CN111876429B - Application of rice protein OsYAF9a in regulation of rice plant type - Google Patents
Application of rice protein OsYAF9a in regulation of rice plant type Download PDFInfo
- Publication number
- CN111876429B CN111876429B CN202010284015.0A CN202010284015A CN111876429B CN 111876429 B CN111876429 B CN 111876429B CN 202010284015 A CN202010284015 A CN 202010284015A CN 111876429 B CN111876429 B CN 111876429B
- Authority
- CN
- China
- Prior art keywords
- rice
- osyaf9a
- seq
- protein
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8213—Targeted insertion of genes into the plant genome by homologous recombination
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
Abstract
The invention relates to application of rice protein OsYAF9a in regulation of rice plant types. The invention also relates to a method for regulating the plant type of rice, which comprises the step of deleting the function of the OsYAF9a protein. The OsYAF9a protein function loss can reduce the plant height of rice and reduce the tillering of the rice.
Description
Technical Field
The invention relates to the field of genetic engineering, in particular to a rice plant height and tillering related protein OsYAF9a, a coding gene thereof and application thereof.
Background
Rice (Oryza sativa L.) is a staple food that provides food for half of the world's population, and approximately more than 50% of the human main source of nutrition is rice[1]. 95% of the world's rice is produced and consumed in Asia, occupying 40-80% of the calories on Asian diet[2]. Since 1960, the rapid growth of the population and the drastic reduction of the cultivation area have made it increasingly difficult to meet the food demand, resulting in a global food crisis and thus also opening the green revolution of crops.
In modern agriculture, plant height is an important trait determining grain yield[3]. The green revolution of the rice has positive influence on the yield potential of the rice, and the breeding of dwarf varieties is taken as a representative[4]. The rice semi-dwarf gene sd-1 plays an important role in modern rice breeding, and semi-dwarf plants can effectively prevent lodging and increase the utilization rate of nitrogen fertilizer[5，6]。
Tillering is also an important agronomic character affecting rice yield, and tillering number is a premise for determining spike number and is an important basis for forming yield. Proper amount of effective tillering is more beneficial to high yield of rice. Therefore, the gene research for controlling the plant height and tillering of the rice is beneficial to the improvement of rice varieties.
Disclosure of Invention
The invention provides a gene related to rice tillering and plant height, which is named as OsYaf9a, is derived from rice (Oryzasativvar) and codes OsYAF9a protein, wherein the amino acid sequence of the protein is SEQ ID No. 2, and the nucleotide coding sequence is SEQ ID No. 1. The functional deletion of the protein expressed by the gene can reduce the plant height of rice and the tillering of the rice.
In one aspect, the invention provides application of rice protein in regulating rice plant type, wherein the protein is OsYAF9a protein, and the amino acid sequence of the protein is shown as SEQ ID No. 2.
In one embodiment, wherein the variety of rice is, for example, Nipponbare or 9311, preferably Nipponbare.
In one embodiment, the nucleotide coding sequence of the OsYAF9a protein is shown in SEQ ID No: 1.
In one embodiment, wherein the rice plant type is plant height and/or tillering.
In one embodiment, wherein the modulating the plant type of rice is reducing the plant height of rice and/or reducing the number of tillers of rice.
In another aspect, the present invention provides a method for regulating the plant type of rice, comprising the step of deleting the function of the OsYAF9a protein, wherein the amino acid sequence of the OsYAF9a protein is SEQ ID No: 2.
In one embodiment, wherein the variety of rice is, for example, Nipponbare or 9311, preferably Nipponbare.
In one embodiment, wherein the rice plant type is plant height and/or tillering.
In one embodiment, wherein the regulating rice plant type is reducing rice plant height and/or reducing tiller number in rice.
In one embodiment, wherein the step of functionally deleting the OsYAF9a protein is achieved by gene knock-out, gene knock-down, frameshift mutation, and the like.
In one embodiment, wherein the knockout and/or frameshift mutation uses a CRISPR/Cas9 vector. In one embodiment, the method further comprises selecting NGG within exons 1-3 within the genomic nucleotide sequence of the OsYaf9a gene. Because of the NGG selected at the front position of the genome, the CRISPR/Cas9 gene editing technology can be used for carrying out frame shift mutation on the target gene at the front position, so that the function of the target protein is lost.
In one embodiment, wherein the CRISPR/Cas9 vector comprises a target sequence for gene knock-out, the nucleotide sequence of the target sequence is shown in SEQ ID No. 5 or SEQ ID No. 6.
In another aspect, the invention provides a CRISPR/Cas9 vector comprising a target sequence as described in any preceding claim.
In another aspect, the invention provides a mutant gene of OsYaf9a, which has the nucleotide sequence:
(a) a nucleotide sequence of T is inserted between 168 th and 169 th sites of SEQ ID No. 1 (the obtained sequence is shown as SEQ ID No. 15); or
(b) A nucleotide sequence of T is inserted between the 461 th and 462 th positions of SEQ ID No. 1 (the obtained sequence is shown in SEQ ID No. 16).
As for SEQ ID No. 15, the nucleotide sequence at position 228-230 of SEQ ID No. 1 can be transcribed into a stop codon as a result of the above-described frame shift mutation of SEQ ID No. 1. With respect to SEQ ID No. 16, the nucleotide sequence at position 474-476 of SEQ ID No. 1 was transcribed into a stop codon because SEQ ID No. 1 underwent the frame shift mutation described above.
After transcription of the wrong RNA, the cell self-clearing mode is started, and the RNA with the transcription error is cleared, so that the OsYAF9a protein is not expressed and/or the OsYAF9a protein with the transcription error is cleared.
In one embodiment, the gene is mutated as described above for use in reducing the plant height of rice and/or reducing tillering of rice.
In one embodiment, wherein the variety of rice is, for example, Nipponbare or 9311, preferably Nipponbare.
Drawings
FIG. 1 shows a map of pHUN411-OsYaf9a vector.
FIG. 2 shows Osyaf9a genotype in Osyaf9a mutant.
FIG. 3 shows phenotypic observations (FIG. 3A) and plant height and tillering (FIG. 3B) statistics of Osyaf9a mutant plants.
Detailed Description
In order that the objects, technical solutions and advantages of the present invention will become more apparent, the present invention will be further described in detail with reference to the accompanying drawings in conjunction with the following specific embodiments.
The research technology of the invention comprises the following steps:
(1) cloning and functional identification of the OsYaf9a gene:
1) according to the technical principle of CRISPR/Cas9 gene editing and the cDNA sequence of the OsYaf9a gene, a specific gRNA target sequence of the OsYaf9a gene is obtained through database and tool website analysis (http:// skl.scau.edu.cn /), and the target sequence is cloned into a CRISPR/Cas9 gene editing vector pHUC411 (purchased from agricultural institute of Anhui province), so that the pHUC411-OsYaf9a gene editing vector is obtained (figure 1).
2) Genotyping of OsYaf9 a:
and carrying out phenotype observation on the obtained transgenic progeny T1 generation plants in the whole growth period, carrying out specific primer amplification sequencing on genome regions near gRNA target sequences of all T1 generation plants, and identifying the target sequences and the mutation conditions near the target sequences. Through the genotype comparison phenotype analysis, the OsYaf9a mutant system plant is obtained.
In conclusion, the OsYaf9a gene in the rice genome is knocked out by using the CRISPR/Cas9 gene editing technology, and the phenotypes of plant height reduction and tiller reduction are obtained through genotype identification, so that a foundation is laid for improving the rice plant morphology and increasing the rice yield potential.
Examples
The experimental procedures mentioned in the following examples are conventional procedures known in the art unless otherwise specified.
Example 1: cloning of OsYaf9a Gene
Reverse transcription
Trizol method for extracting RNA from Nipponbare rice (purchased from Nongjic, Anhui);
approximately 8ug of the above RNA was taken in a 1.5ml EP tube and treated with DNase I at 37 ℃ for 30min to remove DNA as follows:
add 170ul of EDPC water to the above EP tube and add an equal volume of phenol-chloroform, shake well and mix. Centrifuging at 12000rpm at 4 deg.C for 10 min;
transfer the supernatant (about 200ul) to a new 1.5ml EP tube, add 1/10 volumes of 3M NaAC and 2.5 volumes of pre-cooled absolute ethanol and 1.5ul of glycogen, mix by inversion, -stand at-20 ℃ for more than 30 min;
centrifuging at 12000rpm at 4 deg.C for 15min, discarding the supernatant, washing with 70% ethanol pre-cooled on ice for 2 times, and removing residual ethanol;
air-dry by inversion, add 25ul DEPC water, 2ul olig (dT)18, shake, dissolve, mix well, and centrifuge briefly. Incubating at 65 ℃ for 5min, rapidly cooling on ice to obtain a mixed solution of RNA and oligdT, and adding the components according to the following table by using a reverse transcription kit of Novonoprazan company;
after incubation at 55 ℃ for 1h in a water bath, heat treatment was carried out at 80 ℃ for 5 min.
The cells were dissolved in 160ul EDPC water and stored at-20 ℃.
cDNA of Nipponbare rice was obtained.
PCR
A gene homologous to Arabidopsis Yaf9a (LOC _ Os06g04580.1, the nucleotide sequence of which is shown as SEQ ID NO:1 and the amino acid sequence of which is shown as SEQ ID NO: 2) was found from a database (http:// rice. plant biology. msu. edu /), named OsYaf9a, a corresponding primer (forward primer: ATGCCGCAAGCCTCCTCCTCCT (shown as SEQ ID NO: 3) and reverse primer: TTAGCCGTGCCCAAATTGTTGG (shown as SEQ ID NO: 4)) was designed, and the cDNA of the Nipponbare rice obtained in this example was amplified to obtain the cDNA of OsYaf9a gene.
The reaction system of PCR is as follows:
the reaction sequence for PCR was as follows: pre-denaturation at 98 deg.C for 5min, denaturation at 98 deg.C for 15s, annealing at 58 deg.C for 30s, extension at 72 deg.C for 2min, reaction for 35 cycles, post-extension at 72 deg.C for 8min, and holding at 4 deg.C.
After the PCR was completed, the amplified DNA fragment was recovered and purified using DNA recovery kit from mega, and then the purified DNA fragment was ligated into vector pGEM-T (Promega), E.coli DH5 alpha competent cells were transformed, positive clone plasmid was selected, and DNA sequencing was performed by Kawawa Dagen to obtain OsYaf9a cDNA fragment of 951bp length having the DNA sequence shown in SEQ ID NO: 1.
Example 2: construction of the rice pHUC411-OsYaf9a gene editing vector:
according to the technical principle of CRISPR/Cas9 gene editing, NGG is selected in the 1 st exon and the third exon of the genome nucleotide sequence of the OsYaf9a gene through database and tool website analysis, a target sequence 1CCGCGCAGAAGGCGCTCCGC (shown as SEQ ID NO:5, which is in the first exon of the genome of the OsYaf9a gene) of the specific gRNA of the OsYaf9a gene and a target sequence 2GAGTTGTCTGAATCTGGCTG (shown as SEQ ID NO:6, which is in the third exon of the genome of the OsYaf9a gene) of the specific gRNA of the OsYaf9a gene are obtained, and the target sequences are cloned into a CRISPR/Cas9 gene editing vector pHUC411, so that the pHUC411-OsYaf9a gene editing vector (figure 1) is obtained.
The target joint primers of the gRNA target sequences 1 and 2 are respectively as follows:
target sequence for gRNA 1:
f: 5-GGCACCGCGCAGAAGGCGCTCCGC-3 (shown as SEQ ID NO: 7),
r: 5-AAACGCGGAGCGCCTTCTGCGCGG-3 (shown as SEQ ID NO: 8)
Target sequence for gRNA 2:
f: 5-GGCAGAGTTGTCTGAATCTGGCTG-3 (shown as SEQ ID NO: 9)
R: 5-AAACCAGCCAGATTCAGACAACTC-3 (shown in SEQ ID NO: 10).
Example 3: breeding the Osyaf9a mutant system and identifying:
entrusted to agricultural institute of Anhui province, a mature rice embryo callus dip-dyeing transformation method mediated by agrobacterium EHA105 (purchased from agricultural institute of Anhui province) is adopted to transfer a gene editing vector pHUC411-OsYaf9a into a mature rice embryo, and the specific transformation method is as follows: (1) induction of rice mature embryo callus: mature Nipponbare seeds (purchased from Nongkouchi, Anhui) are hulled, surface-sterilized with 70-75% alcohol for 1-2min, soaked in 30% NaClO solution for 15min, and repeated 2 times, and then washed with sterilized water for 4-5 times. Then the seeds are placed on an induction culture medium for culture, and the callus is cultured and induced for transformation at the temperature of 26-28 ℃ in a dark place. (2) Co-culturing rice callus and agrobacterium: the EHA105 strain identified in example 3 as containing the gene editing vector pHUC411-OsYaf9a was activated, enriched, resuspended, and adjusted to an OD600 of 0.5 to 0.6. The callus was collected in a 50ml sterile centrifuge tube and the resuspended agrobacterium suspension was poured into it to contaminate the callus. After soaking for 15-30min, the suspension is poured off, and the impregnated callus is placed on sterile filter paper to suck off the excess agrobacterium liquid. Then placing the callus in a culture dish paved with sterile filter paper, and culturing for 2-3 days at 26 ℃ in a dark place. (3) Screening of resistant callus: after the co-cultivation is completed, the callus is transferred to a selection medium containing 50-100mg/ml of G418 antibiotic and resistance selection is carried out at 26-28 ℃. (4) Differentiation of resistant calli: and (3) placing the callus with good growth state in the screening culture medium in a differentiation culture medium, and performing differentiation culture under the conditions of 16-hour light/8-hour darkness and the environment temperature of 26-28 ℃ until the callus is differentiated to grow into a plantlet. (5) Rooting of the differentiated plantlets: and when the differentiated plantlets are about 2-5cm in month, transferring the plantlets into a rooting culture medium for rooting culture. Transplanting the seedlings with the grown root systems to a greenhouse or a transgenic garden for growth.
Specific primer PCR amplification sequencing is carried out on the genome regions near the target sequences 1 and 2 of gRNA of a Nipponbare transformed plant and a wild Nipponbare plant by using the following specific primers, and the target sequences and mutation conditions of the regions near the target sequences are identified. The amplification reaction procedure was as follows: pre-denaturation at 98 ℃ for 5min, denaturation at 98 ℃ for 15s, annealing at 58 ℃ for 15s, extension at 72 ℃ for 30s, reaction for 35 cycles, and post-extension at 72 ℃ for 8 min. The PCR product is separated by 2 percent agarose gel electrophoresis and stained by ethidium bromide, and the cut target band is sent to the general gene of Senhua Dagen for sequencing. The specific primer sequences for PCR were as follows:
for target sequence 1:
1) osyaf9 a-S1F: 5-AAGCCTCCTCCTCCTCCTC-3 (shown as SEQ ID NO: 11)
Osyaf9 a-S1R: 5-GACTAAGCAATTAATTGGTGTGAAG-3 (shown as SEQ ID NO: 12)
For target sequence 2:
2) osyaf9 a-S2F: 5-GGTGATTTTGTTACACCATATGC-3 (shown as SEQ ID NO: 13)
Osyaf9 a-S2R: 5-ACACACGTCACTGTGGAAATAA-3 (shown as SEQ ID NO: 14)
Through sequencing result analysis, two Osyaf9a homozygous mutants can be obtained and can be stably inherited. Target sequences 1 and 2 of gRNA correspond to Osyaf9a mutant genotypes I and II, respectively, as shown in fig. 2:
the Osyaf9a mutant genotype I has a T base inserted between 168 th and 169 th positions of Osyaf9a, and results in that the nucleotide sequence at position 228-230 of SEQ ID No:1 can be encoded as a stop codon (the nucleotide sequence of Osyaf9a mutant genotype I is shown as SEQ ID NO:15, respectively);
the Osyaf9a mutant genotype II has a T base inserted between 461 and 462 of Osyaf9a, resulting in the nucleotide sequence at 474-476 of SEQ ID No:1 that can be encoded as a stop codon (the nucleotide sequence of Osyaf9a mutant genotype II is shown in SEQ ID NO:16, respectively).
After transcription of the wrong RNA, the cell self-clearing mode is started, and the RNA with the transcription error is cleared, so that the OsYAF9a protein is not expressed and/or the OsYAF9a protein with the transcription error is cleared.
The above sequencing results were repeated 3 times, all giving the same results.
Example 4: phenotypic identification of rice Osyaf9a mutant system plant
The rice Osyaf9a mutant I and II plants and wild type rice Nipponbare plants are planted in a field, and the phenotypic difference between the rice Osyaf9a mutant system plant and the wild type rice Nipponbare (abbreviated as WT) plant in the whole growth period is observed. The observation results (heading stage of rice) are shown in fig. 3, and the Osyaf9a mutant I and II plants showed dwarfing and reduced tillering phenotypes compared to WT plants, with the Osyaf9a mutant I plant being dwarfed by about 44% and reduced tillering by about 68% compared to the wild-type rice nippon plant, and the Osyaf9a mutant II plant being dwarfed by about 43% and reduced tillering by about 68% compared to the wild-type rice nippon plant. Thereby proving that the OsYaf9a gene participates in controlling the plant height and tillering of the rice.
The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are only exemplary embodiments of the present invention and are not intended to limit the present invention, and any modifications, equivalents, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.
Reference documents:
1.White P T.Rice:The essential harvest[J].Natl.Geogr.,1994,185:48-79.
2.Paramita Bhattacharjee，Rekha S Singhal，Pushpa R Kulkarni.Basmati rice:a review[J].International journal of food science&technology,2002,37(1):1-12.
3.Tomoaki Sakamoto，Makoto Matsuoka.Identifying and exploiting grain yield genes in rice[J].Current opinion in plant biology,2008,11(2):209-214.
4.Thomas R Hargrove，Victoria L Cabanilla.The impact of semidwarf varieties on Asian rice-breeding programs[J].BioScience,1979,29(12):731-735.
5.Peter R Jennings.Plant Type as a Rice Breeding Objective 1[J].Crop Science,1964,4(1):13-15.
6.JJ Walcott，DR Laing.Some physiological aspects of growth and yield in wheat crops:a comparison of a semidwarf and a standard height cultivar[J].Australian Journal of Experimental Agriculture,1976,16(81):578-587.
Claims (7)
1. a method for regulating the plant type of rice, which comprises the step of losing the function of OsYAF9a protein, wherein the amino acid sequence of the OsYAF9a protein is SEQ ID No:2, wherein the rice plant type is regulated to reduce the plant height and/or tiller number of the rice, and the variety of the rice is Nipponbare or 9311.
2. The method of claim 1, wherein the variety of rice is Nipponbare.
3. The method of claim 1 wherein the nucleotide coding sequence of the OsYAF9a protein is set forth in SEQ ID No: 1.
4. The method of any one of claims 1-3, wherein the step of functionally deleting the OsYAF9a protein is accomplished by a method of gene knock-out, gene knock-down, or frameshift mutation.
5. The method of claim 4, wherein the knockout and/or frameshift mutation uses a CRISPR/Cas9 vector.
6. The method of claim 5 further comprising selecting NGG within exon 1 or exon 3 within the genomic nucleotide sequence of the OsYaf9a gene.
7. The method of claim 5 or 6, wherein the CRISPR/Cas9 vector comprises a target sequence for gene knockout, the nucleotide sequence of the target sequence being set forth in SEQ ID NO 5 or SEQ ID NO 6.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010284015.0A CN111876429B (en) | 2020-04-10 | 2020-04-10 | Application of rice protein OsYAF9a in regulation of rice plant type |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010284015.0A CN111876429B (en) | 2020-04-10 | 2020-04-10 | Application of rice protein OsYAF9a in regulation of rice plant type |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111876429A CN111876429A (en) | 2020-11-03 |
| CN111876429B true CN111876429B (en) | 2022-05-17 |
Family
ID=73153964
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010284015.0A Active CN111876429B (en) | 2020-04-10 | 2020-04-10 | Application of rice protein OsYAF9a in regulation of rice plant type |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111876429B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010046221A1 (en) * | 2008-10-23 | 2010-04-29 | Basf Plant Science Gmbh | Plants with increased yield (nue) |
| CN102027115A (en) * | 2008-03-31 | 2011-04-20 | 希尔雷斯股份有限公司 | Promoter, promoter control elements, and combinations, and uses thereof |
| CN103503777A (en) * | 2012-06-21 | 2014-01-15 | 先锋国际良种公司 | Carriers and method for gene application for glutamate receptor polypeptide |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090044297A1 (en) * | 1999-05-06 | 2009-02-12 | Andersen Scott E | Transgenic plants with enhanced agronomic traits |
| US7098324B2 (en) * | 2001-07-30 | 2006-08-29 | Texas Tech University | Chitinase encoding DNA molecules from cotton expressed preferentially in secondary walled cells during secondary wall deposition and a corresponding promoter |
-
2020
- 2020-04-10 CN CN202010284015.0A patent/CN111876429B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102027115A (en) * | 2008-03-31 | 2011-04-20 | 希尔雷斯股份有限公司 | Promoter, promoter control elements, and combinations, and uses thereof |
| WO2010046221A1 (en) * | 2008-10-23 | 2010-04-29 | Basf Plant Science Gmbh | Plants with increased yield (nue) |
| CN103503777A (en) * | 2012-06-21 | 2014-01-15 | 先锋国际良种公司 | Carriers and method for gene application for glutamate receptor polypeptide |
Non-Patent Citations (2)
| Title |
|---|
| XM_015786087.2;佚名;《GenBank》;20180807;1-5 * |
| 水稻YEATS结构域包含基因OsYAF9的克隆及材料创制;刘河源;《中国优秀博硕士学位论文全文数据库(硕士)基础科学辑》;20200215;A006-166 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111876429A (en) | 2020-11-03 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111073873B (en) | Application of PP84 protein and coding gene thereof in regulation and control of plant drought resistance | |
| CN110862993B (en) | Gene ZKM89 for controlling plant height and ear position height of corn and application thereof | |
| CN111153974A (en) | Corn disease-resistant gene and molecular marker and application thereof | |
| CN111848764B (en) | Application of rice protein OsARP6 in regulation and control of rice plant type | |
| CN112941086B (en) | Application of OsPIL15 gene in regulation and control of rice salt tolerance | |
| CN111303259A (en) | Application of rice transcription factor gene OsBEAR1 in cultivation of rice variety with increased coleoptile or suitable for direct seeding in field | |
| CN110592097B (en) | Rice spike regulation gene, rice spike regulation mutant, molecular marker and application thereof | |
| CN111286504A (en) | Gene orf188 for regulating and controlling oil content of rape seeds | |
| CN111876429B (en) | Application of rice protein OsYAF9a in regulation of rice plant type | |
| CN111848763B (en) | Application of rice protein OsSWC6 in regulation and control of rice plant type | |
| WO2023087761A1 (en) | APPLICATION OF SOYBEAN GIBBERELLIN 3β-HYDROXYLASE ENCODING GENE GMGA3OX1 | |
| CN116640770A (en) | Application of OsBRY1 Gene in Improving Rice Yield Traits | |
| CN110862440A (en) | Gene ZKM465 for controlling corn plant height and application thereof | |
| US11840693B2 (en) | Restorer plants | |
| CN114921583A (en) | QTL for controlling wheat plant height, candidate gene TaDHL-7B thereof and application | |
| CN112029777B (en) | OsALIS4 gene for reducing rice setting percentage and protein obtained by encoding same and application thereof | |
| CN111875685B (en) | Application of rice protein OsSWC4 in regulation of rice plant type | |
| US11312967B2 (en) | Restorer plants | |
| CN114990131B (en) | Application of OsHLS1 in obtaining semi-dwarf rice | |
| CN116042641B (en) | Soybean GmDSB1 gene related to grain and plant height development, mutant and application thereof | |
| CN116121292B (en) | Rice MYB transcription factor and application of encoded protein thereof | |
| Xiang et al. | A new indica rice germplasm with Arabidopsis‐like life cycle and high‐efficiency genetic transformation as a model system for functional genomics research | |
| CN115287290A (en) | Histone demethylase gene OsJMJ718 and application of encoding protein thereof in regulation and control of rice seed vigor | |
| CN117070515A (en) | Rice biological clock gene OsPRR37 promoter region guide RNA double-target sequence and application thereof | |
| CN117247968A (en) | Method for rapidly and directionally creating early-maturing rape and primer pair for identifying early-maturing rape |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |