CN108486158A - The construction method and its kit of genetic test standard items based on yeast cells - Google Patents
The construction method and its kit of genetic test standard items based on yeast cells Download PDFInfo
- Publication number
- CN108486158A CN108486158A CN201711277328.8A CN201711277328A CN108486158A CN 108486158 A CN108486158 A CN 108486158A CN 201711277328 A CN201711277328 A CN 201711277328A CN 108486158 A CN108486158 A CN 108486158A
- Authority
- CN
- China
- Prior art keywords
- homologous
- arm
- gene
- sequence
- yeast
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/87—Introduction of foreign genetic material using processes not otherwise provided for, e.g. co-transformation
- C12N15/90—Stable introduction of foreign DNA into chromosome
- C12N15/902—Stable introduction of foreign DNA into chromosome using homologous recombination
- C12N15/905—Stable introduction of foreign DNA into chromosome using homologous recombination in yeast
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
- C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
- C12N9/22—Ribonucleases RNAses, DNAses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
Landscapes
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Genetics & Genomics (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Plant Pathology (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The construction method and its kit of the present invention relates to a kind of genetic test standard items based on yeast cells, yeast cells is used in a creative way for the first time as genetic background, by target gene to be detected, such as human body cell mutator, it is integrated into the genome of yeast cells by way of homologous recombination, thus obtained recombinant yeast cell can be in the Genetic Detection for target gene as the standard items of positive control.
Description
Technical field
The construction method and its kit of the present invention relates to a kind of genetic test standard items based on yeast cells, belong to point
Sub- biology techniques field.
Background technology
In clinical genetic diagnosis, the accuracy of genetic test is highly important.By taking antenatal exaination as an example, false positive
Result can the patient that instructs of mistake terminate normal embryo, the result of false negative can cause it is expected to the optimism of sick baby and
Error diagnosis.Clinically, Genetic Detection is often the basis for instructing to be formed diagnosis and treatment scheme.More and more people are examined using heredity
It surveys to obtain individual probability susceptible in crowd, to take effective prophylaxis, including intervention diagnosis and therapy means and life
The change etc. of mode living.
In order to ensure the reliability and accuracy of Genetic Detection result, each experiment must have as positive control and the moon
Property control hereditary reference material.
Genetic Detection standard items more common at present have following several：
Patient's sample；
(operation excision/puncturing tissue, formalin fix/paraffin embedding/frozen section/fresh sample to tumor tissues sample
This etc.) blood sample (circulating tumor cell, free tumor cell gene group)；
Cell line containing genetic mutation；
The immortalized cell lines such as various hereditary diseases, tumour；
Cytogenetics transformation (integrates insertion, rite-directed mutagenesis, gene knockout)；
The gene knock-in of other cellular contexts；
Zhi Liyangpin ＆PCR products：Recombinant plasmid containing mutational site and neighbouring sequence or PCR product；
Synthetic DNA sample；
Above-mentioned various types of Genetic Detection standard items have the benefit and limitation of its own.For example, clinical disease proper manners
That there are sample acquisitions is inconvenient for this, sample is precious, homogeneity is bad, can not largely prepare the defects of standard items；It is thin to obtain hereditary disease
Born of the same parents system is often through patient's cell immortality, and immortalized cell line hereditary capacity is difficult to keep for a long time；Cell containing Tumor mutations
System builds that strain is difficult and unstable, and the building process of cell line containing genetic mutation is cumbersome, needs complicated screening process while cell line
Expensive, condition of culture is more demanding；Plasmid samples structure is simple and quick, but plasmid copy number is high in system, dilution and mould
It pseudogene group DNA and carries out that when the mixing of relatively low mutation percentage standard items prodigious error, easy to pollute can be caused.
Therefore, it is those skilled in the art's urgent problem to be solved to build new genetic test standard items system.
Invention content
In view of the above problem and/or other problems of the relevant technologies, one aspect of the present invention provides a kind of genetic test mark
The construction method of quasi- product, the construction method include to be inserted into objective gene sequence to be detected by way of homologous recombination
The recombinant yeast cell containing the objective gene sequence is obtained in the genome of yeast cells；The recombinant yeast cell is in needle
To being used as positive control standard items in the detection of the target gene.
Preferably, the construction method includes at least the step of structure homologous recombination template, and by the homologous recombination
Template converts the step of yeast cells；The homologous recombination template includes the homologous reparation arm in upstream and the homologous reparation in downstream
Arm, and positioned at the homologous objective gene sequence repaired between the homologous reparation arm of arm and downstream in the upstream；It is described homologous
The homologous nutrient defect type mark base repaired the homologous reparation arm of arm and downstream and target the yeast cells in upstream in recombination template
Cause.
Preferably, the construction method further includes building the nutrition for targeting the yeast cells based on gene editing system
The step of gene editing plasmid of deficiency marker gene；Also, by the homologous recombination template and the gene editing plasmid
The yeast cells is converted together, and acquisition inserts the purpose base in the nutrient defect type mark gene of the yeast cells
Because of the recombinant yeast cell of sequence.
Preferably, the nutrient defect type mark base for targeting the yeast cells is built based on gene editing system described
In the step of gene editing plasmid of cause：The gene editing system is CRISPR/Cas9 gene editing systems, and the yeast is thin
Born of the same parents are saccharomyces cerevisiae, and the nutrient defect type mark gene is URA3 genes；Wherein, the gene editing plasmid targets the wine
Brewer yeast gene URA3 simultaneously makes the site that its DNA double chain is broken for editing sites；
In the structure homologous recombination template the step of：It is same to be primarily based on CRISPR/Cas9 gene editing systems structure
Source recombinant vector, the homologous recombination vector contain the homologous reparation arm in upstream for targeting the editing sites and the homologous reparation in downstream
Arm；The objective gene sequence is connected by the molecular cloning method of restricted digestion in the homologous recombination vector again,
And between the homologous reparation arm of the homologous reparation arm in the upstream and downstream；Finally, then by restricted digestion method it obtains
Homologous recombination containing the homologous linearisation for repairing arm, the homologous reparation arm of the objective gene sequence and the downstream in the upstream
Template；
In the gene editing plasmid that will be obtained together with the homologous recombination template of the linearisation transformed saccharomyces cerevisiae
Cell obtains the recombinant Saccharomyces cerevisiae cell that the objective gene sequence is inserted in URA3 genes；
The step of the step of structure gene editing plasmid and structure homologous recombination template respective complete independently, no
Successively.
Preferably, in the structure gene editing plasmid the step of, the gRNA for targeting genes of brewing yeast URA3 is led to
The molecular cloning method for crossing restricted digestion is connected in yeast-E. coli fabric shuttle-type carrier, obtains the gene editing matter
Grain；The sequence of the gRNA of the targeting genes of brewing yeast URA3 is as shown in SEQ ID No.1.
Preferably, in the structure gene editing plasmid the step of, the primer pair sequence such as SEQ of the gRNA is expanded
Shown in ID No.2 and SEQ ID No.3；The yeast-E. coli fabric shuttle-type carrier is p425-Sap-TEF1p-Cas9-
CYC1t-2xSap carriers；The p425-Sap-TEF1p-Cas9-CYC1t-2xSap carriers of SapI digestions and the gRNA are connected
Connect, the connection product of acquisition converted into Escherichia coli, choose identified positive colony and carry out amplification cultivation, through plasmid extraction and
Purification process obtains the gene editing plasmid.
Preferably, in the structure homologous recombination template the step of, the URA3 genes as shown in SEQ ID No.4 are based on
351-373 upstream sequences design the homologous reparation arm in upstream in sequence, based in as shown in SEQ ID No.4
351-373 downstream sequences design the homologous reparation arm in downstream in URA3 gene orders.
Preferably, the homologous sequence for repairing arm in the upstream is as shown in SEQ ID No.5；The homologous reparation arm in downstream
Sequence is as shown in SEQ ID No.6.
Preferably, in the structure homologous recombination template the step of, first by the homologous reparation arm in the upstream and described
The homologous multiple cloning sites repaired arm and be connected into pBluescript carriers respectively by the molecular cloning method of restricted digestion in downstream
EcoRV the and NotI restriction enzyme sites in region；The objective gene sequence is connected by the molecular cloning method of restricted digestion again
Enter to any one restriction enzyme site between EcoRV the and NotI restriction enzyme sites；Finally pass through restricted digestion method again
It obtains containing the homologous of the homologous linearisation for repairing arm, the homologous reparation arm of the objective gene sequence and the downstream in the upstream
Recombination template；
Wherein, for expanding the homologous primer pair sequence for repairing arm in the upstream as shown in SEQ ID No.7 and SEQ ID
Shown in No.8；For expanding the homologous primer pair sequence for repairing arm in the downstream as shown in SEQ IDNo.9 and SEQ ID No.10
It is shown.
Preferably, in the step of converting, Li-acetate method transformed saccharomyces cerevisiae cell W303-1A is used.
Another aspect of the present invention additionally provides a kind of kit of structure genetic test standard items, and the kit includes：
The gene editing plasmid of targeting genes of brewing yeast URA3 based on CRISPR/Cas9 gene editing systems structure is based on
The homologous recombination vector of CRISPR/Cas9 gene editing systems structure and brewing yeast cell system, wherein wherein, the base
It is described homologous because editor's plasmid targets the genes of brewing yeast URA3 and makes the site that its DNA double chain is broken for editing sites
Recombinant vector contains the homologous reparation arm of the homologous reparation arm in upstream and downstream for targeting the editing sites.
Preferably, the gene editing plasmid is that the gRNA of targeting genes of brewing yeast URA3 is connected to yeast-large intestine bar
The connection product of SapI restriction enzyme sites in bacterium fabric shuttle-type carrier p425-Sap-TEF1p-Cas9-CYC1t-2xSap, the target
To genes of brewing yeast URA3 gRNA sequence as shown in SEQ IDNo.1；The homologous recombination vector contains the targeting volume
Collect the homologous reparation arm of the homologous reparation arm in upstream and downstream in site, wherein the homologous sequence such as SEQ ID for repairing arm in the upstream
Shown in No.5；The homologous sequence for repairing arm in the downstream is as shown in SEQ ID No.6；The brewing yeast cell system is wine brewing ferment
Mother cell W303-1A.
The construction method and its kit of the genetic test standard items of the present invention, use yeast cells in a creative way for the first time
As genetic background, target gene (for example, human body cell mutator) to be detected is integrated by way of homologous recombination
Into the genome of yeast cells, thus obtained recombinant yeast cell can be in the detection for target gene as the positive
The standard items of control.Compared with the standard items of the prior art, on the one hand construction method of the invention avoids such as plasmid or conjunction
At easy to pollute existing for the existing standard items such as DNA, the holding time is short, can not accurate quantification defect, on the other hand with it is existing
The cell line containing genetic mutation as standard items is compared, and is eliminated complicated cell line structure, is reduced cost, but similarly
Specific mutation and copy number can be obtained, DNA extractions, amplification and easy to detect；In another aspect, being used as standard items with existing
Immortalized cell line compared with genetically modified cell system, have homologous recombination efficiency high, genome list copy is cultivated easy to be fast
The advantages such as victory.Furthermore yeast cells incubation and DNA extraction process are also all simple and practicable, and can pass through protoplast formation
Process cell is removed into wall, improve the consistency using operation with human body cell form and standard items.In addition, yeast cells can be with
The exogenous DNA of larger segment is accommodated, the missing of large fragment, the genetic test standard items for repeating even chromosome number variation all may be used
To be transformed and use using it as genetic background.
Description of the drawings
Fig. 1 is the restriction enzyme site collection of illustrative plates of pBluescript carriers；
Fig. 2 is the PCR qualification results for the positive colony (brewing yeast cell after conversion) that embodiment 1 obtains.
Specific implementation mode
Below with reference to specific implementation mode shown in the drawings, the present invention will be described in detail.But these embodiments are simultaneously
The present invention is not limited, structure that those skilled in the art are made according to these embodiments, method or functionally
Transformation is included within the scope of protection of the present invention.
Example embodiment is described more fully with reference to the drawings.However, example embodiment can be with a variety of shapes
Formula is implemented, and is not understood as limited to embodiment set forth herein；On the contrary, thesing embodiments are provided so that the present invention will
Fully and completely, and by the design of example embodiment comprehensively it is communicated to those skilled in the art.
Material used in following example, reagent etc., are commercially available unless otherwise specified.Embodiment
In particular technique or condition person is not specified, according to technology described in document in the art or condition (such as with reference to J. Pehanorms
The works such as Brooker, what Huang Peitang etc. was translated《Molecular Cloning:A Laboratory guide》The third edition, Science Press) or according to product description into
Row.
In one embodiment of the invention, on the one hand inventor provides a kind of gene based on yeast cells
The construction method of examination criteria product, the construction method include to insert objective gene sequence to be detected by way of homologous recombination
Enter into the genome of yeast cells and obtains the recombinant yeast cell containing the objective gene sequence；The recombinant yeast cell
It is used as positive control standard items in the detection for the target gene.
About the scheme of aforementioned present invention, inventor uses yeast cells as genetic background in a creative way for the first time, incites somebody to action
Target gene (human body cell mutator) to be detected is integrated by way of homologous recombination in the genome of yeast cells,
Thus obtained recombinant yeast cell can be in the detection for target gene as the standard items of positive control.
Although in molecular biology field, yeast cells is widely used, and is specific to the subdivision neck of genetic diagnosis
In domain, yeast cells is never used as to the carrier of the standard items of structure Genetic Detection.
In addition to the sample for directly using clinical patient, the construction method of the standard items of some is disclosed in the prior art,
But the process for building the cell line containing genetic mutation is extremely complex, and double copy characteristics of human genome so that there are heterozygosis to dash forward
The possibility of change, the standard items for building plasmid are although simple and quick, but the plasmid copy number in system is very high, dilution and simulation base
Because of group DNA and be easy to cause error and pollute when the mixing of relatively low mutation percentage standard items.
Inventor is by a large amount of research, it has unexpectedly been found that, yeast cells is highly suitable as the standard items of Genetic Detection
Carrier, haploid yeast cells is that homozygous mutation individual can be directly obtained after genetic recombination, in particular, haploid
Wild type yeast cells can be by the side of counting after being mixed in varing proportions with the recombinant yeast cell for having imported target gene
Formula obtains standard items accurate in scale；Yeast cells is stored in after protoplast formation in hypertonic solution, is the back of the body with human body cell
The standard items of scape possess the form of similar acellular wall, and genomic DNA, cell suspension, FFPE blocks and slice, thin can be made
The forms such as born of the same parents' smear meet the actual needs of multiple standards product form.
Furthermore yeast cells can accommodate the exogenous DNA of larger segment, and the operation of genetic recombination is more convenient；In addition yeast
The incubation and DNA extraction process of cell are also all simple and practicable.
In a preferred embodiment of the invention, the construction method includes at least the step of structure homologous recombination template
Suddenly, the step of and by the homologous recombination template converting the yeast cells；The homologous recombination template includes that upstream is homologous
Arm and the homologous reparation arm in downstream are repaired, and positioned at the homologous mesh repaired between the homologous reparation arm of arm and downstream in the upstream
Gene order；The upstream is homologous to repair the homologous nutrient defect type mark repaired arm and target the yeast cells of arm and downstream
Gene.
" the nutrient defect type mark gene about yeast cells " is explained as follows：Certain gene quilts in Yeast genome
After destruction, yeast cells loses the ability for synthesizing certain life necessary materials, cannot be grown on minimal medium, it is necessary to train
It supports and supplements corresponding nutriment ability normal growth in base.These genes all can serve as the screening mark in yeast genes operation
Note.For example, it (is respectively tryptophan, leucine and group that the nutrient defect type mark gene of yeast cells, which has TRP1, Leu2, His3,
The synthesis deficiency marker gene of propylhomoserin), URA3 (uracil synthesizes deficiency marker gene), (ochre mutation inhibits base to SUP4
Cause) etc..
In a more preferred embodiment of the present invention, the construction method further includes based on gene editing system come structure
The step of building the gene editing plasmid for the nutrient defect type mark gene for targeting the yeast cells；Also, it will be described homologous heavy
Group template converts the yeast cells together with the gene editing plasmid, obtains the auxotroph mark in the yeast cells
The recombinant yeast cell of the objective gene sequence is inserted in note gene.
Refer to that " editor " is carried out to target gene about " gene editing ", realizes the knockout to specific DNA fragments, is added
Deng.The selection of tool/system about gene editing, other than current popular CRISPR/Cas systems, also zinc finger core
Sour enzyme (ZFNs), activating transcription factor effector nuclease (TALENs) etc..ZFNs and TALENs is the DNA by protein
Binding domain and FokI cutting domains form dimer to cut target gene.But two kinds of gene editing tools and CRISPR/Cas systems
System is compared, less efficient.CRISPR/Cas systems need to only be designed for the RNA of target-gene sequence complementation and into host cell
Import the gene of coding Cas9 albumen.CRISPR/Cas systems are to the base pairing that the identification of target sequence is RNA and DNA
Journey, more accurate to the identification of target-gene sequence, recognition site diversification, which greatly enhances the efficiency of genetic manipulation.
In the present solution, in transformed yeast cell, the gene editing plasmid of structure targets the nutrition of the yeast cells
Deficiency marker gene simultaneously makes its DNA double chain be broken, and can greatly improve the efficiency of homologous recombination in this way.
In one embodiment of the invention, the yeast is targeted to build based on gene editing system described
In the step of gene editing plasmid of the nutrient defect type mark gene of cell：The gene editing system is CRISPR/Cas9
Gene editing system, the yeast cells are saccharomyces cerevisiae, and the nutrient defect type mark gene is URA3 genes；Wherein, institute
Gene editing plasmid is stated to target the genes of brewing yeast URA3 and make the site that its DNA double chain is broken for editing sites；
In the structure homologous recombination template the step of：It is same to be primarily based on CRISPR/Cas9 gene editing systems structure
Source recombinant vector, the homologous recombination vector contain the homologous reparation arm in upstream for targeting the editing sites and the homologous reparation in downstream
Arm；The objective gene sequence is connected by the molecular cloning method of restricted digestion in the homologous recombination vector again,
And between the homologous reparation arm of the homologous reparation arm in the upstream and downstream；Finally, then by restricted digestion method it obtains
Homologous recombination containing the homologous linearisation for repairing arm, the homologous reparation arm of the objective gene sequence and the downstream in the upstream
Template；
In the gene editing plasmid that will be obtained together with the homologous recombination template of the linearisation transformed saccharomyces cerevisiae
Cell obtains the recombinant Saccharomyces cerevisiae cell that the objective gene sequence is inserted in URA3 genes；
The step of the step of structure gene editing plasmid and structure homologous recombination template respective complete independently, no
Successively.
It in above-mentioned specific embodiment, has selected to be easily obtained and brewing yeast cell easy to operate, and will " wine brewing
Yeast genes URA3 " is used as target spot, wherein URA3 is the gene for encoding -5 phosphate decarboxylase of orotidine, and -5 phosphoric acid of orotidine is de-
Carboxylic acid is a key enzyme in yeast rna pyrimidine nucleotide building-up process.If -5 phosphate decarboxylase of orotidine inactivates, yeast
It can not just grow, show as uridine or uracil auxotrophy and the acidproof phenotypes of 5-FOA.Therefore, URA3 genes are in saccharomycete point
Sub- genetics research is widely used in auxotrophy selection markers.As long as supplementing uridine or uracil, yeast in the medium
It can normal growth；It knocks out URA3 genes, be inserted into the normal growth that exogenous sequences do not interfere with yeast thereto, therefore, invention
Person selects the safe site that URA3 genes are inserted into as exogenous array.
About the genetic recombination of yeast cells, compiled using CRISPR/Cas9 genes in specific embodiments of the present invention
The system of collecting, specifically, CRISPR/Cas9 gene editings system can efficiently mediate fixed point DNA double chain fracture, it will usually swash
Non-homologous end joining mechanism (NHEJ) in living cells is repaired, and introduce therewith the insertion of non-purpose, missing and other
Mutation, this principle is widely used in gene knockout.And DNA double chain fracture can similarly be repaired by homologous recombination machinery, when
When we introduce single-stranded or double-stranded recombination template, so that it may with the insertion target sequence of specificity.
In a preferred embodiment of the invention, in the structure gene editing plasmid the step of, targeting is made
The gRNA of brewer yeast gene URA3 is connected to yeast-E. coli fabric shuttle-type carrier by the molecular cloning method of restricted digestion
In, obtain the gene editing plasmid；The sequence such as SEQ ID No.1 institutes of the gRNA of the targeting genes of brewing yeast URA3
Show.
The design of the sequence of gRNA about targeting genes of brewing yeast URA3, inventor are based on http://
Several sequences that may be suitble to target the gRNA of genes of brewing yeast URA3 of crispr.dbcls.jp/ website designs, and successively
It is annealed and is connected in yeast-E. coli fabric shuttle-type carrier, then successful plasmid transformed yeast cell will be built, take Dan Ke
It is grand to pass through its editorial efficiency of sequence verification；Inventor passes through a large amount of verification test, finds to work as the targeting genes of brewing yeast
When the sequence of the gRNA of URA3 is as shown in SEQ ID No.1, editorial efficiency highest.
In the further preferred embodiment of the present invention, the structure gene editing plasmid the step of in, expand
The primer pair sequence of the gRNA is as shown in SEQ ID No.2 and SEQ ID No.3；The yeast-E. coli fabric shuttle-type carries
Body is p425-Sap-TEF1p-Cas9-CYC1t-2xSap carriers；By the p425-Sap-TEF1p-Cas9- of SapI digestions
CYC1t-2xSap carriers are connect with the gRNA, and the connection product of acquisition is converted Escherichia coli, choose identified positive gram
Grand carry out amplification cultivation obtains the gene editing plasmid through plasmid extraction and purification process.
In another further preferred embodiment of the present invention, the structure homologous recombination template the step of in, base
The homologous reparation in upstream as described in 351-373 upstream sequence designs in the URA3 gene orders shown in SEQ ID No.4
Arm, it is same based on downstream as described in the 351-373 downstream sequence designs in the URA3 gene orders shown in SEQ ID No.4
Repair arm in source.
Specifically, when the sequence of the gRNA of the targeting genes of brewing yeast URA3 is as shown in SEQ ID No.1, warp
It is connected to yeast-E. coli fabric shuttle-type carrier and is transformed into verification after yeast cells, the URA3 genes of yeast cells
351-373 random appearance DNA double chain fractures；Inventor is based on the URA3 gene orders as shown in SEQ ID No.4 as a result,
In 351-373 upstreams sequence design described in the homologous reparation arm in upstream, based in the URA3 bases as shown in SEQ ID No.4
Because of the homologous reparation arm in downstream described in the sequence design in 351-373 downstreams in sequence.
It is furthermore preferred that by the design and experimental verification of inventor, the homologous sequence such as SEQ for repairing arm in the upstream
Shown in ID No.5；The homologous sequence for repairing arm in the downstream is as shown in SEQ ID No.6.
It is furthermore preferred that in the structure homologous recombination template the step of, first by the homologous reparation arm in the upstream and institute
State the homologous polyclonal position repaired arm and be connected into pBluescript carriers respectively by the molecular cloning method of restricted digestion in downstream
EcoRV the and NotI restriction enzyme sites in point region；The objective gene sequence is passed through into the molecular cloning method of restricted digestion again
Any one restriction enzyme site being connected between EcoRV the and NotI restriction enzyme sites；Finally pass through the side of restricted digestion again
Method is obtained containing the same of the homologous linearisation for repairing arm, the homologous reparation arm of the objective gene sequence and the downstream in the upstream
Source recombination template；Wherein, for expanding the homologous primer pair sequence for repairing arm in the upstream as shown in SEQ ID No.7 and SEQ
Shown in ID No.8；For expanding the homologous primer pair sequence for repairing arm in the downstream as shown in SEQ ID No.9 and SEQ ID
Shown in No.10.
Finally, with regard to the acquisition for the objective gene sequence being inserted into, by amplifying target genes sequence (for example, amplification is true
What the DNA sequence dna containing mutator to be detected or amplification rite-directed mutagenesis PCR were obtained surely contains mutator to be detected
DNA sequence dna.The restriction enzyme sites such as EcoRI, XmaI, SmaI, BamHI, XbaI may be selected in the target gene that amplification is inserted into,
Amplimer both ends add suitable restriction enzyme site and protection base, the segment expanded are connected to by digestion above-mentioned same
In the recombinant vector of source.
In a preferred embodiment of the invention, in the step of converting, wine brewing ferment is converted using Li-acetate method
Mother cell W303-1A.
In one embodiment of the invention, inventor's further aspect provides a kind of structure genetic test standard
The kit of product, the kit include：Targeting genes of brewing yeast based on CRISPR/Cas9 gene editing systems structure
The gene editing plasmid of URA3, homologous recombination vector and saccharomyces cerevisiae based on CRISPR/Cas9 gene editing systems structure
Cell line, wherein wherein, the gene editing plasmid targets the genes of brewing yeast URA3 and its DNA double chain is made to be broken
Site is editing sites, and the homologous recombination vector contains the homologous reparation arm in upstream for targeting the editing sites and downstream is homologous
Repair arm.
In a preferred embodiment of the invention, the gene editing plasmid is targeting genes of brewing yeast URA3
GRNA is connected to the SapI digestions in yeast-E. coli fabric shuttle-type carrier p425-Sap-TEF1p-Cas9-CYC1t-2xSap
The connection product in site, the sequence of the gRNA of the targeting genes of brewing yeast URA3 is as shown in SEQ ID No.1；It is described homologous
Recombinant vector contains the homologous reparation arm of the homologous reparation arm in upstream and downstream for targeting the editing sites, wherein the upstream is same
The sequence of arm is repaired as shown in SEQ ID No.5 in source；The homologous sequence for repairing arm in the downstream is as shown in SEQ ID No.6；Institute
It is brewing yeast cell W303-1A to state brewing yeast cell system.
In the above scheme, kit is mating with above-mentioned construction method, specifically, structure is included in kit
The gene editing plasmid built up, the homologous recombination vector having had been built up and brewing yeast cell system to be transformed；User purchases
After having bought the kit, it is only necessary to be connected to by restricted digestion method objective gene sequence to be detected homologous heavy
In group carrier (and between the homologous reparation arm of the homologous reparation arm in upstream and downstream), then obtained by restricted digestion method
The homologous recombination template of linearisation, finally by the linearisation homologous recombination template containing objective gene sequence and ready-made base
Because editing plasmid transformed saccharomyces cerevisiae cell line together, to obtain the recombinant yeast cell containing objective gene sequence, the recombination
Yeast cells is used as positive control standard items in the detection for target gene.
Embodiment 1
Below with " the significant correlation gene mutation of Non-small cell lung carcinoma is c.35G>For C (hereinafter referred to as G12A mutation),
Build the yeast cells standard items (positive criteria product) for detecting G12A mutation.
Step (a)：The gene editing of targeting genes of brewing yeast URA3 is built based on CRISPR/Cas9 gene editing systems
Plasmid；
In step (a), inventor selects yeast-E. coli fabric shuttle-type carrier, specifically, selection p425-Sap-
TEF1p-Cas9-CYC1t-2xSap carriers (commercially available)；
In step (a), inventor devises the sequence of the gRNA of targeting genes of brewing yeast URA3, specifically, gRNA
Sequence be：Cattacgaatgcacacggtgtgg (as shown in SEQ ID No.1)；It is anti-according to the gRNA sequence designs two
To complementary primer (in addition, being that can be carried with p425-Sap-TEF1p-Cas9-CYC1t-2xSap specifically in the present embodiment
The SapI digestion notches of body match, by primer both ends polishing), primer sequence is as follows：
Positive sequence (F)：5 '-atccattacgaatgcacacggtg -3 ' (as shown in SEQ ID No.2)；
Reverse sequence (R)：5 '-aaccaccgtgtgcattcgtaatg -3 ' (as shown in SEQ ID No.3)；
Wherein, the dashed part " aac " at 5 ' ends of the dashed part " atc " and reverse sequence at 5 ' ends of positive sequence is to mend
Neat part.
By the primer of two reverse complementals by annealed combination, annealing system totally 20 μ l, wherein containing：10xNEBbuffer 2
Each 5 μ l of μ l, 100 μM of F/R；Slow near room temperature after 95 DEG C of 5min.
The p425-Sap-TEF1p-Cas9-CYC1t-2xSap carriers of SapI digestions are connect (connection with annealed product
System totally 10 μ l, wherein containing：10xT4ligase buffer 1 μ l, digestion carrier 50ng, 1 μ l of annealed product) conversion large intestine bar
Bacterium DH5 α (commercially available, to be purchased from TIANGEN Biotech (Beijing) Co., Ltd.) article No. CB101), identification and acquisition positive colony；Reagent
Box (commercially available, to be purchased from company of Axygen companies, 35715KA1 product types) extraction plasmid.
Successful plasmid will be built by LiAc method transformed saccharomyces cerevisiae W303-1A, monoclonal is taken to pass through sequence verification；Through
Verification, through this embodiment after the plasmid transformed saccharomyces cerevisiae W303-1A of step (a) acquisition, in the 351-373 of gene URA3
Position (based on 351-373 in the URA3 gene orders such as SEQ ID No.4 shown in) at random cause DNA double chain to be broken；By
The plasmid that this identification the present embodiment step (a) obtains is " the gene editing plasmid of targeting genes of brewing yeast URA3 ".
Step (b)：Prepare homologous recombination template；
First, CRISPR/Cas9 gene editing systems are based on and build homologous recombination vector；
(b-1)：The homology arm of targeting editing sites of inventor's design based on Cas9 systems；As described above, step (a) obtains
The editing sites of the gene editing plasmid of the targeting genes of brewing yeast URA3 taken are located at the 351-373 of gene URA3 sequences
Position, therefore, the homologous reparation arm in sequence design upstream of the inventor based on 351-373 upstreams, based on 351-373
The homologous reparation arm in sequence design downstream in downstream.
The homologous sequence for repairing arm in upstream designed is as shown in SEQ ID No.5 (134bp), the homologous reparation arm in downstream
Sequence as shown in SEQ ID No.6 (141bp).
(b-2)：Inventor above-mentioned editing sites upstream and downstream near 150bp, with Premier5 software Design primers,
The primer of verified use is as follows：It is (positive as shown in SEQ ID No.7 for expanding the homologous primer pair sequence for repairing arm in upstream
Sequence) and SEQ ID No.8 shown in (reverse sequence)；For expanding the homologous primer pair sequence such as SEQ ID for repairing arm in downstream
Shown in (positive sequence) and SEQ ID No.10 shown in No.9 (reverse sequence).
The homologous reparation arm of upstream and downstream is obtained by PCR amplification, specifically：
PCR system：5 μ l, the 25mM MgSO containing 10 × KOD buffer in 50 μ l PCR systems43 μ l, 2mM dNTPs 5
μ l, 10 μM of upstream and downstream primers each 1 μ l of 1 μ l, Kod-Plus-Neo, the plasmid template 5-10ng of the gene order containing URA3；Wherein,
Using KOD-Plus-Neo PCR high fidelity enzymes, it is purchased from TOYOBO companies, article No. KOD-40；
PCR conditions：94 DEG C of pre-degeneration 2min, three-step approach amplification, wherein 98 DEG C of denaturation 10s, 58 DEG C of annealing 30s, 68 DEG C are prolonged
50s is stretched, extends 68 DEG C of extension 5min, 4 DEG C of holdings after 40 cycles.
With the gel reclaims kit AP-GX-250 recycling of Axygen companies after PCR product electrophoresis detection.
(b-3)：The homologous homologous arm of repairing of arm and downstream of repairing in upstream is divided by the molecular cloning method of restricted digestion
Be not connected into the multiple cloning sites region of pBluescript carriers EcoRV and NotI restriction enzyme sites (pBluescript carriers
Restriction enzyme site collection of illustrative plates is referring to Fig. 1), obtain the same of the homologous reparation arm of the homologous reparation arm in the upstream containing targeting editing sites and downstream
Source recombinant vector.
Concrete operations are as follows：
PBluescript carriers are commercially available, and are purchased from You Bao biotech firms, product type VT1892.
Digestion：PBluescript carriers with the digestion of EcoRV restriction enzymes (BioLab, article No. R0195V, to specifications side
Method use)；The 1 μ g containing 10 × NEB buffer3.1,5 μ l, EcoRV enzymes, 1 μ l, pBluescript carrier in 50 μ l digestion systems,
37 DEG C of reaction 2h；The gel reclaims kit AP-GX-250 of Axygen companies of the pBluescript carriers after digestion is returned again
It receives.
Connection：The homologous reparation arm pieces section in upstream that gel in above-mentioned (b-2) step is recycled and above-mentioned EcoRV restriction enzymes
PBluescript carriers after cutting use the T4DNA ligases (article No. M0202) of BioLab companies, and Connection Step is according to T4DNA
The specification of ligase operates --- containing after 10 × T4 ligases buffer, 1 μ l, EcoRV digestions in 10 μ l linked systems
PBluescript carriers 50ng (20-200ng/ μ l), the homologous reparation arm pieces section 30ng (50-100ng/ in upstream of kit recycling
μ l), T4 ligases 1 μ l, ddH2O polishings；Room temperature connects 2h；
Verification：By above-mentioned connection product convert competent escherichia coli cell (DH5 α, Tiangeng biochemical technology Co., Ltd,
Article No. CB101), the picking white colonies after LB tablet cultures 12-16h connect correctly clone by generation sequence verification.
Digestion：The above-mentioned homologous carrier for the repairing arm NotI in upstream that is connected to is limited into digestion (BioLab, article No.
R0189V, to specifications method use), the 1 μ l containing 10 × NEB buffer3.15 μ l, NotI enzyme in 50 μ l digestion systems, even
Homologous pBluescript carriers 1 the μ g, 37 DEG C of reaction 2h for repairing arm in upstream is met.Carrier Axygen companies after digestion
Gel reclaims kit AP-GX-250 recycling.
Connection：The homologous reparation arm pieces section in downstream that gel in above-mentioned (b-2) step is recycled and above-mentioned NotI restriction enzymes
Carrier after cutting uses Shanghai Jinan Technology Co., Ltd.,Mono- step directed cloning kits (seamless clone) of PCR
(NR001), method uses to specifications, by the homologous carrier repaired arm pieces section and be connected into NotI restriction enzyme digestions in downstream.
Verification：Connection product is converted into competent escherichia coli cell (DH5 α, Tiangeng biochemical technology Co., Ltd, article No.
CB101), choose monoclonal and correctly clone is connected by generation sequence verification, that is, obtain homologous recombination vector and (be inserted into purpose base
Because of the homologous recombination frame carrier of sequence).
(b-4)：Then, then by the objective gene sequence being inserted by the molecular cloning method of restricted digestion it is connected into
In the homologous recombination vector of above-mentioned acquisition and between the homologous reparation arm of the homologous reparation arm in upstream and downstream, to be contained
The homologous recombination vector of purposeful gene order, specifically：
About the target gene being inserted into, above-mentioned G12A mutators have been selected in the present embodiment.About target gene
The acquisition pattern of sequence can determine the DNA sequence dna containing mutator to be detected or amplification rite-directed mutagenesis by expanding
The DNA sequence dna containing mutator to be detected that PCR is obtained.
For the objective gene sequence being inserted into is connected in homologous recombination vector and positioned at the homologous reparation arm in upstream under
Between swimming homologous reparation arm, two homologous multiple restriction enzyme sites repaired between arm can be selected to be located at two referring to Fig. 1
It is homologous repair arm restriction enzyme site EcoRV and NotI between other restriction enzyme sites, for example, can select EcoRI, XmaI,
The restriction enzyme sites such as SmaI, BamHI, XbaI；Selection and then target gene amplimer sequence both ends plus suitable
Protection base.
In the present embodiment, EcoRI＆XbaI restriction enzyme sites have been selected, objective gene sequence, which is connected to homologous recombination, to be carried
Amplimer sequence is as follows used in EcoRI＆XbaI restriction enzyme sites in body：
Positive sequence：5 ' CGGAATTCACGGAGTCTTGCTCTATCGC 3 ' (as shown in SEQ ID No.11)；
Reverse sequence：
5 ' GCTCTAGAACCTTCAAGGTGTCTTACAGGTC 3 ' (as shown in SEQ ID No.12)
Concrete operations are as follows：
(KOD-Plus-Neo PCR are used using the primer amplification objective gene sequence with restriction enzyme site and protection base
High fidelity enzyme, TOYOBO companies, article No. KOD-40), PCR conditions：94 DEG C of pre-degeneration 2min, three-step approach amplification, wherein 98 DEG C of changes
Property 10s, 58 DEG C annealing 30s, 68 DEG C extension 50s；Extend 68 DEG C of extension 5min after 40 cycles；4 DEG C of holdings.PCR product electrophoresis
With the gel reclaims kit AP-GX-250 recycling of Axygen companies after detection；
The PCR product EcoRI＆ of homologous recombination vector and above-mentioned purpose gene order that above-mentioned (b-3) step is obtained
XbaI enzyme cutting, (BioLab, EcoRI article No. R0101V, XbaI article No. R0145V, to specifications method use).50ul digestions
Contain in system：10 × NEB buffer2.1,5 μ each 1 μ l of l, EcoRI, XbaI enzyme, the PCR product 1 μ g of objective gene sequence, 37
DEG C reaction 1-2h.With the gel reclaims kit AP-GX-250 recycling of Axygen companies after digestion products electrophoresis detection.
Target gene fragment after homologous recombination vector and digestion after the digestion that mentioned reagent box is recycled uses
The T4DNA ligases of BioLab companies, article No. M0202, to specifications method use.Connect containing 10 × T4 in 10 μ l linked systems
1 μ l of enzyme buffer are met, the homologous recombination vector 50ng (50-200ng/ μ l) after digestion, the purpose after the digestion of kit recycling
Genetic fragment 30ng (50-100ng/ μ l), T4 ligases 1 μ l, ddH2O polishings.Room temperature connects 2h.
Connection product is converted into competent escherichia coli cell (DH5 α, Tiangeng biochemical technology Co., Ltd, article No.
CB101), the picking monoclonal after LB tablet cultures 12-16h connects correctly clone by generation sequence verification, that is, is contained
There is the plasmid of homologous recombination template.
Finally, it then is obtained by restricted digestion method and contains the homologous reparation arm in upstream, objective gene sequence and downstream
The homologous recombination template of the homologous linearisation for repairing arm.Such as Fig. 1, select on the outside of EcoRV, NotI any two restriction enzyme site to upper
" plasmid containing homologous recombination template " for stating acquisition carries out homologous recombination template (the targeting wine that double digestion can be obtained linearisation
The homologous recombination template of the linearisation of brewer yeast gene URA3 and carrying objective gene sequence)
Above-mentioned step (a) and step (b) is independently to carry out, can be in no particular order.
Step (c)：The gene editing plasmid that step (a) is obtained contains the target gene sequence with what step (b) obtained
Transformed saccharomyces cerevisiae cell, acquisition insert the objective gene sequence to the homologous recombination vector of row in URA3 genes together
Recombinant Saccharomyces cerevisiae cell；
Specifically, in the present embodiment, the gene editing plasmid that above-mentioned steps (a) obtain is obtained with above-mentioned steps (b)
The homologous recombination vector of the carrying objective gene sequence of the targeting genes of brewing yeast URA3 obtained is converted using Li-acetate method and is made wine
Yeast cells W303-1A；Steps are as follows for specific conversion process：
(c-1) YPD fluid nutrient medium culture brewing yeast cell W303-1A are used, after being incubated overnight, 12000rpm centrifugations
It after 30 seconds, discards supernatant, takes precipitation (yeast cells)；
Wherein, the main formula of YPD fluid nutrient mediums：Peptone (peptone) 20g/L, yeast extract (yeast
Extract) 10g/L, glucose 20g/L, agar powder 20g/L；
(c-2) use 1 × TE/LiAC of 1ml that the precipitation that above-mentioned steps (c-1) obtain is resuspended, washing, then 12000rpm centrifugations
It after 30 seconds, discards supernatant, takes precipitation (yeast cells)；
(c-3) the gene editing matter for adding above-mentioned steps (a) to obtain in the yeast cell pellets obtained to above-mentioned steps (c-2)
Grain 600ng, 1 μ g, Carrier DNA of homologous recombination template 4 μ l, 1 × TE/LiAC 45 the μ l, 1 × PEG/ that step (b) obtains
300 μ l of LiAC are uniformly mixed；
(c-4) heat-shock transformed；Heat-shock transformed, operating condition is carried out to the mixture that step (c-3) obtains：30 DEG C of 30min,
42 DEG C of 25min, 30 DEG C of 10min；
(c-5) the product centrifugation 12000rpm that obtains step (c-4), 30 seconds, abandon supernatant, be resuspended with the pure water of 100 μ l
It precipitates, then painting-leu tablets (leucine auxotrophy yeast solids culture medium), and is cultivated 2-3 days under 30 DEG C of environment.Note：-
What is grown on leu tablets is the thalline for inserting gene editing plasmid, because of the gene editing matter that the present embodiment step (a) obtains
There is leucine label on grain, can be grown in leucine auxotrophy yeast culture medium.
(c-6) monoclonal of 1/3 match end size of picking, the mixing in the SDS solution of 20 μ l 0.2%, 100 DEG C are boiled
4min, 4 DEG C of coolings, then 12000rpm are centrifuged 30 seconds, and supernatant is taken to do PCR identifications with Taq enzyme.Used by wherein PCR is identified
Primer：Use a forward primer of objective gene sequence, and the reverse primer on URA3 genes.Specifically in the present embodiment
In, positive sequence：5 ' aggcctgctgaaaatgactg3 ' (as shown in SEQ ID No.13), reverse sequence 5 '
Ttagttttgctggccgcatcttc3 ' (as shown in SEQ ID No.14).
About PCR system, totally 25 μ l, wherein the 5 μ l containing 5 × Taq buffer, 0.3 μ l of Taq enzyme, 10 μ lM forward directions sequences/
Each 1.25 μ l of reverse sequence, 0.4 μ l of above-mentioned supernatant.
Referring to Fig. 2, it is PCR qualification results, the mesh of Yeast genome is inserted by PCR amplification preliminary identification target gene
Region, (positive band) that PCR qualification results are positive, as objective gene sequence has been successively inserted into brewing yeast cell
The yeast cells clone (accuracy that can be also inserted by sequence verification) of URA3 genes, as structure successfully recombinates wine brewing ferment
Mother cell.DL2000 is the DNA marker used in Fig. 2, and "+" indicates that positive findings, "-" indicate that negative findings, NTC are sky
White control, 1.2kb are purpose band.In Fig. 2, it is positive findings to have 7 in 8 results, to build successfully recombination wine brewing ferment
Mother cell.
In addition, the PCR product that above-mentioned PCR identifications are positive also is sent sequencing company to carry out generation sequencing by inventor, PCR is used
The upstream and downstream primer of reaction carries out bidirectional sequencing, further demonstrates the URA3 bases that objective gene sequence is inserted into saccharomyces cerevisiae
Because in.
Embodiment 2：Build the kit of genetic test standard items
The kit of embodiment 2 includes mainly：
1), the gene editing plasmid for the targeting genes of brewing yeast URA3 that the step of above-described embodiment 1 (a) obtains (is based on
The gene editing plasmid of the targeting genes of brewing yeast URA3 of CRISPR/Cas9 gene editing systems structure), wherein gene is compiled
Plasmid is collected to target the genes of brewing yeast URA3 and make the site that its DNA double chain is broken for editing sites；
2) homologous recombination vector that (b-3) in the step of above-described embodiment 1 (b) is obtained (is based on CRISPR/Cas9 genes
Editing system structure, the homologous homologous recombination load for repairing the homologous reparation arm of arm and downstream in the upstream containing targeting editing sites
Body)；
3) brewing yeast cell system；In the present embodiment, brewing yeast cell W303-1A may be used.
User has purchased after the kit of the embodiment of the present invention 2, it is only necessary to the target gene to be detected that will have been expanded
Sequence is connected in homologous recombination vector by restricted digestion method (and positioned at the homologous reparation arm in upstream and downstream is homologous repaiies
Between dibrachia), then the homologous recombination template linearized is obtained by restricted digestion method, it will finally contain purposeful base
Because of the linearisation homologous recombination template of sequence and ready-made gene editing plasmid transformed saccharomyces cerevisiae cell line together, to be contained
The recombinant yeast cell of purposeful gene order, the recombinant yeast cell are used as positive control in the detection for target gene
Standard items.
It preferably, can also be homologous heavy comprising objective gene sequence to be detected to be connected in the kit of the present embodiment
The linked system etc. of group carrier.Preferably, the vinegar of transformed saccharomyces cerevisiae cell line can also be included in the kit of the present embodiment
Sour lithium transformation system etc..
Application examples：Application of the recombinant yeast cell as genetic test standard items about structure
Below with " the significant correlation gene mutation of Non-small cell lung carcinoma is c.35G>C (hereinafter referred to as G12A mutation) is
Example, the preparation of the standard items of summary G12A mutators detection.
Negative standards' product：Wild type gene group, plasmid
Positive criteria product：The successful recombinant Saccharomyces cerevisiae cell of structure that above-described embodiment 1 is obtained carries out protoplast
Change, using the acellular wall suspension of acquisition as positive criteria product.
Protoplast formation operation about recombinant Saccharomyces cerevisiae cell is as follows：By cultured recombinant Saccharomyces cerevisiae cell from
The heart takes supernatant, and the hypertonic PB liquid piping and druming after precipitation sterilizing is uniform, and 5 × 10 are added in every milliliter of solution750U lywallzymes (day
Root #RT-410-02), 1h is handled under 30 DEG C of water bath conditions, 4000rpm centrifugations remove supernatant, change the hypertonic PB liquid of no lywallzyme into
Preserve cell suspension.Wherein, the preparation about hypertonic PB liquid：With the citric acid solution configuration of the disodium hydrogen phosphate and 0.1M of 0.2M
At the PB liquid of pH=6.8, the hypertonic PB liquid of KCl of 0.8M is prepared with PB liquid.
Another note：Positive criteria product of the acellular wall suspension obtained as genetic test, can also be directly used in carrying for DNA
It takes, cell smear, wax stone and paraffin section etc. can also be made.
Effect data
1, the successful recombinant Saccharomyces cerevisiae cell of structure obtained for embodiment 1, by being inserted into target gene and yeast
The Q-PCR of reference gene reacts, and the target gene that preliminary identification is inserted into is that single copy is inserted into yeast cells；
Specifically, using three primer sequences being inserted on target gene KRAS, (hereinafter referred to as KRAS primers 1, KRAS draw
Object 2, KRAS primers 3) and saccharomyces cerevisiae (w303-1a) genome on reference gene ACT1 to carry out Q-PCR quantitative, repeat three times
It is as a result as follows after experiment：
1 corresponding ct values of KRAS primers are 15.91；
The corresponding ct values of KRAS primer 2s are 15.73；
3 corresponding ct values of KRAS primers are 15.96；
The corresponding ct values of ACT1 are 15.78；
It can be seen from the results above that the target gene and the reference gene arbitrary two that are inserted into its ct value through t-test, p>
0.05 without significant difference, due to the haploid yeast that saccharomyces cerevisiae (w303-1a) is standard, can preliminary proof be inserted into
Target gene is that single copy is inserted into yeast.
2, it is inserted into the stability verification that target gene stablizes heredity in yeast
The recombinant Saccharomyces cerevisiae cell that embodiment 1 obtains is placed on amplification cultivation on YPD tablets, yeast extract is suspended in 20%
It is frozen at -80 DEG C in glycerine, after freezing half a year, identifies that its genotype does not change using above-mentioned PCR and generation sequencing；
The recombinant Saccharomyces cerevisiae cell that embodiment 1 obtains is placed under 4 DEG C of YPD tablets, -20 DEG C of environment and preserves half a year, is adopted
Identify that its genotype does not change with above-mentioned PCR and generation sequencing；
In 20 generation of recombinant Saccharomyces cerevisiae cell continuous passage that embodiment 1 is obtained, 48h is continuously cultivated, using above-mentioned PCR
It is sequenced with a generation and identifies that its genotype does not change.
3, the recombinant yeast cell built according to the method for the present invention is more difficult dirty when being applied as genetic test standard items
Dye
The positive criteria that will be used in the positive criteria product used in the prior art (plasmid standard) and the above application examples
Product (the acellular wall suspension of the recombinant Saccharomyces cerevisiae cell of embodiment 1) parallelly carry out PCR reactions under the same conditions；
After testing, the plasmid standard used in the prior art the generally ddH2O when carrying out for 3 times or more is the moon of template
Property control will appear false positive, and progress 10 times when the positive criteria product used in the application application examples is detected as pcr template
Will not occur false positive pollution above.
4, according to counting of the recombinant yeast cell when being applied as genetic test standard items of the method for the present invention structure and
Dosing accuracy.
The recombinant yeast cell built according to the method for the present invention can be carried out accurate by blood counting chamber, automatic counter for counting etc.
True quantifies, the copy number of quantity, that is, target gene to be detected of recombinant yeast cell, and the copy number of plasmid standard needs
It to be calculated by concentration mensuration and copy number and be obtained indirectly.Therefore, the recombinant yeast cell built according to the method for the present invention, in base
Because of detection in application, the accuracy counted keeps its copy number of being more convenient for quantitative and the proportioning mixing of different genotype.
It should be appreciated that although this specification is described in terms of embodiments, but not each embodiment only includes one
A independent technical solution, this description of the specification is merely for the sake of clarity, and those skilled in the art should will say
As a whole, the technical solution in each embodiment may also be suitably combined to form those skilled in the art can for bright book
With the other embodiment of understanding.
The series of detailed descriptions listed above only for the present invention feasible embodiment specifically
Bright, they are all without departing from equivalent implementations made by technical spirit of the present invention not to limit the scope of the invention
Or change should all be included in the protection scope of the present invention.
Sequence table
<110>The Shanghai bio tech ltd Ze Yin
<120>The gene of brewing yeast cell
<130> 2017-ZY-1
<160> 14
<170> SIPOSequenceListing 1.0
<210> 1
<211> 23
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 1
cattacgaat gcacacggtg tgg 23
<210> 2
<211> 23
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 2
atccattacg aatgcacacg gtg 23
<210> 3
<211> 23
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 3
aaccaccgtg tgcattcgta atg 23
<210> 4
<211> 804
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 4
atgtcgaaag ctacatataa ggaacgtgct gctactcatc ctagtcctgt tgctgccaag 60
ctatttaata tcatgcacga aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc 120
accaaggaat tactggagtt agttgaagca ttaggtccca aaatttgttt actaaaaaca 180
catgtggata tcttgactga tttttccatg gagggcacag ttaagccgct aaaggcatta 240
tccgccaagt acaatttttt actcttcgaa gacagaaaat ttgctgacat tggtaataca 300
gtcaaattgc agtactctgc gggtgtatac agaatagcag aatgggcaga cattacgaat 360
gcacacggtg tggtgggccc aggtattgtt agcggtttga agcaggcggc ggaagaagta 420
acaaaggaac ctagaggcct tttgatgtta gcagaattgt catgcaaggg ctccctagct 480
actggagaat atactaaggg tactgttgac attgcgaaga gcgacaaaga ttttgttatc 540
ggctttattg ctcaaagaga catgggtgga agagatgaag gttacgattg gttgattatg 600
acacccggtg tgggtttaga tgacaaggga gacgcattgg gtcaacagta tagaaccgtg 660
gatgatgtgg tctctacagg atctgacatt attattgttg gaagaggact atttgcaaag 720
ggaagggatg ctaaggtaga gggtgaacgt tacagaaaag caggctggga agcatatttg 780
agaagatgcg gccagcaaaa ctaa 804
<210> 5
<211> 134
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 5
ggcacagtta agccgctaaa ggcattatcc gccaagtaca attttttact cttcgaagac 60
agaaaatttg ctgacattgg taatacagtc aaattgcagt actctgcggg tgtatacaga 120
atagcagaat gggc 134
<210> 6
<211> 141
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 6
tgtcgctctt cgcaatgtca acagtaccct tagtatattc tccagtagct agggagccct 60
tgcatgacaa ttctgctaac atcaaaaggc ctctaggttc ctttgttact tcttccgccg 120
cctgcttcaa accgctaaca a 141
<210> 7
<211> 22
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 7
ggcacagtta agccgctaaa gg 22
<210> 8
<211> 26
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 8
gcccattctg ctattctgta tacacc 26
<210> 9
<211> 38
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 9
agttctagag cggccgcttg ttagcggttt gaagcagg 38
<210> 10
<211> 38
<212> DNA
<213>Yeast cells (Saccharomyces cerevisiae)
<400> 10
accgcggtgg cggccgctgt cgctcttcgc aatgtcaa 38
<210> 11
<211> 28
<212> DNA
<213>Brewing yeast cell (Saccharomyces cerevisiae)
<400> 11
cggaattcac ggagtcttgc tctatcgc 28
<210> 12
<211> 31
<212> DNA
<213>Brewing yeast cell (Saccharomyces cerevisiae)
<400> 12
gctctagaac cttcaaggtg tcttacaggt c 31
<210> 13
<211> 20
<212> DNA
<213>Brewing yeast cell (Saccharomyces cerevisiae)
<400> 13
aggcctgctg aaaatgactg 20
<210> 14
<211> 23
<212> DNA
<213>Brewing yeast cell (Saccharomyces cerevisiae)
<400> 14
ttagttttgc tggccgcatc ttc 23
Claims (12)
1. a kind of construction method of genetic test standard items, it is characterised in that：The construction method includes by purpose to be detected
Gene order is inserted into the genome of yeast cells by way of homologous recombination and is obtained containing the objective gene sequence
Recombinant yeast cell；
The recombinant yeast cell is used as positive control standard items in the detection for the target gene.
2. the construction method of genetic test standard items as described in claim 1, it is characterised in that：
The construction method includes at least the step of structure homologous recombination template, and will be described in homologous recombination template conversion
The step of yeast cells；
The homologous recombination template includes the homologous reparation arm of the homologous reparation arm in upstream and downstream, and is repaiied positioned at the upstream is homologous
The homologous objective gene sequence repaired between arm of dibrachia and downstream；
The homologous nutrition repaired the homologous reparation arm of arm and downstream and target the yeast cells in upstream in the homologous recombination template
Deficiency marker gene.
3. the construction method of genetic test standard items as claimed in claim 2, it is characterised in that：
The construction method further includes building the nutrient defect type mark for targeting the yeast cells based on gene editing system
The step of gene editing plasmid of gene；Also,
The homologous recombination template is converted into the yeast cells together with the gene editing plasmid, is obtained thin in the yeast
The recombinant yeast cell of the objective gene sequence is inserted in the nutrient defect type mark gene of born of the same parents.
4. the construction method of genetic test standard items as claimed in claim 3, it is characterised in that：
It is compiled based on gene editing system to build the gene for the nutrient defect type mark gene for targeting the yeast cells described
In the step of collecting plasmid：The gene editing system is CRISPR/Cas9 gene editing systems, and the yeast cells is wine brewing ferment
Mother, the nutrient defect type mark gene are URA3 genes；Wherein, the gene editing plasmid targets the genes of brewing yeast
URA3 simultaneously makes the site that its DNA double chain is broken for editing sites；
In the structure homologous recombination template the step of：It is homologous heavy to be primarily based on CRISPR/Cas9 gene editing systems structure
Group carrier, the homologous recombination vector contain the homologous reparation arm of the homologous reparation arm in upstream and downstream for targeting the editing sites；
The objective gene sequence is connected by the molecular cloning method of restricted digestion in the homologous recombination vector and position again
Between the homologous reparation arm of the homologous reparation arm in the upstream and downstream；Finally, then by restricted digestion method contained
The homologous recombination mould of the homologous linearisation for repairing arm, the homologous reparation arm of the objective gene sequence and the downstream in the upstream
Plate；
In the gene editing plasmid that will be obtained together with the homologous recombination template of the linearisation transformed saccharomyces cerevisiae cell,
Obtain the recombinant Saccharomyces cerevisiae cell that the objective gene sequence is inserted in URA3 genes；
The step of the step of structure gene editing plasmid and structure homologous recombination template respective complete independently, regardless of elder generation
Afterwards.
5. the construction method of genetic test standard items as claimed in claim 4, it is characterised in that：
In the structure gene editing plasmid the step of, the gRNA for targeting genes of brewing yeast URA3 is passed through into restricted digestion
Molecular cloning method be connected in yeast-E. coli fabric shuttle-type carrier, obtain the gene editing plasmid；
The sequence of the gRNA of the targeting genes of brewing yeast URA3 is as shown in SEQ ID No.1.
6. the construction method of genetic test standard items as claimed in claim 5, it is characterised in that：
In the structure gene editing plasmid the step of, the primer pair sequence such as SEQ ID No.2 and SEQ of the gRNA is expanded
Shown in ID No.3；The yeast-E. coli fabric shuttle-type carrier is p425-Sap-TEF1p-Cas9-CYC1t-2xSap carriers；
The p425-Sap-TEF1p-Cas9-CYC1t-2xSap carriers of SapI digestions are connect with the gRNA, by the connection of acquisition
Product converts Escherichia coli, chooses identified positive colony and carries out amplification cultivation, and institute is obtained through plasmid extraction and purification process
State gene editing plasmid.
7. the construction method of genetic test standard items as claimed in claim 5, it is characterised in that：
In the structure homologous recombination template the step of, based in the URA3 gene orders as shown in SEQ ID No.4 the
351-373 upstream sequences design the homologous reparation arm in upstream, based in the URA3 gene sequences as shown in SEQ ID No.4
351-373 downstream sequences design the homologous reparation arm in downstream in row.
8. the construction method of genetic test standard items as claimed in claim 7, it is characterised in that：
The homologous sequence for repairing arm in the upstream is as shown in SEQ ID No.5；The homologous sequence such as SEQ for repairing arm in the downstream
Shown in ID No.6.
9. the construction method of genetic test standard items as claimed in claim 8, it is characterised in that：
In the structure homologous recombination template the step of, first by the homologous reparation arm in the upstream and the homologous reparation in the downstream
Arm is connected into the EcoRV in the multiple cloning sites region of pBluescript carriers by the molecular cloning method of restricted digestion respectively
With NotI restriction enzyme sites；The objective gene sequence is connected by the molecular cloning method of restricted digestion again described
Any one restriction enzyme site between EcoRV and NotI restriction enzyme sites；Finally contained again by restricted digestion method
The homologous recombination mould of the homologous linearisation for repairing arm, the homologous reparation arm of the objective gene sequence and the downstream in the upstream
Plate；
Wherein, for expanding the homologous primer pair sequence for repairing arm in the upstream as shown in SEQ ID No.7 and SEQ ID No.8
It is shown；For expanding the homologous primer pair sequence for repairing arm in the downstream as shown in SEQ ID No.9 and SEQ ID No.10 institutes
Show.
10. the construction method of genetic test standard items as in one of claimed in any of claims 1 to 9, it is characterised in that：
In the step of converting, Li-acetate method transformed saccharomyces cerevisiae cell W303-1A is used.
11. a kind of kit of structure genetic test standard items, it is characterised in that：
The kit includes：The base of targeting genes of brewing yeast URA3 based on CRISPR/Cas9 gene editing systems structure
Because editing plasmid, the homologous recombination vector based on CRISPR/Cas9 gene editing systems structure and brewing yeast cell system,
In, wherein the gene editing plasmid targets the genes of brewing yeast URA3 and the site for making its DNA double chain be broken is editor
Site, the homologous recombination vector contain the homologous reparation arm of the homologous reparation arm in upstream and downstream for targeting the editing sites.
12. the kit of structure genetic test standard items as claimed in claim 11, it is characterised in that：
The gene editing plasmid is that the gRNA of targeting genes of brewing yeast URA3 is connected to yeast-E. coli fabric shuttle-type carrier
The connection product of SapI restriction enzyme sites in p425-Sap-TEF1p-Cas9-CYC1t-2xSap, the targeting saccharomyces cerevisiae base
Because URA3 gRNA sequence as shown in SEQ ID No.1；
The homologous recombination vector contains the homologous reparation arm of the homologous reparation arm in upstream and downstream for targeting the editing sites,
In, the homologous sequence for repairing arm in the upstream is as shown in SEQ ID No.5；The homologous sequence such as SEQ ID for repairing arm in the downstream
Shown in No.6；
The brewing yeast cell system is brewing yeast cell W303-1A.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711277328.8A CN108486158B (en) | 2017-12-06 | 2017-12-06 | Construction method of gene detection standard substance based on yeast cells and kit thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201711277328.8A CN108486158B (en) | 2017-12-06 | 2017-12-06 | Construction method of gene detection standard substance based on yeast cells and kit thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN108486158A true CN108486158A (en) | 2018-09-04 |
| CN108486158B CN108486158B (en) | 2020-11-17 |
Family
ID=63343960
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201711277328.8A Active CN108486158B (en) | 2017-12-06 | 2017-12-06 | Construction method of gene detection standard substance based on yeast cells and kit thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108486158B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111521460A (en) * | 2020-04-28 | 2020-08-11 | 北京橡鑫生物科技有限公司 | FFPE reference product, preparation method and application thereof |
| CN111893178A (en) * | 2020-08-24 | 2020-11-06 | 重庆市人口和计划生育科学技术研究院 | Genetic reference material for alpha thalassemia gene detection and preparation method thereof |
| EP4092132A4 (en) * | 2020-01-16 | 2024-03-20 | Ricoh Company, Ltd. | Sample for evaluating performance of genetic testing apparatus, method for preparing said sample, and device for evaluating performance, method for evaluating performance, program for evaluating performance, and apparatus for evaluating performance of genetic testing apparatus |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005075654A1 (en) * | 2004-01-30 | 2005-08-18 | Mixis France S.A. | Generation of recombinant genes in saccharomyces cerevisiae |
| CN104212836A (en) * | 2014-09-18 | 2014-12-17 | 东华大学 | Method for knocking out mir-505 from mammal cell line |
| CN105624146A (en) * | 2015-05-28 | 2016-06-01 | 中国科学院微生物研究所 | Molecular cloning method based on CRISPR/Cas9 and homologous recombination of saccharomyces cerevisiae cell endogenous genes |
| CN105821072A (en) * | 2015-01-23 | 2016-08-03 | 深圳华大基因研究院 | CRISPR-Cas9 system used for assembling DNA and DNA assembly method |
-
2017
- 2017-12-06 CN CN201711277328.8A patent/CN108486158B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005075654A1 (en) * | 2004-01-30 | 2005-08-18 | Mixis France S.A. | Generation of recombinant genes in saccharomyces cerevisiae |
| CN1938426A (en) * | 2004-01-30 | 2007-03-28 | 麦克西斯法国股份有限公司 | Generation of recombinant genes in saccharomyces cerevisiae |
| CN104212836A (en) * | 2014-09-18 | 2014-12-17 | 东华大学 | Method for knocking out mir-505 from mammal cell line |
| CN105821072A (en) * | 2015-01-23 | 2016-08-03 | 深圳华大基因研究院 | CRISPR-Cas9 system used for assembling DNA and DNA assembly method |
| CN105624146A (en) * | 2015-05-28 | 2016-06-01 | 中国科学院微生物研究所 | Molecular cloning method based on CRISPR/Cas9 and homologous recombination of saccharomyces cerevisiae cell endogenous genes |
Non-Patent Citations (2)
| Title |
|---|
| 岳运峰: "新型转基因标准物质与标记基因检测方法研究", 《中国优秀硕士学位论文全文数据库（电子期刊）》 * |
| 李世宇: "CRISPR/Cas9技术在毕赤酵母和枯草芽孢杆菌中研究", 《中国优秀硕士学位论文全文数据库（电子期刊）》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP4092132A4 (en) * | 2020-01-16 | 2024-03-20 | Ricoh Company, Ltd. | Sample for evaluating performance of genetic testing apparatus, method for preparing said sample, and device for evaluating performance, method for evaluating performance, program for evaluating performance, and apparatus for evaluating performance of genetic testing apparatus |
| CN111521460A (en) * | 2020-04-28 | 2020-08-11 | 北京橡鑫生物科技有限公司 | FFPE reference product, preparation method and application thereof |
| CN111893178A (en) * | 2020-08-24 | 2020-11-06 | 重庆市人口和计划生育科学技术研究院 | Genetic reference material for alpha thalassemia gene detection and preparation method thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN108486158B (en) | 2020-11-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110520528A (en) | Hi-fi CAS9 variant and its application | |
| JP2549049B2 (en) | Manufacture of Factor VIII and related products | |
| CN106998665A (en) | The generation of haplophyte | |
| CN108486158A (en) | The construction method and its kit of genetic test standard items based on yeast cells | |
| CN109097387A (en) | A kind of methods and applications with CRISPR/Cas9 gene editing system initiative purple fruit Tomato mutants | |
| KR102010859B1 (en) | Markers for identifying floury endosperm characteristics and use thereof | |
| CN108165581A (en) | The method for repairing HBA2 gene mutations in vitro using single stranded nucleotide acid fragment | |
| WO2020173150A1 (en) | Off-target single nucleotide variants caused by single-base editing and high-specificity off-target-free single-base gene editing tool | |
| Dev et al. | Chromosome markers in Mus musculus: differences in C-banding between the subspecies M. m. musculus and M. m. molossinus | |
| CN112481309B (en) | Application of Ago protein, composition and gene editing method | |
| JP2022512530A (en) | How to characterize a modification using a designer nuclease | |
| CN106282230A (en) | The method of rite-directed mutagenesis LDLR gene | |
| CN111893178A (en) | Genetic reference material for alpha thalassemia gene detection and preparation method thereof | |
| Elisaphenko et al. | Repetitive DNA sequences in the common vole: cloning, characterization and chromosome localization of two novel complex repeats MS3 and MS4 from the genome of the East European vole Microtus rossiaemeridionalis | |
| CN108624686B (en) | A kind of probe library, detection method and the kit of detection BRCA1/2 mutation | |
| CN109929876A (en) | The construction method of Vps28 knock out mice animal model and application | |
| CN114480601A (en) | Molecular marker, primer, method and application for identifying genetic sex of hippocampus kelloggi | |
| CN108250285A (en) | A kind of and the relevant haplotype-tag of Micropterus salmoides fast-growth and its application | |
| CN112921104B (en) | Variable shear marker for assisting in selecting weight of sheep tail fat, detection primer and application thereof | |
| CN107459564A (en) | The application of rice ZYGO1 albumen and its encoding gene in pollen fertility is regulated and controled | |
| Wang et al. | Characterization of the CsCENH3 protein and centromeric DNA profiles reveal the structures of centromeres in cucumber | |
| CN106317214B (en) | The heat-resisting GAP-associated protein GAP TaXPD of wheat and its encoding gene and application | |
| Bruschi et al. | Yeast artificial chromosomes | |
| CN113718042B (en) | Sex-specific DNA (deoxyribonucleic acid) marker for red and white koi and application thereof | |
| CN113699254B (en) | Sex-specific DNA (deoxyribonucleic acid) marker for large trichromatic and Zhaobiao trichromatic koi and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |