzyme cutting sites selected need to be positioned between the upstream and downstream homologous arms of yeast in a recombinant universal vector psk-up-down containing the homologous arms of the yeast.
Example 3: obtaining genetic reference materials
A gRNA1-p425-Sap-TEF1p-Cas9-CYC1t-2xSap plasmid targeting URA3 and the double-stranded homologous recombination template containing the upstream and downstream homology arms and the genetic reference substance gene obtained in example 2 were used to transform yeast by a lithium acetate method. After the culture, the recombination condition of the monoclone is identified by PCR and a first-generation sequencing method.
Lithium acetate (LiAC) conversion system:
1) taking 1ml of bacterial liquid cultured overnight in YPD liquid culture medium, and discarding supernatant at 12000rpm for 30 sec;
2) the cells were resuspended and washed with 1ml of purified water, and the supernatant was discarded at 12000rpm for 30 sec;
3) 1ml of 1 × TE/LiAC heavy suspension washing bacteria, 12000rpm 30sec, completely removed supernatant;
4) adding gRNA1-p425-Sap-TEF1p-Cas9-CYC1t-2xSap plasmid 600ng, Carrier DNA 4 mul, double-strand recombinant template 1 mul, 1 xTE/LiAC 45 mul and 1 xPEG/LiAC 300 mul into the bacterial precipitation, and uniformly mixing;
5) heat shock: 30min at 30 ℃, 25min at 42 ℃ and 10min at 30 ℃;
6) the supernatant was discarded at 12000rpm for 30sec, and 100. mu.l of pure water was used to re-suspend the plate on a leu plate;
7) culturing at 30 deg.C for 2-3 day;
YPD liquid medium formula: peptone (peptone)20g/L, yeast extract (yeast extract)10g/L, glucose 20g/L YPD;
the formula of the liquid culture medium is as follows: peptone (peptone)20g/L, yeast extract (yeast extract)10g/L, glucose 20g/L, agar powder 20g/L
-Leu solid medium formulation: 6.7g/L of yeast nitrogen source foundation, 20g/L of glucose, -leu10 multiplied by Amino acids0.64g/L and 20g/L of agar powder
-leu10 × Amino Acids: 200mg of adenine, 200mg of arginine, 200mg of histidine, 300mg of isoleucine, 300mg of lysine, 200mg of methionine, 500mg of phenylalanine, 2000mg of threonine, 200mg of tryptophan, 300mg of tyrosine, 1500mg of valine and 500mg of uracil;
picking a single clone: boiled in 20ul 0.2% SDS solution for 4min, and PCR-verified with Taq enzyme:
aatcatgtcgaaagctacatataaggaacg (upstream sequence of the yeast URA3 gene targeting the cleavage site based on the Cas9 system is selected as the amplification upstream primer, which is a non-limiting example and underlined is the restriction site)
And (3) primer R: selecting a genetic reference substance gene knocked into a yeast cell as an amplification downstream primer, such as the genes alpha 1 and alpha 2;
PCR positive, i.e., the genetic reference material gene is successfully knocked into the yeast genome, and the knocking-in accuracy can be verified through sequencing.
Example 4: preservation of genetic reference material, preparation of standard substance and use method
1. Preservation of genetic reference material, preparation of standard substance
The transformed yeast strain is preserved with 20% glycerol at-80 deg.C. The extraction and use of the genome DNA can be carried out after the snail enzyme is used for enzymolysis of the yeast cell wall. The gene mutation standard products with different mutation ratios can be prepared by protoplast processing, counting and mixing of the yeast.
2. Protoplast formation of Yeast cells
Preparing hypertonic PB liquid: a PB solution having a pH of 6.8 was prepared using 0.2M disodium hydrogen phosphate and 0.1M citric acid solution, and a 0.8M KCl hypertonic PB solution was prepared using the PB solution.
Centrifuging cultured yeast cells, collecting supernatant, and uniformly pumping precipitate with sterilized hypertonic PB solution at a ratio of 5 × 10750U of lyticase (Tiangen # RT-410-02) was treated in a water bath at 30 ℃ for 1 hour, centrifuged at 4000rpm to remove the supernatant, and the cell suspension was replaced with a hypertonic PB solution without lyticase to preserve the cell suspension.
The foregoing is only a preferred embodiment of the present invention, and it should be noted that, for those skilled in the art, various modifications and decorations can be made without departing from the principle of the present invention, and these modifications and decorations should also be regarded as the protection scope of the present invention.
Sequence listing
<110> research institute of science and technology of Chongqing city population and family planning
SHANGHAI ZEYIN BIOLOGICAL TECHNOLOGY Co.,Ltd.
<120> genetic reference substance for alpha thalassemia gene detection and preparation method thereof
<130>MP2016728
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>804
<212>DNA
<213> Artificial Sequence (Artificial Sequence)
<400>1
atgtcgaaag ctacatataa ggaacgtgct gctactcatc ctagtcctgt tgctgccaag 60
ctatttaata tcatgcacga aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc 120
accaaggaat tactggagtt agttgaagca ttaggtccca aaatttgttt actaaaaaca 180
catgtggata tcttgactga tttttccatg gagggcacag ttaagccgct aaaggcatta 240
tccgccaagt acaatttttt actcttcgaa gacagaaaat ttgctgacat tggtaataca 300
gtcaaattgc agtactctgc gggtgtatac agaatagcag aatgggcaga cattacgaat 360
gcacacggtg tggtgggccc aggtattgtt agcggtttga agcaggcggc ggaagaagta 420
acaaaggaac ctagaggcct tttgatgtta gcagaattgt catgcaaggg ctccctagct 480
actggagaat atactaaggg tactgttgac attgcgaaga gcgacaaaga ttttgttatc 540
ggctttattg ctcaaagaga catgggtgga agagatgaag gttacgattg gttgattatg 600
acacccggtg tgggtttaga tgacaaggga gacgcattgg gtcaacagta tagaaccgtg 660
gatgatgtgg tctctacagg atctgacatt attattgttg gaagaggact atttgcaaag 720
ggaagggatg ctaaggtaga gggtgaacgt tacagaaaag caggctggga agcatatttg 780
agaagatgcg gccagcaaaa ctaa 804
Claims (10)
1. A genetic reference material for alpha thalassemia gene detection is characterized in that a yeast cell in which a genetic reference material gene required for alpha thalassemia gene detection is inserted into a URA3 gene.
2. Genetic reference material according to claim 1, wherein the genetic reference material genes required for the alpha thalassemia gene detection are thalassemia genes alpha 1 and/or thalassemia genes alpha 2.
3. The genetic reference material of claim 1, wherein the yeast cell is a saccharomyces cerevisiae cell.
4. Use of the genetic reference material of any one of claims 1 to 3 for preparing alpha thalassemia gene standard products with different mutation ratios or for preparing a gene kit for detecting alpha thalassemia.
5. The method for preparing genetic reference material according to claim 1, wherein the URA3 gene in yeast cells is disrupted using CRISPR/Cas9 gene editing system, and then the gene of genetic reference material required for detection of α thalassemia gene is inserted at the disruption site by constructing upstream and downstream homology arms.
6. The method of claim 5, comprising:
step 1, searching a PAM sequence in URA3 gene in a yeast cell as a guide RNA target site, and taking a 20-base sequence at the upstream of the PAM sequence as a protospacer sequence; designing two reverse complementary primers according to a protobeacons sequence, wherein one primer sequence is the protobeacons sequence, forming a completely complementary double-stranded DNA by the two reverse complementary primers, and assembling the double-stranded DNA with a first carrier in an enzyme digestion manner to obtain a guide RNA plasmid;
designing an upstream and a downstream homology arms based on a guide RNA target site, inserting the upstream and the downstream homology arms into a multiple cloning site of a second vector in a molecular cloning mode, wherein an enzyme cutting site is required to be reserved between the upstream and the downstream homology arms for connecting a genetic reference substance gene required by alpha thalassemia gene detection;
designing upstream and downstream amplification primers according to the genetic reference substance gene, adding the reserved enzyme cutting sites at two ends of the amplification primers, amplifying by using a template containing the genetic reference substance gene to obtain the genetic reference substance gene with the reserved enzyme cutting sites, and inserting the genetic reference substance gene into a second vector in an enzyme cutting mode;
and 2, transferring the plasmid for expressing the Cas9, the guide RNA plasmid and the second vector inserted with the homology arm and the genetic reference substance gene into a yeast cell for homologous recombination, and then verifying after culturing to obtain the genetic reference substance.
7. The method according to claim 6, wherein the PAM sequence is 371-373bp sequence of URA3 gene in yeast cells.
8. The preparation method of claim 6, wherein the first vector is a commercial shuttle vector p425-Sap-TEF1p-Cas9-CYC1t-2 xSap.
9. The method according to claim 6, wherein the second vector is a commercial vector PBluescript (PSK).
10. A method for preparing gene mutation standard products of alpha thalassemia with different mutation ratios, which is characterized in that snail enzyme is used for enzymolysis of yeast cell walls of genetic reference materials of any one of claims 1 to 3, then genomic DNA is extracted and used, and the gene mutation standard products with different mutation ratios can be prepared through protoplast processing, counting and mixing of yeast.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010860247.6A CN111893178A (en) | 2020-08-24 | 2020-08-24 | Genetic reference material for alpha thalassemia gene detection and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010860247.6A CN111893178A (en) | 2020-08-24 | 2020-08-24 | Genetic reference material for alpha thalassemia gene detection and preparation method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111893178A true CN111893178A (en) | 2020-11-06 |
Family
ID=73224438
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010860247.6A Pending CN111893178A (en) | 2020-08-24 | 2020-08-24 | Genetic reference material for alpha thalassemia gene detection and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111893178A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831555A (en) * | 2021-02-01 | 2021-05-25 | 人和未来生物科技（长沙）有限公司 | Reference substance for detecting thalassemia gene and preparation method and application thereof |
| CN115505639A (en) * | 2022-11-24 | 2022-12-23 | 广州凯普医药科技有限公司 | Thalassemia gene detection quality control product and preparation method thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080044819A1 (en) * | 2003-12-09 | 2008-02-21 | John Ross Hawkins | Genetic Reference Materials |
| CN108342480A (en) * | 2018-03-05 | 2018-07-31 | 北京医院 | A kind of genetic mutation detection Quality Control object and preparation method thereof |
| CN108486158A (en) * | 2017-12-06 | 2018-09-04 | 上海泽因生物科技有限公司 | The construction method and its kit of genetic test standard items based on yeast cells |
| CN109115859A (en) * | 2018-10-23 | 2019-01-01 | 广东祥岳生物技术有限公司 | A kind of newborn's Screening for Thalassemia outcome quality control method |
| CN110699325A (en) * | 2019-10-14 | 2020-01-17 | 苏州艾可瑞斯生物科技有限公司 | Preparation method of plasma tumor mutation load detection quality control product based on CRISPR/Cas9 technology |
-
2020
- 2020-08-24 CN CN202010860247.6A patent/CN111893178A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080044819A1 (en) * | 2003-12-09 | 2008-02-21 | John Ross Hawkins | Genetic Reference Materials |
| CN108486158A (en) * | 2017-12-06 | 2018-09-04 | 上海泽因生物科技有限公司 | The construction method and its kit of genetic test standard items based on yeast cells |
| CN108342480A (en) * | 2018-03-05 | 2018-07-31 | 北京医院 | A kind of genetic mutation detection Quality Control object and preparation method thereof |
| CN109115859A (en) * | 2018-10-23 | 2019-01-01 | 广东祥岳生物技术有限公司 | A kind of newborn's Screening for Thalassemia outcome quality control method |
| CN110699325A (en) * | 2019-10-14 | 2020-01-17 | 苏州艾可瑞斯生物科技有限公司 | Preparation method of plasma tumor mutation load detection quality control product based on CRISPR/Cas9 technology |
Non-Patent Citations (1)
| Title |
|---|
| LI ZHOU ET AL.: ""Utilizing CRISPR Cas9 technology to prepare lymphoblastoid cell lines harboring genetic mutations for generating quality control materials in genetic testing"" * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831555A (en) * | 2021-02-01 | 2021-05-25 | 人和未来生物科技（长沙）有限公司 | Reference substance for detecting thalassemia gene and preparation method and application thereof |
| CN115505639A (en) * | 2022-11-24 | 2022-12-23 | 广州凯普医药科技有限公司 | Thalassemia gene detection quality control product and preparation method thereof |
| CN115505639B (en) * | 2022-11-24 | 2023-04-11 | 广州凯普医药科技有限公司 | Thalassemia gene detection quality control product and preparation method thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Conway et al. | Promoter and nucleotide sequences of the Zymomonas mobilis pyruvate decarboxylase | |
| Biessmann et al. | Chromosome ends in Drosophila without telomeric DNA sequences. | |
| Dieckmann et al. | Identification and cloning of a yeast nuclear gene (CBP1) involved in expression of mitochondrial cytochrome b. | |
| US7968339B2 (en) | Method of inducing genome reorganization via intracellular activation of thermostable multifrequency DNA-cleaving enzyme | |
| Munz et al. | Recombination between dispersed serine tRNA genes in Schizosaccharomyces pombe | |
| CN111893178A (en) | Genetic reference material for alpha thalassemia gene detection and preparation method thereof | |
| Lin et al. | Meiotically induced rec7 and rec8 genes of Schizosaccharomyces pombe. | |
| Segurado et al. | Increased recombination intermediates and homologous integration hot spots at DNA replication origins | |
| CN108486158B (en) | Construction method of gene detection standard substance based on yeast cells and kit thereof | |
| Suto et al. | A double-strand break repair component is essential for S phase completion in fission yeast cell cycling | |
| EP0045573A2 (en) | Eukaryotic autonomously replicating segment | |
| Bailis et al. | The essential helicase gene RAD3 suppresses short-sequence recombination in Saccharomyces cerevisiae | |
| JP6990111B2 (en) | Method for producing mutant filamentous fungus | |
| CN112481309B (en) | Application of Ago protein, composition and gene editing method | |
| WO1993023534A1 (en) | Process for gene targeting and genome manipulations | |
| CN108103025B (en) | Hematopoietic stem cell and preparation method and application thereof | |
| Grishchuk et al. | Genetic and cytological characterization of the RecA-homologous proteins Rad51 and Dmc1 of Schizosaccharomyces pombe | |
| Chen et al. | Multiple-copy-gene integration on chromosome of Escherichia coli for beta-galactosidase production | |
| CN109293751A (en) | Yersinia pestis virulence-associated protein sORF34 and its encoding gene and application | |
| CN111621500B (en) | Rat model for atrial fibrillation/atrial cardiomyopathy based on MYL4 gene editing and construction method thereof | |
| WO2024055664A1 (en) | Optimized guide rna, crispr/acc2c9 gene editing system, and gene editing method | |
| CN111040025B (en) | Application of Yp _2058 protein in regulation of toxicity of Yersinia pestis | |
| CN114891786B (en) | Dog Rosa26 gene and application thereof | |
| CN111235185B (en) | Method for realizing gene editing and screening based on LAC4 gene | |
| CN110129359B (en) | Method for detecting gene editing event and determining gene editing efficiency and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |