CN108486158B - Construction method of gene detection standard substance based on yeast cells and kit thereof - Google Patents
Construction method of gene detection standard substance based on yeast cells and kit thereof Download PDFInfo
- Publication number
- CN108486158B CN108486158B CN201711277328.8A CN201711277328A CN108486158B CN 108486158 B CN108486158 B CN 108486158B CN 201711277328 A CN201711277328 A CN 201711277328A CN 108486158 B CN108486158 B CN 108486158B
- Authority
- CN
- China
- Prior art keywords
- gene
- constructing
- sequence
- homologous recombination
- homologous
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/905—Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Microbiology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Mycology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Medicinal Chemistry (AREA)
- Plant Pathology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention relates to a construction method of a gene detection standard based on yeast cells and a kit thereof, which creatively adopts the yeast cells as genetic background for the first time, integrates a target gene to be detected, such as a human cell mutant gene, into the genome of the yeast cells in a homologous recombination mode, and the obtained recombinant yeast cells can be used as a positive control standard in genetic detection aiming at the target gene.
Description
Technical Field
The invention relates to a construction method of a gene detection standard product based on yeast cells and a kit thereof, belonging to the technical field of molecular biology.
Background
In clinical genetic diagnosis, the accuracy of gene detection is very important. In the case of prenatal examinations, false positive results may falsely guide the patient to terminate normal embryos, and false negative results may lead to optimistic expectations and false diagnoses of the affected infant. In clinical practice, genetic testing often leads to the formation of the basis of a diagnosis and treatment plan. More and more people utilize genetic detection to obtain the susceptibility probability of individuals in the population, so that effective disease prevention measures are taken, including intervention diagnosis and treatment means, life style change and the like.
To ensure the reliability and accuracy of the genetic test results, each experiment must be provided with genetic reference materials as positive and negative controls.
The genetic detection standards which are commonly used at present are as follows:
a patient sample;
tumor tissue samples (surgically excised/punctured tissue, formalin fixed/paraffin embedded/frozen sections/fresh samples, etc.) blood samples (circulating tumor cells, free tumor cell genomes);
a cell line comprising a genetic mutation;
immortalized cell lines of various genetic diseases, tumors, and the like;
genetic modification of cells (integration insertion, site-directed mutagenesis, gene knockout);
knock-in of genes in other cellular backgrounds;
plasmid sample & PCR product: recombinant plasmid or PCR product containing mutation site and nearby sequence;
synthesizing a DNA sample;
each of the above types of genetic test standards has its own advantages and limitations. For example, clinical patient samples have the defects of inconvenient sample acquisition, precious samples, poor uniformity, incapability of preparing a large amount of standard products and the like; the acquired genetic disease cell line is usually immortalized by the cells of a patient, and the genetic characteristics of the immortalized cell line are difficult to maintain for a long time; the cell line containing the tumor mutation is difficult and unstable to construct, the construction process of the cell line containing the genetic mutation is complicated, a complex screening process is required, the cell line is expensive, and the requirement on culture conditions is high; plasmid samples are simple and rapid to construct, but the copy number of plasmids in a system is high, and great errors and pollution are caused when genomic DNA is diluted and simulated and standard products with lower mutation percentage are mixed.
Therefore, constructing a new gene detection standard system is a problem to be solved urgently by those skilled in the art.
Disclosure of Invention
In view of the above-mentioned problems and/or other problems of the related art, an aspect of the present invention provides a method for constructing a gene assay standard, the method comprising inserting a target gene sequence to be detected into the genome of a yeast cell by homologous recombination to obtain a recombinant yeast cell containing the target gene sequence; the recombinant yeast cells are used as a positive control standard in the detection of the target gene.
Preferably, the construction method at least comprises the steps of constructing a homologous recombination template, and transforming the yeast cell with the homologous recombination template; the homologous recombination template comprises an upstream homologous repair arm and a downstream homologous repair arm, and the target gene sequence is positioned between the upstream homologous repair arm and the downstream homologous repair arm; the upstream homologous repair arm and the downstream homologous repair arm in the homologous recombination template target auxotrophic marker genes of the yeast cells.
Preferably, the construction method further comprises the step of constructing a gene editing plasmid targeting an auxotrophic marker gene of the yeast cell based on a gene editing system; and transforming the yeast cell with the homologous recombination template and the gene editing plasmid to obtain a recombinant yeast cell in which the target gene sequence is inserted into an auxotrophic marker gene of the yeast cell.
Preferably, in the step of constructing a gene editing plasmid targeting an auxotrophic marker gene of the yeast cell based on a gene editing system: the gene editing system is a CRISPR/Cas9 gene editing system, the yeast cell is Saccharomyces cerevisiae, and the auxotroph marker gene is URA3 gene; wherein, the gene editing plasmid targets the Saccharomyces cerevisiae gene URA3 and makes the site of DNA double strand break as editing site;
in the step of constructing a homologous recombination template: firstly, constructing a homologous recombination vector based on a CRISPR/Cas9 gene editing system, wherein the homologous recombination vector contains an upstream homologous repair arm and a downstream homologous repair arm which target the editing sites; then the target gene sequence is connected into the homologous recombination vector by a molecular cloning method of restriction enzyme cutting and is positioned between the upstream homologous repair arm and the downstream homologous repair arm; finally, obtaining a linearized homologous recombination template containing the upstream homologous repair arm, the target gene sequence and the downstream homologous repair arm by a restriction enzyme cutting method;
transforming the obtained gene editing plasmid and the linearized homologous recombination template into a saccharomyces cerevisiae cell to obtain a recombinant saccharomyces cerevisiae cell in which the target gene sequence is inserted in the URA3 gene;
the step of constructing the gene editing plasmid and the step of constructing the homologous recombination template are independently completed, and are not in sequence.
Preferably, in the step of constructing the gene editing plasmid, the gRNA targeting saccharomyces cerevisiae gene URA3 is connected to a yeast-escherichia coli shuttle-type vector by a molecular cloning method of restriction enzyme cleavage to obtain the gene editing plasmid; the sequence of the gRNA of the targeting saccharomyces cerevisiae gene URA3 is shown in SEQ ID No. 1.
Preferably, in the step of constructing a gene editing plasmid, the sequences of a primer pair for amplifying the gRNA are shown as SEQ ID No.2 and SEQ ID No. 3; the yeast-escherichia coli shuttle type vector is a p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector; connecting a p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector subjected to SapI enzyme digestion with the gRNA, transforming the obtained connection product into escherichia coli, selecting the identified positive clone for amplification culture, and obtaining the gene editing plasmid through plasmid extraction and purification operations.
Preferably, in the step of constructing a homologous recombination template, the upstream homologous repair arm is designed based on an upstream sequence at positions 351-373 in the URA3 gene sequence shown in SEQ ID No.4, and the downstream homologous repair arm is designed based on a downstream sequence at positions 351-373 in the URA3 gene sequence shown in SEQ ID No. 4.
Preferably, the sequence of the upstream homology repair arm is shown as SEQ ID No. 5; the sequence of the downstream homology repair arm is shown as SEQ ID No. 6.
Preferably, in the step of constructing the homologous recombination template, the upstream homologous repair arm and the downstream homologous repair arm are first ligated to the EcoRV and NotI cleavage sites of the multiple cloning site region of the pBluescript vector, respectively, by a molecular cloning method of restriction enzyme cleavage; connecting the target gene sequence to any enzyme cutting site between the EcoRV enzyme cutting sites and the NotI enzyme cutting sites by a molecular cloning method of restriction enzyme cutting; finally, obtaining a linearized homologous recombination template containing the upstream homologous repair arm, the target gene sequence and the downstream homologous repair arm by a restriction enzyme cutting method;
wherein, the sequences of the primer pair for amplifying the upstream homologous repair arm are shown as SEQ ID No.7 and SEQ ID No. 8; the sequences of the primer pairs for amplifying the downstream homology repair arms are shown as SEQ ID No.9 and SEQ ID No. 10.
Preferably, in the transformation step, the Saccharomyces cerevisiae W303-1A is transformed by using a lithium acetate method.
In another aspect, the present invention further provides a kit for constructing a gene detection standard, wherein the kit comprises: the gene editing plasmid is constructed based on a CRISPR/Cas9 gene editing system and is targeted to Saccharomyces cerevisiae gene URA3, the homologous recombination vector is constructed based on a CRISPR/Cas9 gene editing system and is a Saccharomyces cerevisiae cell line, wherein the gene editing plasmid is targeted to Saccharomyces cerevisiae gene URA3, a site of DNA double strand break of the gene editing plasmid is an editing site, and the homologous recombination vector contains an upstream homologous repair arm and a downstream homologous repair arm which are targeted to the editing site.
Preferably, the gene editing plasmid is a connection product of a gRNA of a targeting saccharomyces cerevisiae gene URA3 connected to a sapI enzyme cutting site in a yeast-escherichia coli shuttle-type vector p425-Sap-TEF1p-Cas9-CYC1t-2xSap, and the sequence of the gRNA of the targeting saccharomyces cerevisiae gene URA3 is shown as SEQ ID No. 1; the homologous recombination vector contains an upstream homologous repair arm and a downstream homologous repair arm which target the editing site, wherein the sequence of the upstream homologous repair arm is shown as SEQ ID No. 5; the sequence of the downstream homologous repair arm is shown as SEQ ID No. 6; the saccharomyces cerevisiae cell line is a saccharomyces cerevisiae cell W303-1A.
The construction method of the gene detection standard substance and the kit thereof provided by the invention firstly creatively adopt the yeast cells as the genetic background, integrate the target gene to be detected (such as human cell mutant gene) into the genome of the yeast cells in a homologous recombination manner, and the obtained recombinant yeast cells can be used as the positive control standard substance in the detection of the target gene. Compared with the standard substance in the prior art, the construction method of the invention avoids the defects of easy pollution, short preservation time and incapability of accurate quantification of the existing standard substance such as plasmid or synthetic DNA on one hand, and omits complex cell line construction and reduces cost on the other hand compared with the existing cell line containing genetic mutation as the standard substance, but can obtain definite mutation and copy number on the same hand, and the DNA extraction, amplification and detection are convenient; on the other hand, compared with the existing immortalized cell line and genetically modified cell line which are used as standard products, the gene has the advantages of high homologous recombination efficiency, single copy of genome, simple and quick culture and the like. In addition, the yeast cell culture process and the DNA extraction process are simple and easy to implement, and the cells can be removed from the wall through the process of protoplast transformation, so that the consistency of the cells with the human cell shape and the use operation of the standard substance is improved. In addition, the yeast cell can accommodate large-fragment exogenous DNA, and gene detection standards of deletion, duplication and even chromosome number variation of the large fragment can be modified and used by taking the gene detection standards as genetic backgrounds.
Drawings
FIG. 1 is a map of the cleavage site of the pBluescript vector;
FIG. 2 shows the results of PCR identification of positive clones (transformed s.cerevisiae cells) obtained in example 1.
Detailed Description
The present invention will be described in detail below with reference to specific embodiments shown in the drawings. These embodiments are not intended to limit the present invention, and structural, methodological, or functional changes made by those skilled in the art according to these embodiments are included in the scope of the present invention.
Example embodiments will now be described more fully with reference to the accompanying drawings. Example embodiments may, however, be embodied in many different forms and should not be construed as limited to the embodiments set forth herein; rather, these embodiments are provided so that this disclosure will be thorough and complete, and will fully convey the concept of example embodiments to those skilled in the art.
Materials, reagents and the like used in the following examples are commercially available unless otherwise specified. The examples do not show the specific techniques or conditions, and the techniques or conditions are described in the literature in the art (for example, refer to J. SammBruk et al, molecular cloning, A laboratory Manual, third edition, science Press, translated by Huang Petang et al) or according to the product instructions.
In a specific embodiment of the present invention, the inventors provide a method for constructing a yeast cell-based gene detection standard, which comprises inserting a target gene sequence to be detected into the genome of a yeast cell by homologous recombination to obtain a recombinant yeast cell containing the target gene sequence; the recombinant yeast cells are used as a positive control standard in the detection of the target gene.
In the embodiment of the present invention, the inventors originally used yeast cells as genetic background for the first time, and integrated the target gene (human cell mutant gene) to be detected into the genome of yeast cells by homologous recombination, so that the obtained recombinant yeast cells can be used as a positive control standard in the detection of the target gene.
Although yeast cells are widely used in the field of molecular biology, yeast cells have never been used as a vector for constructing a standard for genetic testing, particularly in the field of subdivision of genetic diagnosis.
In addition to the direct use of clinical patient samples, some standard construction methods are disclosed in the prior art, but the process of constructing a cell line containing genetic mutation is very complicated, the possibility of heterozygous mutation exists due to the double-copy property of human genome, the plasmid copy number in the system is high although the plasmid construction standard is simple and rapid, and errors and pollution are easily caused when diluting and simulating genomic DNA and mixing the standard with lower mutation percentage.
The inventor has found through a great deal of research that, surprisingly, the yeast cell is very suitable to be used as a standard product carrier for genetic detection, the haploid yeast cell can directly obtain homozygous mutant individuals after gene recombination, and particularly, the haploid wild type yeast cell and the recombined yeast cell introduced with target genes can obtain a standard product with accurate proportion by counting after being mixed in different proportions; yeast cells are stored in hypertonic solution after being protoplasted, have the similar form without cell walls as a standard substance taking human cells as background, can be prepared into forms of genome DNA, cell suspension, FFPE blocks, slices, cell smears and the like, and meet the actual requirements of various standard substance forms.
Moreover, the yeast cell can accommodate exogenous DNA with larger segment, and the operation of gene recombination is more convenient; in addition, the culture process of the yeast cells and the DNA extraction process are simple and easy to implement.
In a preferred embodiment of the present invention, the construction method comprises at least a step of constructing a template for homologous recombination, and a step of transforming the yeast cell with the template for homologous recombination; the homologous recombination template comprises an upstream homologous repair arm and a downstream homologous repair arm, and the target gene sequence is positioned between the upstream homologous repair arm and the downstream homologous repair arm; the upstream and downstream homology repair arms target an auxotrophic marker gene of the yeast cell.
The "auxotrophic marker gene for yeast cells" is explained as follows: after certain genes in the yeast genome are disrupted, the yeast cells lose the ability to synthesize certain essential living materials, cannot grow on minimal medium, and must be supplemented with corresponding nutrients to grow normally. These genes can be used as selection markers in yeast gene manipulation. Examples of the auxotrophic marker genes for yeast cells include TRP1, Leu2, His3 (synthesis-deficient marker genes for tryptophan, leucine, and histidine, respectively), URA3 (uracil synthesis-deficient marker gene), and SUP4 (ochre mutation suppressor gene).
In a more preferred embodiment of the present invention, the construction method further comprises the step of constructing a gene editing plasmid targeting an auxotrophic marker gene of the yeast cell based on a gene editing system; and transforming the yeast cell with the homologous recombination template and the gene editing plasmid to obtain a recombinant yeast cell in which the target gene sequence is inserted into an auxotrophic marker gene of the yeast cell.
"Gene editing" refers to "editing" a target gene to knock out or add a specific DNA fragment. As for the selection of tools/systems for gene editing, there are Zinc Finger Nucleases (ZFNs), transcription activator effector nucleases (TALENs), and the like, in addition to the currently hot CRISPR/Cas system. Both ZFNs and TALENs cleave target genes by forming dimers from the DNA binding domain and fokl cleavage domain of the protein. However, both gene editing tools are less efficient than the CRISPR/Cas system. The CRISPR/Cas system only needs to design RNA complementary to the target gene sequence and introduce the gene encoding Cas9 protein into the host cell. The CRISPR/Cas system identifies the target sequence in the process of base pairing of RNA and DNA, so that the identification of the target gene sequence is more accurate, and the identification sites are diversified, thereby greatly improving the efficiency of gene operation.
In this scheme, when transforming yeast cells, the constructed gene editing plasmid targets the auxotrophic marker gene of the yeast cell and breaks its DNA double strand, which can greatly improve the efficiency of homologous recombination.
In a specific embodiment of the present invention, in the step of constructing a gene editing plasmid targeting an auxotrophic marker gene of the yeast cell based on a gene editing system: the gene editing system is a CRISPR/Cas9 gene editing system, the yeast cell is Saccharomyces cerevisiae, and the auxotroph marker gene is URA3 gene; wherein, the gene editing plasmid targets the Saccharomyces cerevisiae gene URA3 and makes the site of DNA double strand break as editing site;
in the step of constructing a homologous recombination template: firstly, constructing a homologous recombination vector based on a CRISPR/Cas9 gene editing system, wherein the homologous recombination vector contains an upstream homologous repair arm and a downstream homologous repair arm which target the editing sites; then the target gene sequence is connected into the homologous recombination vector by a molecular cloning method of restriction enzyme cutting and is positioned between the upstream homologous repair arm and the downstream homologous repair arm; finally, obtaining a linearized homologous recombination template containing the upstream homologous repair arm, the target gene sequence and the downstream homologous repair arm by a restriction enzyme cutting method;
transforming the obtained gene editing plasmid and the linearized homologous recombination template into a saccharomyces cerevisiae cell to obtain a recombinant saccharomyces cerevisiae cell in which the target gene sequence is inserted in the URA3 gene;
the step of constructing the gene editing plasmid and the step of constructing the homologous recombination template are independently completed, and are not in sequence.
In the above embodiments, a readily available and easily manipulated s.cerevisiae cell was selected and targeted to the "s.cerevisiae gene URA 3", wherein URA3 is the gene encoding orotidine-5 phosphate decarboxylase, which is a key enzyme in the synthesis of yeast RNA pyrimidine nucleotides. If orotidine-5 phosphate decarboxylase is inactivated, the yeast cannot grow and shows uridine or uracil auxotrophy and 5-FOA acid-resistant phenotype. Therefore, URA3 gene is widely used as a nutritional deficiency screening marker in yeast molecular genetics research. The yeast can grow normally as long as the medium is supplemented with uridine or uracil; knocking out the URA3 gene and inserting an exogenous fragment into it did not affect the normal growth of yeast, therefore, the inventors selected URA3 gene as a safe site for insertion of exogenous sequences.
Regarding the gene recombination of yeast cells, the CRISPR/Cas9 gene editing system is adopted in the specific embodiment of the present invention, and particularly, the CRISPR/Cas9 gene editing system can efficiently mediate site-specific DNA double strand breaks, usually activates the repair of non-homologous end joining mechanism (NHEJ) in cells, and then introduces non-purposeful insertion, deletion and other mutations, which is widely used for gene knockout. The double-stranded DNA break can also be repaired by a homologous recombination mechanism, and when a single-stranded or double-stranded recombination template is introduced, a target sequence can be specifically inserted.
In a preferred embodiment of the present invention, in the step of constructing a gene editing plasmid, a gRNA targeting the saccharomyces cerevisiae gene URA3 is ligated to a yeast-escherichia coli shuttle-type vector by a molecular cloning method of restriction enzyme cleavage to obtain the gene editing plasmid; the sequence of the gRNA of the targeting saccharomyces cerevisiae gene URA3 is shown in SEQ ID No. 1.
Regarding the design of the gRNA sequence of the targeting saccharomyces cerevisiae gene URA3, the inventor designs a plurality of sequences possibly suitable for the gRNA of the targeting saccharomyces cerevisiae gene URA3 based on http:// crispr.dbcls.jp/website, and sequentially anneals the sequences to a yeast-escherichia coli shuttle vector, then transforms the successfully constructed plasmid into a yeast cell, and verifies the editing efficiency of the plasmid by sequencing a single clone; through a large number of verification tests, the inventor finds that the editing efficiency is highest when the sequence of the gRNA of the targeting saccharomyces cerevisiae gene URA3 is shown as SEQ ID No. 1.
In a more preferred embodiment of the present invention, in the step of constructing a gene editing plasmid, the sequences of a primer pair for amplifying the gRNA are shown as SEQ ID nos. 2 and 3; the yeast-escherichia coli shuttle type vector is a p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector; connecting a p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector subjected to SapI enzyme digestion with the gRNA, transforming the obtained connection product into escherichia coli, selecting the identified positive clone for amplification culture, and obtaining the gene editing plasmid through plasmid extraction and purification operations.
In another more preferred embodiment of the present invention, in said step of constructing a homologous recombination template, said upstream homologous repair arm is designed based on an upstream sequence at positions 351-373 in the URA3 gene sequence shown in SEQ ID No.4, and said downstream homologous repair arm is designed based on a downstream sequence at positions 351-373 in the URA3 gene sequence shown in SEQ ID No. 4.
Specifically, when the sequence of the gRNA of the targeted Saccharomyces cerevisiae gene URA3 is shown as SEQ ID No.1, DNA double strand breaks occur randomly at positions 351-373 of the URA3 gene of the yeast cell after being connected to a yeast-Escherichia coli shuttle-type vector and transformed into the yeast cell; thus, the inventors designed the upstream homology-repair arm based on the sequence upstream of positions 351-373 in the URA3 gene sequence shown in SEQ ID No.4, and designed the downstream homology-repair arm based on the sequence downstream of positions 351-373 in the URA3 gene sequence shown in SEQ ID No. 4.
More preferably, through the design and experimental verification of the inventor, the sequence of the upstream homology repair arm is shown as SEQ ID No. 5; the sequence of the downstream homology repair arm is shown as SEQ ID No. 6.
More preferably, in the step of constructing the homologous recombination template, the upstream homologous repair arm and the downstream homologous repair arm are first ligated to the EcoRV and NotI cleavage sites of the multiple cloning site region of the pBluescript vector, respectively, by a molecular cloning method of restriction enzyme cleavage; connecting the target gene sequence to any enzyme cutting site between the EcoRV enzyme cutting sites and the NotI enzyme cutting sites by a molecular cloning method of restriction enzyme cutting; finally, obtaining a linearized homologous recombination template containing the upstream homologous repair arm, the target gene sequence and the downstream homologous repair arm by a restriction enzyme cutting method; wherein, the sequences of the primer pair for amplifying the upstream homologous repair arm are shown as SEQ ID No.7 and SEQ ID No. 8; the sequences of the primer pairs for amplifying the downstream homology repair arms are shown as SEQ ID No.9 and SEQ ID No. 10.
Finally, regarding the obtaining of the target gene sequence to be inserted, the target gene sequence is amplified (for example, a DNA sequence containing the mutant gene to be detected is determined by amplification or a DNA sequence containing the mutant gene to be detected is obtained by amplification site-directed mutagenesis PCR).
In a preferred embodiment of the present invention, in said transformation step, the Saccharomyces cerevisiae W303-1A cells are transformed using the lithium acetate method.
In a specific embodiment of the present invention, the inventors further provide a kit for constructing a gene detection standard, the kit comprising: the gene editing plasmid is constructed based on a CRISPR/Cas9 gene editing system and is targeted to Saccharomyces cerevisiae gene URA3, the homologous recombination vector is constructed based on a CRISPR/Cas9 gene editing system and is a Saccharomyces cerevisiae cell line, wherein the gene editing plasmid is targeted to Saccharomyces cerevisiae gene URA3, a site of DNA double strand break of the gene editing plasmid is an editing site, and the homologous recombination vector contains an upstream homologous repair arm and a downstream homologous repair arm which are targeted to the editing site.
In a preferred embodiment of the invention, the gene editing plasmid is a ligation product of a gRNA targeting Saccharomyces cerevisiae URA3 ligated to a SapI cleavage site in a yeast-E.coli shuttle vector p425-Sap-TEF1p-Cas9-CYC1t-2xSap, the sequence of the gRNA targeting Saccharomyces cerevisiae URA3 is shown in SEQ ID No. 1; the homologous recombination vector contains an upstream homologous repair arm and a downstream homologous repair arm which target the editing site, wherein the sequence of the upstream homologous repair arm is shown as SEQ ID No. 5; the sequence of the downstream homologous repair arm is shown as SEQ ID No. 6; the saccharomyces cerevisiae cell line is a saccharomyces cerevisiae cell W303-1A.
In the scheme, the kit is matched with the construction method, and specifically, the kit comprises a constructed gene editing plasmid, a constructed homologous recombination vector and a saccharomyces cerevisiae cell line to be transformed; after a user purchases the kit, the target gene sequence to be detected is connected to the homologous recombination vector (and is positioned between the upstream homologous repair arm and the downstream homologous repair arm) by a restriction enzyme cutting method, a linearized homologous recombination template is obtained by the restriction enzyme cutting method, and finally the linearized homologous recombination template containing the target gene sequence and the ready-made gene editing plasmid are transformed into a saccharomyces cerevisiae cell line together to obtain the recombinant yeast cell containing the target gene sequence, wherein the recombinant yeast cell is used as a positive reference standard in the detection aiming at the target gene.
Example 1
Hereinafter, a yeast cell standard (positive standard) for detecting the G12A mutation is constructed by taking "mutation c.35G > C (hereinafter referred to as G12A mutation), which is an important related gene of human non-small cell lung cancer, as an example.
Step (a): constructing a gene editing plasmid of a target saccharomyces cerevisiae gene URA3 based on a CRISPR/Cas9 gene editing system;
in step (a), the inventors selected a yeast-E.coli shuttle-type vector, specifically, the p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector (commercially available);
in step (a), the inventors designed sequences of grnas targeting saccharomyces cerevisiae gene URA3, specifically, the sequences of grnas are: cattacgaatgcacacggtgtgg (shown in SEQ ID No. 1); two reverse complementary primers were designed based on the gRNA sequence (in this example, to match the SapI cleavage gap of the p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector, both ends of the primers were filled up), and the primer sequences were as follows:
forward sequence (F): 5 '-atccattacgaatgcacacggtg-3' (shown in SEQ ID No. 2);
reverse sequence (R): 5 '-aaccaccgtgtgcattcgtaatg-3' (shown in SEQ ID No. 3);
wherein the streaked portion "atc" at the 5 'end of the forward sequence and the streaked portion "aac" at the 5' end of the reverse sequence are filled-up portions.
Two reverse complementary primers were combined by annealing in a total of 20. mu.l, containing: 2 ul of 10 xNEBBbuffer, 5 ul of 100 ul M F/R; after 5min at 95 ℃ the temperature was slowly brought to room temperature.
Connecting a p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector subjected to SapI enzyme digestion with an annealing product (a connection system is 10 mu l, wherein the connection system comprises 10xT4ligase buffer 1 mu l, an enzyme digestion vector 50ng and an annealing product 1 mu l), transforming Escherichia coli DH5 alpha (commercially available from Tiangen Biochemical technology (Beijing) Co., Ltd.) with the product number CB101, and identifying and obtaining a positive clone; the plasmid was extracted from the kit (commercially available, 35715KA1 from Axygen).
Converting the successfully constructed plasmid into saccharomyces cerevisiae W303-1A by a LiAc method, and taking a single clone to carry out sequencing verification; it was verified that after Saccharomyces cerevisiae W303-1A was transformed with the plasmid obtained in step (a) of this example, DNA double strand breaks were randomly generated at positions 351-373 of gene URA3 (based on positions 351-373 in URA3 gene sequence shown in SEQ ID No. 4); the plasmid obtained in step (a) of this example was thus identified as "a gene editing plasmid targeting Saccharomyces cerevisiae gene URA 3".
Step (b): preparing a homologous recombination template;
firstly, constructing a homologous recombinant vector based on a CRISPR/Cas9 gene editing system;
(b-1): the inventors designed homology arms targeting the editing site based on the Cas9 system; as described above, the editing site of the gene editing plasmid targeting Saccharomyces cerevisiae gene URA3 obtained in step (a) is located at positions 351-373 of the sequence of gene URA3, and therefore, the inventors designed an upstream homology repair arm based on the upstream sequence at positions 351-373 and designed a downstream homology repair arm based on the downstream sequence at positions 351-373.
The designed sequence of the upstream homology repair arm is shown as SEQ ID No.5 (134bp), and the sequence of the downstream homology repair arm is shown as SEQ ID No.6 (141 bp).
(b-2): the inventors designed primers near the upstream and downstream of the above editing site by 150bp using Premier5 software, and verified the following primers: the sequences of the primer pairs for amplifying the upstream homologous repair arm are shown as SEQ ID No.7 (forward sequence) and SEQ ID No.8 (reverse sequence); the sequences of the primer pairs for amplifying the downstream homology-modified arms are shown as SEQ ID No.9 (forward sequence) and SEQ ID No.10 (reverse sequence).
Obtaining upstream and downstream homologous repair arms through PCR amplification, specifically:
and (3) PCR system: 50 μ l of the PCR system contained 10 XKOD buffer 5 μ l, 25mM MgSO4Mu.l of 3 mu.l of 2mM dNTPs, 1 mu.l of 10 mu M each of the upstream and downstream primers, Kod-Plus-Neo 1 mu.l of the DNA sequence, and 5-10ng of a plasmid template containing a URA3 gene sequence; wherein KOD-Plus-Neo PCR high-fidelity enzyme is adopted and purchased from TOYOBO company, and the commodity number is KOD-40;
PCR conditions were as follows: pre-denaturation at 94 ℃ for 2min, and amplification by a three-step method, wherein denaturation at 98 ℃ is performed for 10s, annealing at 58 ℃ is performed for 30s, extension at 68 ℃ is performed for 50s, extension at 68 ℃ is performed for 5min after 40 cycles, and the temperature is kept at 4 ℃.
The PCR product was recovered by electrophoresis using the Axygen gel recovery kit AP-GX-250.
(b-3): the upstream homologous repair arm and the downstream homologous repair arm were ligated to the EcoRV and NotI cleavage sites of the multiple cloning site region of the pBluescript vector, respectively, by a molecular cloning method using restriction enzyme digestion (see FIG. 1 for a map of the cleavage sites of the pBluescript vector), to obtain a homologous recombination vector containing the upstream homologous repair arm and the downstream homologous repair arm of the targeted editing site.
The specific operation is as follows:
the pBluescript vector is commercially available from Youbao Bio Inc., product model VT 1892.
Enzyme digestion: the pBluescript vector was digested with EcoRV restriction enzyme (BioLab, cat # R0195V, used according to the instructions); 50 mul enzyme digestion system contains 10XNEB buffer3.15 mul, EcoRV enzyme 1 mul, pBluescript vector 1 mug, reaction 2h at 37 ℃; the digested pBluescript vector was recovered using the Axygen gel recovery kit AP-GX-250.
Connecting: the upstream homologous repair arm fragment recovered from the gel in the above-mentioned step (b-2) and the pBluescript vector digested with EcoRV restriction enzyme were ligated by using T4DNA ligase (cat. No. M0202) from BioLab in accordance with the protocol of the T4DNA ligase, i.e., 1. mu.l of 10XT4ligase buffer was contained in 10. mu.l of the ligation system, 50ng (20-200 ng/. mu.l) of the pBluescript vector digested with EcoRV, 30ng (50-100 ng/. mu.l) of the upstream homologous repair arm fragment recovered from the kit, 1. mu.l of T4ligase, and ddH2Supplementing and leveling O; connecting for 2h at room temperature;
and (3) verification: the ligation product is transformed into an Escherichia coli competent cell (DH5 alpha, Tiangen Biochemical technology Co., Ltd., product No. CB101), white clones are picked after 12-16h of LB plate culture, and correct clones are ligated through one-generation sequencing verification.
Enzyme digestion: the above vector to which the upstream homology-modified arm was ligated was digested with NotI restriction enzyme (BioLab, cat # R0189V, used as described in the specification), and 50. mu.l of the digestion system contained 10XNEB buffer 3.15. mu.l and NotI enzyme 1. mu.l, and pBluescript vector to which the upstream homology-modified arm was ligated 1. mu.g was reacted at 37 ℃ for 2 hours. The digested vector was recovered using Axygen gel recovery kit AP-GX-250.
Connecting: the vector digested with NotI restriction enzyme and the downstream homologous repair arm fragment recovered from the gel in the step (b-2) was used in ShanghaiA near-shore technology co.ltd,
PCR one-step directed cloning kit (seamless cloning) (NR001), used according to the instructions, the downstream homology-repair arm fragment was ligated into the NotI restriction enzyme-digested vector.
And (3) verification: the ligation product is transformed into an escherichia coli competent cell (DH5 α, tiangen biochemistry technology limited, cat # CB101), and the single clone is picked up and correctly ligated by first-generation sequencing verification, to obtain a homologous recombination vector (a homologous recombination framework vector into which a target gene sequence is to be inserted).
(b-4): then, the target gene sequence to be inserted is ligated to the homologous recombination vector obtained above by a molecular cloning method using restriction enzyme cleavage, and is located between the upstream homologous repair arm and the downstream homologous repair arm, thereby obtaining a homologous recombination vector containing the target gene sequence, specifically:
as the target gene to be inserted, the G12A mutant gene described above was selected in this example. The target gene sequence can be obtained by amplification to determine the DNA sequence containing the mutant gene to be detected or by amplification of the DNA sequence containing the mutant gene to be detected obtained by site-directed mutagenesis PCR.
In order to connect the target gene sequence to be inserted into the homologous recombination vector and located between the upstream homologous repair arm and the downstream homologous repair arm, multiple enzyme cutting sites between the two homologous repair arms can be selected, see fig. 1, i.e., other enzyme cutting sites located between the enzyme cutting sites EcoRV and NotI of the two homologous repair arms, for example, enzyme cutting sites such as EcoRI, XmaI, SmaI, BamHI, XbaI and the like can be selected; after selection, appropriate protective bases are added to both ends of the amplification primer sequence of the target gene.
In this example, EcoRI & XbaI cleavage sites were selected, and the amplification primer sequences used to ligate the gene sequence of interest to the EcoRI & XbaI cleavage sites in the homologous recombination vector were as follows:
forward sequence: 5 'CGGAATTCACGGAGTCTTGCTCTATCGC 3' (shown in SEQ ID No. 11);
reverse sequence:
5 'GCTCTAGAACCTTCAAGGTGTCTTACAGGTC 3' (shown in SEQ ID No. 12)
The specific operation is as follows:
the target gene sequence was amplified using primers with restriction sites and protected bases (using KOD-Plus-Neo PCR Hi-Fi enzyme, TOYOBO Co., Cat. KOD-40), PCR conditions: pre-denaturation at 94 ℃ for 2min, and amplification by a three-step method, wherein denaturation at 98 ℃ is performed for 10s, annealing at 58 ℃ is performed for 30s, and extension at 68 ℃ is performed for 50 s; after 40 cycles, extending for 5min at 68 ℃; keeping at 4 ℃. Recovering the PCR product by using a gel recovery kit AP-GX-250 of Axygen company after electrophoresis detection;
the homologous recombination vector obtained in the above step (b-3) and the PCR product of the above target gene sequence were digested with EcoRI & XbaI, (BioLab, EcoRI cat No. R0101V, XbaI cat No. R0145V, used as described in the specification). 50ul enzyme digestion system contains: 10XNEB buffer 2.15 u l, EcoRI, XbaI enzyme each 1 u l, the target gene sequence of PCR products 1 u g, 37 degrees C reaction for 1-2 h. And (3) carrying out electrophoretic detection on the enzyme digestion product, and then recovering by using a gel recovery kit AP-GX-250 of Axygen company.
The digested homologous recombination vector and the digested target gene fragment recovered from the kit were used with T4DNA ligase from BioLab, cat # M0202, according to the method described in the specification. 10 mul of the connection system contains 1 mul of 10XT4ligase buffer, 50ng (50-200 ng/mul) of the homologous recombination vector after enzyme digestion, 30ng (50-100 ng/mul) of the target gene fragment after enzyme digestion recovered by the kit, 1 mul of T4ligase, ddH2And (4) supplementing and finishing. The ligation was carried out at room temperature for 2 h.
And transforming the ligation product into an escherichia coli competent cell (DH5 alpha, Tiangen Biochemical technology Co., Ltd., product No. CB101), culturing for 12-16h on an LB plate, selecting a single clone, and verifying correct ligation through first-generation sequencing to obtain a plasmid containing the homologous recombination template.
Finally, a linearized homologous recombination template containing the upstream homologous repair arm, the target gene sequence and the downstream homologous repair arm is obtained by a restriction enzyme cutting method. As shown in figure 1, any two enzyme cutting sites outside EcoRV and NotI are selected to carry out double enzyme cutting on the obtained 'plasmid containing the homologous recombination template' so as to obtain a linearized homologous recombination template (the linearized homologous recombination template which targets the Saccharomyces cerevisiae gene URA3 and carries a target gene sequence)
The step (a) and the step (b) are respectively and independently carried out, and can not be carried out in sequence.
Step (c): transforming the gene editing plasmid obtained in the step (a) and the homologous recombination vector containing the target gene sequence obtained in the step (b) into a saccharomyces cerevisiae cell together to obtain a recombinant saccharomyces cerevisiae cell in which the target gene sequence is inserted in the URA3 gene;
specifically, in this example, the gene editing plasmid obtained in the step (a) and the homologous recombination vector carrying the target gene sequence of the target saccharomyces cerevisiae gene URA3 obtained in the step (b) are transformed into the saccharomyces cerevisiae cell W303-1A by a lithium acetate method; the specific transformation process steps are as follows:
(c-1) culturing the saccharomyces cerevisiae cell W303-1A by adopting a YPD liquid culture medium, after overnight culture, centrifuging at 12000rpm for 30 seconds, discarding a supernatant, and taking a precipitate (a yeast cell);
the YPD liquid culture medium mainly comprises the following components: peptone (peptone)20g/L, yeast extract (yeast extract)10g/L, glucose 20g/L, agar powder 20 g/L;
(c-2) resuspending the pellet obtained in the above step (c-1) with 1ml of 1 XTE/LiAC, washing, centrifuging at 12000rpm for 30 seconds, discarding the supernatant, and collecting the pellet (yeast cells);
(c-3) adding 600ng of the gene editing plasmid obtained in the step (a), 1. mu.g of the homologous recombination template obtained in the step (b), 4. mu.l of Carrier DNA, 45. mu.l of 1 XTE/LiAC, and 300. mu.l of 1 XPEG/LiAC to the yeast cell sediment obtained in the step (c-2), and uniformly mixing;
(c-4) heat shock transformation; thermally shocking the mixture obtained in step (c-3) under the operating conditions: 30min at 30 ℃, 25min at 42 ℃ and 10min at 30 ℃;
(c-5) the product obtained in the step (c-4) was centrifuged at 12000rpm for 30 seconds, the supernatant was discarded, the pellet was resuspended in 100. mu.l of purified water, and then applied to a leu plate (leucine deficient yeast solid medium) and cultured at 30 ℃ for 2 to 3 days. And (4) supplementary notes: the cells into which the gene-editing plasmids had been inserted were grown on leu plates, because the gene-editing plasmids obtained in step (a) of this example had leucine tags, and they could be grown on a leucine-deficient yeast medium.
(c-6) selecting 1/3 of the single clone with the size of the match head, uniformly mixing the single clone with 20 mu l of 0.2% SDS solution, boiling the mixture for 4min at 100 ℃, cooling the mixture at 4 ℃, centrifuging the mixture for 30 seconds at 12000rpm, and taking supernate to perform PCR identification by using Taq enzyme. Wherein the primers used for PCR identification are: one forward primer for the gene sequence of interest and a reverse primer on the URA3 gene were used. Specifically, in this embodiment, the forward sequence: 5 'aggcctgctgaaaatgactg 3' (shown as SEQ ID No. 13), and reverse sequence 5 'ttagttttgctggccgcatcttc 3' (shown as SEQ ID No. 14).
For the PCR system, 25. mu.l of each of 5 XTaq buffer, 0.3. mu.l Taq enzyme, 1.25. mu.l each of 10. mu. lM sense/antisense sequences, and 0.4. mu.l supernatant were contained.
Referring to FIG. 2, for the PCR identification result, the insertion of the target gene into the target region of the yeast genome is preliminarily verified by PCR amplification, and the PCR identification result is positive (positive strip), i.e., the yeast cell clone in which the URA3 gene of the Saccharomyces cerevisiae cell is successfully inserted into the target gene sequence (the accuracy of the insertion can also be verified by sequencing), i.e., the successfully constructed recombinant Saccharomyces cerevisiae cell. In FIG. 2, DL2000 is the used DNA marker, "+" indicates a positive result, "-" indicates a negative result, NTC is a blank control, and 1.2kb is the objective band. In FIG. 2, 7 of the 8 results were positive results, indicating that the recombinant s.cerevisiae cells were successfully constructed.
In addition, the inventors also confirmed that the target gene sequence was inserted into URA3 gene of Saccharomyces cerevisiae by subjecting the PCR product identified as positive to sequencing for the first generation by the sequencer and performing bidirectional sequencing using the upstream and downstream primers of the PCR reaction.
Example 2: kit for constructing gene detection standard product
The kit of example 2 essentially comprises:
1) the gene editing plasmid targeting saccharomyces cerevisiae gene URA3 obtained in the step (a) of the above example 1 (gene editing plasmid targeting saccharomyces cerevisiae gene URA3 constructed based on CRISPR/Cas9 gene editing system), wherein the gene editing plasmid targets the saccharomyces cerevisiae gene URA3 and has a site of DNA double strand break as an editing site;
2) the homologous recombination vector obtained in step (b-3) of example 1 above (a homologous recombination vector constructed based on the CRISPR/Cas9 gene editing system and containing an upstream homologous repair arm and a downstream homologous repair arm that target the editing site);
3) a Saccharomyces cerevisiae cell line; in this example, s.cerevisiae cell W303-1A may be used.
After purchasing the kit of embodiment 2 of the present invention, a user only needs to connect the amplified target gene sequence to be detected to a homologous recombination vector (and located between the upstream homologous repair arm and the downstream homologous repair arm) by a restriction enzyme digestion method, obtain a linearized homologous recombination template by the restriction enzyme digestion method, and finally transform the linearized homologous recombination template containing the target gene sequence and a ready-made gene editing plasmid together into a saccharomyces cerevisiae cell line to obtain a recombinant yeast cell containing the target gene sequence, wherein the recombinant yeast cell is used as a positive control standard in a detection for the target gene.
Preferably, the kit of this embodiment may further comprise a ligation system for ligating the target gene sequence to be detected to the homologous recombination vector, and the like. Preferably, the kit of the present embodiment may further comprise a lithium acetate transformation system for transforming a saccharomyces cerevisiae cell line, and the like.
Application example: application of constructed recombinant yeast cell as gene detection standard
The preparation of the standard for detecting the G12A mutant gene will be briefly described below by taking "C.35G > C (hereinafter referred to as G12A mutation), which is an important gene related to human non-small cell lung cancer, as an example.
Negative standard substance: wild type genome, plasmid
Positive standard substance: the successfully constructed recombinant Saccharomyces cerevisiae cells obtained in example 1 were protoplasted and the cell wall-free suspension obtained was used as a positive standard.
The protoplast procedure for recombinant Saccharomyces cerevisiae cells was as follows: centrifuging cultured recombinant Saccharomyces cerevisiae cells, collecting supernatant, uniformly pumping precipitate with sterilized hypertonic PB solution, and adding 5 × 10 per ml solution750U of muramidase (Tiangen # RT-410-02) is treated for 1h under the condition of 30 ℃ water bath, the supernatant is centrifuged at 4000rpm, and the cell suspension is preserved by changing into a hypertonic PB solution without the muramidase. Wherein, the preparation of the hypertonic PB liquid is as follows: a PB solution having a pH of 6.8 was prepared using 0.2M disodium hydrogen phosphate and 0.1M citric acid solution, and a 0.8M KCl hypertonic PB solution was prepared using the PB solution.
Note also that: the obtained cell wall-free suspension is used as a positive standard substance for gene detection, can be directly used for extracting DNA, and can also be prepared into cell smears, wax blocks, paraffin sections and the like.
Effect data
1. For the successfully constructed recombinant saccharomyces cerevisiae cell obtained in the example 1, the inserted target gene is preliminarily verified to be inserted in the yeast cell in a single copy manner through Q-PCR reaction of the inserted target gene and a yeast internal reference gene;
specifically, Q-PCR quantification was carried out using three primer sequences (hereinafter referred to as KRAS primer 1, KRAS primer 2 and KRAS primer 3) inserted into the target gene KRAS and the reference gene ACT1 in the genome of Saccharomyces cerevisiae (w303-1a), and the results obtained after three replicates were as follows:
the ct value corresponding to KRAS primer 1 is 15.91;
the ct value corresponding to the KRAS primer 2 is 15.73;
the ct value corresponding to the KRAS primer 3 is 15.96;
ct value for ACT1 is 15.78;
from the above results, it can be seen that there is no significant difference in ct value between any two pairs of the inserted target gene and the reference gene through t-test, p >0.05, and since Saccharomyces cerevisiae (w303-1a) is a standard haploid yeast, it can be preliminarily proved that the inserted target gene is inserted in yeast in single copy.
2. Verification of stability of Stable inheritance of inserted Gene in Yeast
Putting the recombinant saccharomyces cerevisiae cells obtained in the example 1 on a YPD plate for amplification culture, suspending yeast extract in 20% glycerol, freezing and storing at-80 ℃, and identifying that the genotype of the cells is not changed by adopting the PCR and first-generation sequencing after half a year of freezing and storing;
the recombinant saccharomyces cerevisiae cell obtained in the embodiment 1 is placed on a 4 ℃ YPD plate and stored for half a year at-20 ℃, and the genotype of the cell is identified to be unchanged by adopting the PCR and the first-generation sequencing;
the recombinant Saccharomyces cerevisiae cells obtained in example 1 were continuously passaged for 20 generations, cultured for 48 hours, and identified as unchanged in genotype by PCR and first-generation sequencing as described above.
3. The recombinant yeast cell constructed according to the method of the invention is difficult to be polluted when being used as a gene detection standard
The positive standard (plasmid standard) used in the prior art and the positive standard (cell wall-free suspension of recombinant saccharomyces cerevisiae cells of example 1) used in the above application example were subjected to PCR reaction in parallel under the same conditions;
according to detection, the plasmid standard substance used in the prior art generally has false positive when the negative control with ddH2O as a template is carried out for 3 times or more, and the positive standard substance used in the application example of the application example does not have false positive pollution when the positive standard substance is used as a PCR template for detection for 10 times or more.
4. The recombinant yeast cells constructed according to the method have counting and quantitative accuracy when being used as gene detection standards.
The recombinant yeast cells constructed according to the method can be accurately quantified through a blood count plate, an automatic counter and the like, the number of the recombinant yeast cells is the copy number of the target gene to be detected, and the copy number of the plasmid standard substance is indirectly obtained through concentration measurement and copy number calculation. Therefore, when the recombinant yeast cell constructed by the method is applied to gene detection, the accuracy of counting is more convenient for copy number quantification and the proportioning and mixing of different genotypes.
It should be understood that although the present description refers to embodiments, not every embodiment contains only a single technical solution, and such description is for clarity only, and those skilled in the art should make the description as a whole, and the technical solutions in the embodiments can also be combined appropriately to form other embodiments understood by those skilled in the art.
The above-listed detailed description is only a specific description of a possible embodiment of the present invention, and they are not intended to limit the scope of the present invention, and equivalent embodiments or modifications made without departing from the technical spirit of the present invention should be included in the scope of the present invention.
Sequence listing
<110> Shanghai Zeyin Biotech Co., Ltd
<120> genes of Saccharomyces cerevisiae cells
<130> 2017-ZY-1
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 1
cattacgaat gcacacggtg tgg 23
<210> 2
<211> 23
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 2
atccattacg aatgcacacg gtg 23
<210> 3
<211> 23
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 3
aaccaccgtg tgcattcgta atg 23
<210> 4
<211> 804
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 4
atgtcgaaag ctacatataa ggaacgtgct gctactcatc ctagtcctgt tgctgccaag 60
ctatttaata tcatgcacga aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc 120
accaaggaat tactggagtt agttgaagca ttaggtccca aaatttgttt actaaaaaca 180
catgtggata tcttgactga tttttccatg gagggcacag ttaagccgct aaaggcatta 240
tccgccaagt acaatttttt actcttcgaa gacagaaaat ttgctgacat tggtaataca 300
gtcaaattgc agtactctgc gggtgtatac agaatagcag aatgggcaga cattacgaat 360
gcacacggtg tggtgggccc aggtattgtt agcggtttga agcaggcggc ggaagaagta 420
acaaaggaac ctagaggcct tttgatgtta gcagaattgt catgcaaggg ctccctagct 480
actggagaat atactaaggg tactgttgac attgcgaaga gcgacaaaga ttttgttatc 540
ggctttattg ctcaaagaga catgggtgga agagatgaag gttacgattg gttgattatg 600
acacccggtg tgggtttaga tgacaaggga gacgcattgg gtcaacagta tagaaccgtg 660
gatgatgtgg tctctacagg atctgacatt attattgttg gaagaggact atttgcaaag 720
ggaagggatg ctaaggtaga gggtgaacgt tacagaaaag caggctggga agcatatttg 780
agaagatgcg gccagcaaaa ctaa 804
<210> 5
<211> 134
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 5
ggcacagtta agccgctaaa ggcattatcc gccaagtaca attttttact cttcgaagac 60
agaaaatttg ctgacattgg taatacagtc aaattgcagt actctgcggg tgtatacaga 120
atagcagaat gggc 134
<210> 6
<211> 141
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 6
tgtcgctctt cgcaatgtca acagtaccct tagtatattc tccagtagct agggagccct 60
tgcatgacaa ttctgctaac atcaaaaggc ctctaggttc ctttgttact tcttccgccg 120
cctgcttcaa accgctaaca a 141
<210> 7
<211> 22
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 7
ggcacagtta agccgctaaa gg 22
<210> 8
<211> 26
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 8
gcccattctg ctattctgta tacacc 26
<210> 9
<211> 38
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 9
agttctagag cggccgcttg ttagcggttt gaagcagg 38
<210> 10
<211> 38
<212> DNA
<213> Yeast cell (Saccharomyces cerevisiae)
<400> 10
accgcggtgg cggccgctgt cgctcttcgc aatgtcaa 38
<210> 11
<211> 28
<212> DNA
<213> Saccharomyces cerevisiae cell (Saccharomyces cerevisiae)
<400> 11
cggaattcac ggagtcttgc tctatcgc 28
<210> 12
<211> 31
<212> DNA
<213> Saccharomyces cerevisiae cell (Saccharomyces cerevisiae)
<400> 12
gctctagaac cttcaaggtg tcttacaggt c 31
<210> 13
<211> 20
<212> DNA
<213> Saccharomyces cerevisiae cell (Saccharomyces cerevisiae)
<400> 13
aggcctgctg aaaatgactg 20
<210> 14
<211> 23
<212> DNA
<213> Saccharomyces cerevisiae cell (Saccharomyces cerevisiae)
<400> 14
ttagttttgc tggccgcatc ttc 23
Claims (9)
1. A method for constructing a gene detection standard for genetic diagnosis, which is characterized by comprising the following steps: the construction method comprises the steps of inserting a target gene sequence to be detected into the genome of the yeast cell in a homologous recombination mode to obtain a recombinant yeast cell containing the target gene sequence;
the recombinant yeast cells are used as a positive control standard in the detection of the target gene after being subjected to protogenic treatment;
the construction method at least comprises the steps of constructing a homologous recombination template and transforming the yeast cell with the homologous recombination template;
the homologous recombination template comprises an upstream homologous repair arm and a downstream homologous repair arm, and the target gene sequence is positioned between the upstream homologous repair arm and the downstream homologous repair arm;
the upstream homologous repair arm and the downstream homologous repair arm in the homologous recombination template target auxotrophic marker genes of the yeast cells;
the construction method further comprises the step of constructing a gene editing plasmid targeting an auxotrophic marker gene of the yeast cell based on a gene editing system; and the number of the first and second electrodes,
transforming the yeast cell with the homologous recombination template and the gene editing plasmid to obtain a recombinant yeast cell in which the target gene sequence is inserted into the auxotrophic marker gene of the yeast cell.
2. The method for constructing a gene assaying standard according to claim 1, which comprises:
in the step of constructing a gene editing plasmid targeting an auxotrophic marker gene of the yeast cell based on the gene editing system: the gene editing system is a CRISPR/Cas9 gene editing system, the yeast cell is Saccharomyces cerevisiae, and the auxotroph marker gene is URA3 gene; wherein, the gene editing plasmid targets the Saccharomyces cerevisiae gene URA3 and makes the site of DNA double strand break as editing site;
in the step of constructing a homologous recombination template: firstly, constructing a homologous recombination vector based on a CRISPR/Cas9 gene editing system, wherein the homologous recombination vector contains an upstream homologous repair arm and a downstream homologous repair arm which target the editing sites; then the target gene sequence is connected into the homologous recombination vector by a molecular cloning method of restriction enzyme cutting and is positioned between the upstream homologous repair arm and the downstream homologous repair arm; finally, obtaining a linearized homologous recombination template containing the upstream homologous repair arm, the target gene sequence and the downstream homologous repair arm by a restriction enzyme cutting method;
transforming the obtained gene editing plasmid and the linearized homologous recombination template into a saccharomyces cerevisiae cell to obtain a recombinant saccharomyces cerevisiae cell in which the target gene sequence is inserted in the URA3 gene;
the step of constructing the gene editing plasmid and the step of constructing the homologous recombination template are independently completed, and are not in sequence.
3. The method for constructing a gene assaying standard according to claim 2, wherein:
in the step of constructing the gene editing plasmid, connecting the gRNA of the target Saccharomyces cerevisiae gene URA3 to a yeast-escherichia coli shuttle-type vector by a molecular cloning method of restriction enzyme digestion to obtain the gene editing plasmid;
the sequence of the gRNA of the targeting saccharomyces cerevisiae gene URA3 is shown in SEQ ID No. 1.
4. The method for constructing a gene assaying standard according to claim 3, wherein:
in the step of constructing the gene editing plasmid, the sequences of a primer pair for amplifying the gRNA are shown as SEQ ID No.2 and SEQ ID No. 3; the yeast-escherichia coli shuttle type vector is a p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector; connecting a p425-Sap-TEF1p-Cas9-CYC1t-2xSap vector subjected to SapI enzyme digestion with the gRNA, transforming the obtained connection product into escherichia coli, selecting the identified positive clone for amplification culture, and obtaining the gene editing plasmid through plasmid extraction and purification operations.
5. The method for constructing a gene assaying standard according to claim 3, wherein:
in the step of constructing a homologous recombination template, the upstream homologous repair arm is designed based on an upstream sequence at positions 351-373 in the URA3 gene sequence shown in SEQ ID No.4, and the downstream homologous repair arm is designed based on a downstream sequence at positions 351-373 in the URA3 gene sequence shown in SEQ ID No. 4.
6. The method for constructing a gene assaying standard according to claim 5, wherein:
the sequence of the upstream homologous repair arm is shown as SEQ ID No. 5; the sequence of the downstream homology repair arm is shown as SEQ ID No. 6.
7. The method for constructing a gene assaying standard according to claim 6, wherein:
in the step of constructing the homologous recombination template, the upstream homologous repair arm and the downstream homologous repair arm are respectively connected into the EcoRV enzyme cutting site and the NotI enzyme cutting site of the multiple cloning site region of the pBluescript vector by a molecular cloning method of restriction enzyme cutting; connecting the target gene sequence to any enzyme cutting site between the EcoRV enzyme cutting sites and the NotI enzyme cutting sites by a molecular cloning method of restriction enzyme cutting; finally, obtaining a linearized homologous recombination template containing the upstream homologous repair arm, the target gene sequence and the downstream homologous repair arm by a restriction enzyme cutting method;
wherein, the sequences of the primer pair for amplifying the upstream homologous repair arm are shown as SEQ ID No.7 and SEQ ID No. 8; the sequences of the primer pairs for amplifying the downstream homology repair arms are shown as SEQ ID No.9 and SEQ ID No. 10.
8. The method for constructing a gene assaying standard according to any one of claims 1 to 7, which comprises:
in the transformation step, the Saccharomyces cerevisiae W303-1A is transformed using a lithium acetate method.
9. The method for constructing a gene assaying standard according to any one of claims 1 to 7, which comprises:
the native stateThe operation process of the materialization treatment comprises the following steps: centrifuging the recombinant saccharomyces cerevisiae cells, taking supernatant, uniformly blowing and beating the sediment by using sterilized hypertonic PB solution, and adding 5 multiplied by 10 to each milliliter of the solution750U of muramidase, treating for 1h under the condition of 30 ℃ water bath, centrifuging at 4000rpm to remove supernatant, and replacing with a hypertonic PB solution without the muramidase to store the obtained cell suspension; the preparation method of the hypertonic PB liquid comprises the following steps: the solution was prepared into a PB solution with pH 6.8 using 0.2M disodium hydrogen phosphate and 0.1M citric acid, and then KCl was added to prepare a hypertonic PB solution with KCl concentration of 0.8M.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711277328.8A CN108486158B (en) | 2017-12-06 | 2017-12-06 | Construction method of gene detection standard substance based on yeast cells and kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711277328.8A CN108486158B (en) | 2017-12-06 | 2017-12-06 | Construction method of gene detection standard substance based on yeast cells and kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108486158A CN108486158A (en) | 2018-09-04 |
| CN108486158B true CN108486158B (en) | 2020-11-17 |
Family
ID=63343960
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711277328.8A Active CN108486158B (en) | 2017-12-06 | 2017-12-06 | Construction method of gene detection standard substance based on yeast cells and kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108486158B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2021145140A1 (en) * | 2020-01-16 | 2021-07-22 | 株式会社リコー | Sample for evaluating performance of genetic testing apparatus, method for preparing said sample, and device for evaluating performance, method for evaluating performance, program for evaluating performance, and apparatus for evaluating performance of genetic testing apparatus |
| CN111521460A (en) * | 2020-04-28 | 2020-08-11 | 北京橡鑫生物科技有限公司 | FFPE reference product, preparation method and application thereof |
| CN111893178A (en) * | 2020-08-24 | 2020-11-06 | 重庆市人口和计划生育科学技术研究院 | Genetic reference material for alpha thalassemia gene detection and preparation method thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005075654A1 (en) * | 2004-01-30 | 2005-08-18 | Mixis France S.A. | Generation of recombinant genes in saccharomyces cerevisiae |
| CN104212836A (en) * | 2014-09-18 | 2014-12-17 | 东华大学 | Method for knocking out mir-505 from mammal cell line |
| CN105624146A (en) * | 2015-05-28 | 2016-06-01 | 中国科学院微生物研究所 | Molecular cloning method based on CRISPR/Cas9 and homologous recombination of saccharomyces cerevisiae cell endogenous genes |
| CN105821072A (en) * | 2015-01-23 | 2016-08-03 | 深圳华大基因研究院 | CRISPR-Cas9 system used for assembling DNA and DNA assembly method |
-
2017
- 2017-12-06 CN CN201711277328.8A patent/CN108486158B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005075654A1 (en) * | 2004-01-30 | 2005-08-18 | Mixis France S.A. | Generation of recombinant genes in saccharomyces cerevisiae |
| CN1938426A (en) * | 2004-01-30 | 2007-03-28 | 麦克西斯法国股份有限公司 | Generation of recombinant genes in saccharomyces cerevisiae |
| CN104212836A (en) * | 2014-09-18 | 2014-12-17 | 东华大学 | Method for knocking out mir-505 from mammal cell line |
| CN105821072A (en) * | 2015-01-23 | 2016-08-03 | 深圳华大基因研究院 | CRISPR-Cas9 system used for assembling DNA and DNA assembly method |
| CN105624146A (en) * | 2015-05-28 | 2016-06-01 | 中国科学院微生物研究所 | Molecular cloning method based on CRISPR/Cas9 and homologous recombination of saccharomyces cerevisiae cell endogenous genes |
Non-Patent Citations (2)
| Title |
|---|
| CRISPR/Cas9技术在毕赤酵母和枯草芽孢杆菌中研究;李世宇;《中国优秀硕士学位论文全文数据库（电子期刊）》;20170630;摘要、"3.1 CRISPR/Cas9系统在毕赤醇母基因编辑中的应用" * |
| 新型转基因标准物质与标记基因检测方法研究;岳运峰;《中国优秀硕士学位论文全文数据库（电子期刊）》;20120730;摘要、"第 4 章 新型标准物质的替代性研究" * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108486158A (en) | 2018-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11441180B2 (en) | Compositions and methods for accurately identifying mutations | |
| CN107586835B (en) | Single-chain-linker-based construction method and application of next-generation sequencing library | |
| Bassett et al. | Highly efficient targeted mutagenesis of Drosophila with the CRISPR/Cas9 system | |
| CN108707629A (en) | The preparation method of zebra fish notch1b gene mutation bodies | |
| CN108486158B (en) | Construction method of gene detection standard substance based on yeast cells and kit thereof | |
| US8722408B2 (en) | Trap vectors and gene trapping method by using the same | |
| JP2022522019A (en) | Non-targeted single nucleotide mutations by single nucleotide editing and highly specific off-target single nucleotide gene editing tools that avoid such mutations | |
| Chalker | Transformation and strain engineering of Tetrahymena | |
| CN113584079A (en) | Establishment of zebra fish heart specific marker strain applied to calcium ion imaging | |
| CN110066805A (en) | The method of gene knockout breeding adgrf3b Gene Deletion zebra fish | |
| CN111893178A (en) | Genetic reference material for alpha thalassemia gene detection and preparation method thereof | |
| CN110250108B (en) | RPRM gene knockout mouse model and construction method and application thereof | |
| CN110724735A (en) | SNP (Single nucleotide polymorphism) locus and primer for rapidly identifying individual sex of fugu obscurus and method thereof | |
| CN115261360A (en) | Method for constructing gata6 gene knockout zebra fish model | |
| WO2018009863A1 (en) | Scramble of heterozygous diploid yeast | |
| CN113774128B (en) | Gja8 application of gene mutation site in preparation of product for diagnosing cataract disease | |
| CN113699254B (en) | Sex-specific DNA (deoxyribonucleic acid) marker for large trichromatic and Zhaobiao trichromatic koi and application thereof | |
| CN113718042B (en) | Sex-specific DNA (deoxyribonucleic acid) marker for red and white koi and application thereof | |
| KR101515861B1 (en) | Polymerase chain reaction method for identification of introduced exotic gene number in brassicaceae | |
| CN110129359B (en) | Method for detecting gene editing event and determining gene editing efficiency and application thereof | |
| CN117587008A (en) | Nucleic acid product of targeting Rbmxl2 gene and construction method of animal model of oligospermia | |
| WO2021051484A1 (en) | CRISPR/CAS9 SYSTEM AND APPLICATION THEREOF IN CONSTRUCTION OF α, β, AND α&AMP;β THALASSEMIA MODEL PORCINE CELL LINES | |
| CN115029382A (en) | Preparation method of genetically modified mouse capable of distinguishing Tbx1 two variable spliceosomes | |
| CN118028378A (en) | Model mouse for knocking out microglial cell-derived VDBP gene and construction method thereof | |
| WO2024092186A2 (en) | Genes conferring resistance to anthracnose fruit rot of strawberries |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |