CN116042641B - Soybean GmDSB1 gene related to grain and plant height development, mutant and application thereof - Google Patents
Soybean GmDSB1 gene related to grain and plant height development, mutant and application thereof Download PDFInfo
- Publication number
- CN116042641B CN116042641B CN202211009700.8A CN202211009700A CN116042641B CN 116042641 B CN116042641 B CN 116042641B CN 202211009700 A CN202211009700 A CN 202211009700A CN 116042641 B CN116042641 B CN 116042641B
- Authority
- CN
- China
- Prior art keywords
- soybean
- gene
- gmdsb1
- plant
- mutant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/10—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in agriculture
- Y02A40/146—Genetically Modified [GMO] plants, e.g. transgenic plants
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Organic Chemistry (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Plant Pathology (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Gastroenterology & Hepatology (AREA)
- Botany (AREA)
- Medicinal Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The invention discloses a lotus bean No. 12 GmDSB1 gene related to soybean grain and plant height development, and the nucleotide sequence of the gene is shown as SEQ ID No. 1. The invention also discloses a mutant gene of the GmDSB1 gene, and the nucleotide sequence of the mutant gene is shown as SEQ ID NO. 2. The invention also discloses application of the GmDSB1 gene in regulating and controlling the development mechanism of soybean grains and plant heights, improving the grain weights and plant heights of soybeans to realize high hundred grain weights and ideal plant height utilization, and application of the mutant gene of the GmDSB1 gene in cultivating improved soybean varieties. The invention provides more theoretical basis for developing genes related to the growth of soybean seeds and plant heights, can provide a new thought for the research of the growth mechanism of the soybean seeds and plant heights, and provides a new means for improving the soybean types and plant heights so as to rapidly realize the hundred-grain weight and ideal plant height utilization of the soybean or cultivate improved soybean varieties.
Description
Technical Field
The invention belongs to the technical field of plant genetic engineering, and particularly relates to a lotus bean No. 12 GmDSB1 gene related to soybean seed and plant height development, a mutant thereof and application thereof.
Background
Soybean (Glycine max) is rich in protein and vegetable oil, and is an important grain and oil dual-purpose crop. China is the origin of soybeans and has been the export country, but with the reduction of cultivated land area and the increasing demand of people for soybeans, china has become the largest import country in the world. Since the soybean yield in China is slowly increased, improving the soybean yield in China has become a primary goal of soybean breeding, and the characters related to the yield have become a core problem of soybean breeding research.
Seed (grain) size and plant height are important agronomic traits of crops and are closely related to the yield of the crops. The dwarf plants can enhance lodging resistance, improve planting density and increase light energy utilization rate, thereby improving the yield of crops, and the seed size and shape of leguminous plants are important factors for determining the yield of the leguminous plants, so that genetic research is particularly important for improving the yield of soybeans. The method separates the genes of the mutant with clone height and seed size and researches the molecular mechanism thereof, and has important significance and application value for cultivating high-yield soybean varieties.
At present, the most research on dwarf mutants is that of rice, dwarf mutants generated under natural mutation conditions are reported for the first time by Parnell et al, then dwarf mutants generated by artificial mutagenesis are reported for the first time by Oryoji et al, and a large amount of genetic research is carried out on the dwarf mutants, so that the generation of the dwarf mutants provides abundant resources for rice breeding.
There are various causes for plant dwarf, which may be caused by a decrease in internode cell number, by research on near isogenic lines of rice in Kamijma et al, 1981. Through research on a large number of dwarf mutants in plants such as rice, arabidopsis and the like, the biosynthesis, transportation, signal transduction and other processes of plant hormones such as Auxin (Auxin), gibberellin (Gibberell in Acid, GA), brassinosteroid (BR) and the like are important to the regulation of plant height. Currently, many studies are reported on dwarf mutants regulated by Gibberellin (GA) and Brassinolide (BR). Hsieh et al have found that the application of exogenous GA3 can restore the dwarf phenotype of tomato transformed AtCBF1/DREB1A gene plants, and in 2017, li Laigeng et al, a gene SBI encoding GA2 oxidase is found in rice, and demonstrated that the gene leads to the generation of the dwarf phenotype of rice. In 2011, burkhard Schulza et al have found that NA1 is a homologous gene of Arabidopsis thaliana DE-ETIOLATED2 (DET 2) in maize dwarf mutant NA plant1 (NA 1), and is a gene in the BR biosynthetic pathway. In 2017, xu Yunyuan et al reported that overexpression of OsMIR396d gene in rice resulted in a semi-dwarf and leaf tilt phenotype, which is a typical BR-enhanced mutant phenotype, the gene OsmiR396d regulates GA biosynthesis and signal transduction and BR response processes by regulating expression of different target genes downstream, and thus influences plant type development.
In recent years, research on a regulation mechanism of plant seed size is rapid, a series of key genes for regulating seed size have been isolated in model plants of arabidopsis thaliana (Arabidopsis thaliana) and rice (Oryza sativa), and a molecular regulation network is established.
The plant hormone plays an important role in the growth and development of plants, and the processes of biosynthesis, transportation, signal transduction and the like of the plant hormone have important significance in regulating the size of seeds. McAdam et al found that in peas (p.sativum), the PsTAR2 gene encodes an aminotransferase that catalyzes the conversion of tryptophan to IPyA, and that the tar2-1 mutation resulted in reduced starch content, seed shrinkage, seed, and diminution. Noguero et al found that the DASH gene regulates alfalfa (m.truncate) seed size by affecting auxin homeostasis and embryogenesis. Lin Wenhui the subject group studies found that BR promotes seed development and directly regulates seed size through the transcription factor BZR1 of the brassinosteroid signaling pathway, and that overexpression of soybean (G.max) GmBZR1 in Arabidopsis (A. Thaliana) significantly enlarges the seed of transgenic Arabidopsis. Swain et al found that a decrease in GA levels in pea (P.satium) endosperm resulted in a decrease in seed weight and an increase in the number of sterile seeds. One of the major roles of cytokinins in seed development is to regulate endosperm cell division, which can control seed size by affecting endosperm development.
At present, few reports on soybean mutants are provided, researches on seed and plant height development are quite lagged, and the action mechanism of regulating the seed size and plant height is still quite recently provided, so that the soybean seed and plant height development mutants are isolated and positioned, and the soybean seed and plant height development mutants have important theoretical and practical significance for soybean variety improvement. The applicant obtains 1 mutant with increased grains and short plants through EMS mutagenesis, locates the target gene to be the GmDSB1 gene of lotus bean No. 12 through a map cloning technology, searches to find that the T-DNA mutant plant of the arabidopsis thaliana homologous gene AtATH1 (AT 1G 30680) of the gene has no obvious phenotype, and reports that embryo development abnormality exists in animal cells. At present, no report has been made on the soybean grain and plant height regulation of soybean lotus bean No. 12 GmDSB1 gene, and the GmDSB1 gene mutant causing the increase and dwarfing of soybean grain and the application of the GmDSB1 gene mutant in soybean breeding. The GmDSB1 gene and its mutant are used in improving soybean seed size and plant height, and this makes it possible to create new soybean variety with ideal plant height and hundred grain weight.
Disclosure of Invention
Aiming at the defects of the prior art, the invention aims to provide a lotus bean No. 12 GmDSB1 gene related to the growth of soybean seeds and plant height, a mutant and application thereof.
The invention relates to a lotus bean No. 12 GmDSB1 gene related to soybean seed and plant height development, which is characterized in that: the gene is a lotus bean No. 12 GmDSB1 gene related to soybean grain enlargement and plant dwarf, and the nucleotide sequence of the gene is shown as SEQ ID No. 1.
The amino acid coded by the lotus bean No. 12 GmDSB1 gene related to the growth of soybean seeds and plant height is characterized in that: the amino acid sequence is shown as SEQ ID NO. 3.
The invention provides a mutant gene of lotus bean No. 12 GmDSB1 gene related to soybean grain and plant height development, which is characterized in that: the nucleotide sequence of the gene is shown as SEQ ID NO. 2; the mutation shows that the 1894 th base of the nucleotide sequence of the GmDSB1 gene shown in SEQ ID NO.1 is changed from wild C to T.
The amino acid encoded by the allelic mutant gene of the lotus bean No. 12 GmDSB1 gene related to the growth of soybean seeds and plant height is characterized in that: the amino acid sequence is shown as SEQ ID NO.4, and is the amino acid sequence change shown as SEQ ID NO. 3; the plant character shows seed coat cracking, grain length and grain width increase and plant dwarf, and the mutant is named Gmdsb1.
F produced by hybridization of applicants with Williams82 Using Gmdsb1 2 The generation performs map cloning and BSA sequencing to obtain GmDSB1 gene, and verifies the plant through RNAi interferenceThe accuracy of the gene was determined. Experiments prove that the GmDSB1 gene has the function of regulating and controlling the growth of soybean seeds and plant height, which is a new function of the GmDSB1 gene discovered for the first time. Meanwhile, compared with wild lotus bean No. 12, the mutant of the GmDSB1 gene and RNAi transgenic plants show seed coat cracking, the grain length and grain width are increased, the plants are short and the like, and the phenomenon has important significance for researching plant grain and plant height development mechanisms.
The invention relates to application of a lotus bean No. 12 GmDSB1 gene related to soybean seed and plant height development in research on plant seed size and plant height development mechanism, wherein the plant is preferably soybean.
The invention relates to application of a lotus bean No. 12 GmDSB1 gene related to soybean seed and plant height development in improving soybean seed and plant height to realize high hundred-seed weight and ideal plant height utilization of soybean.
The invention relates to application of a lotus bean No. 12 GmDSB1 gene related to soybean seed and plant height development in cultivating soybean varieties with increased soybean seed and short plants.
The invention relates to application of a mutant gene of a lotus bean No. 12 GmDSB1 gene related to soybean seed and plant height development in cultivating and improving soybean varieties.
The invention relates to application of a mutant gene of a lotus bean No. 12 GmDSB1 gene related to soybean seed and plant height development in cultivating soybean varieties with soybean seed enlargement and plant dwarf.
Compared with the prior art, the invention has the beneficial effects that: the stable genetic mutant Gmdsb1 is obtained through EMS mutagenesis, and the mutation of the GmdSB1 gene of the lotus bean No. 12 related to the grain and plant height development is found to cause the abnormal development of the grain and plant height of the lotus bean No. 12. The invention provides more theoretical basis for developing genes related to the growth of soybean seeds and plant heights, can provide a new thought for the research of the growth mechanism of the soybean seeds and plant heights, and provides a new means for rapidly realizing the application of high hundred-grain weight and rational plant height utilization and the application in cultivating improved soybean varieties by improving the soybean types and plant heights.
Drawings
Fig. 1: grain morphology and plant height photographs of wild type (left) and Gmdsb1 mutant (right).
Wherein, the left side of the A graph is wild lotus seed 12 seeds, and the right side is mutant Gmdsb1 seeds; panel B shows the wild type plants of the lotus seed 12, and the mutant Gmdsb1 plants.
Fig. 2: schematic of initial localization of seed mutant genes.
Fig. 3: the Gmdsb1 mutant gene was mapped finely.
Fig. 4: schematic representation of mutation sites of Gmdsb1 mutant.
Fig. 5: the structure of the GmDSB1 gene interference vector is schematically shown.
Fig. 6: plant morphology photographs of GmDSB1 interfering line seed (left) and transgenic plant seed (right).
Wherein, the left side of the A diagram is the seed of the GmDSB1 interference line plant, the right side is the seed of the wild plant, the left side of the B diagram is the GmDSB1 interference line plant, and the right side is the wild plant.
Detailed Description
The present invention will be described in detail with reference to the accompanying drawings and specific embodiments. The following examples are only preferred embodiments of the present invention, and it should be noted that the following descriptions are merely for explaining the present invention, and are not limiting in any way, and any simple modification, equivalent variation and modification of the embodiments according to the technical principles of the present invention are within the scope of the technical solutions of the present invention.
The present invention will be described in detail with reference to the accompanying drawings and specific embodiments.
In the following examples, materials, reagents, strains, plasmids, enzymes, kits and the like were used, and were obtained commercially unless otherwise specified. Among them, EMS mutagens (ethyl methylsulfonate, ethyl methansulfonate), manufactured by Sigma Co., USA.
Example 1: screening of soybean grain-enlarged and plant dwarf mutant Gmdsb1
The wild type seed No. 12 of the lotus seed is subjected to mutagenesis treatment by adopting an EMS mutagen with the concentration of 0.6 percent.The specific method comprises the following steps: selecting about 5000 wild type lotus seeds with consistent and full size and intact seed coats, soaking the wild type lotus seeds for about 4 hours at room temperature, pouring out water, soaking the wild type lotus seeds for about 8 hours by using 0.6% EMS mutagen, adding 5% sodium thiosulfate as a terminator and a antidote, flushing with running water for about 1 hour, airing the wild type lotus seeds for sowing, and harvesting the mature wild type lotus seeds by single plants to obtain M 1 Generation material 1231 single plant. Next year, sow M 1 Seed generation, wherein 30 seeds are sown in each single plant, namely M 2 The generation material is identified that one of dwarf soybean grain type abnormal mutant plants is named Gmdsb1 (see figure 1) through field phenotype observation, and the mutant shows seed coat cracking and grain length and grain width increase, and is a phenotype that seeds become larger and plants become shorter.
FIG. 1 is a grain morphology and plant height photograph of wild type and Gmdsb1 mutants. Wherein, the left side of fig. 1A is wild type lotus bean 12, the right side is mutant Gmdsb1, the upper side of fig. 1B is wild type lotus bean 12, and the lower side is mutant Gmdsb1.
Example 2: genetic analysis of soybean grain-enlarged and plant dwarf mutant Gmdsb1
Hybridization is carried out by taking soybean grain-enlarged plant dwarf mutant Gmdsb1 plant as female parent and sequencing variety Williams82 as male parent to obtain F 1 Hybrid seeds of generation F 1 Obtaining F by substitution selfing 2 Colony, pair F 2 Phenotype investigation was performed on the generation population, at 523 strain F 2 Separating 143 plant dwarf mutant with increased seed grains from the generation group, and comparing F 2 The population was subjected to χ2 test, calculated χ2= 1.7491, df=1, significant level α=0.05, and table look-up to determine χ2=0.186<3.84, demonstrating that the soybean grain size and plant dwarf mutant Gmdsb1 meets a mendelian genetic segregation ratio of 3:1, thus determining that the mutant trait is controlled by a single recessive nuclear gene.
Example 3: determination and cloning of soybean regulation grain size and plant height genes
Localization was performed using the method of map-based cloning.
1) Plant DNA extraction
About 0.8g of soybean leaf material is taken and added into a 1.5mL centrifuge tube, magnetic beads and a buckle cover are added, the mixture is rapidly placed into liquid nitrogen for precooling, and a sample is ground into powder by a sample grinding machine; after the sample is crushed into powder, 1mL of 2% CTAB extracting solution preheated at 65 ℃ is rapidly added, and the mixture is gently and reversely mixed according to the 'infinity' shape, and water bath is carried out for 0.5-2h at 65 ℃ and reversely mixed every 5min; centrifuge at 12000rpm for 10min, take 600. Mu.L of supernatant in a new 1.5mL centrifuge tube. Adding equal volume of phenol/chloroform/isoamyl alcohol, gently reversing and mixing according to the + -shaped, and centrifuging at 12000rpm for 10min; transferring the supernatant to a new 1.5mL centrifuge tube, adding equal volume chloroform/isoamyl alcohol, gently reversing and mixing according to the 'infinity' shape, and centrifuging at 12000rpm for 10min; taking 400 mu L of supernatant to a new clean centrifuge tube, adding 400 mu L of pre-cooled isopropanol with the temperature of-20 DEG, gently reversing and mixing uniformly according to the 'infinity' shape, and standing for more than 30 minutes at the temperature of-20 ℃; centrifuging at 12000rpm at 4deg.C for 10min, discarding supernatant, washing with 75% ethanol once, and blow-drying in an ultra-clean bench; 600. Mu.L of RNase A-containing double distilled water is dissolved and precipitated, digested for 15min at 37 ℃, and sequentially extracted once with equal volumes of phenol/chloroform/isoamyl alcohol and chloroform/isoamyl alcohol; taking 400 mu L of supernatant to a new 1.5mL centrifuge tube, adding 1/10 times of 3M NaAc (pH 5.2) and 2 times of precooled absolute ethyl alcohol, and standing at-20 ℃ for 30min; centrifuging at 12000rpm at 4deg.C for 10min, discarding supernatant, washing with 75% ethanol twice, and blow-drying in an ultra-clean bench; 40 mu L of double distilled water is dissolved and precipitated and is stored in a refrigerator at the temperature of minus 20 ℃ for standby.
Extracting field grown wild lotus bean No. 12 and BC according to the steps 1 F 3 Wild plants and grain dysplasia mutant soybean leaf DNA isolated in the generation.
2) PCR amplification
PCR amplification reaction (20. Mu.L system) was performed with ordinary easy Taq enzyme:
the amplification conditions were as follows:
3) Primary positioning of soybean regulation grain size and plant height genes
In the period of growing soybean to V6 (full development of 6 th three-leaf complex leaf), wild lotus seed No. 12, F 1 Hybrid plants of the generation, sequenced varieties williams82 and F 2 Extracting DNA from Gmdsb1 plants separated from the generation group, wherein the genotype of lotus bean No. 12 is a band type, the genotype of williams82 is b band type, and F 1 The genotype of the hybrid is h band type, 128 Indel molecular markers with polymorphism uniformly covering 20 chromosomes are used as amplification primers, the mutants are subjected to PCR amplification, and then acrylamide gel is used for electrophoresis separation of PCR products, so that the mutants are determined to belong to a band type b band type or h band type.
The lowest recombination rate chromosome band was found according to the formula recombination rate= (h+2b)/(a+b+h) ×2, and the result shows that the number of the exchanged single plants is gradually decreased from right to left along with the arrangement order of the 4 pairs of molecular markers on chromosome 9 by carrying out statistical analysis on the amplified product band type (see fig. 2). The minimal number of single plants was exchanged at the Gm373 marker, closely linked to the phenotype of Gmdsb1 at the Gm373 marker, and the mutation site was initially mapped to chromosome 9. Then, the development of a new Indel marker was continued at the left end of the Gm373 marker, and the minimum number of crossover plants detected at the Gm379 marker, indicating that the mutation candidate gene was located between the Gm 379-Gm 373 markers, with a physical distance between the intervals of about 3.9Mb.
2) Fine positioning and determination of soybean regulation grain size and plant height genes
Further expanding the segregating population based on initial positioning, utilizing F 2 、F 3 、F 4 The mutant individuals obtained by the generation isolation locate the target gene within the 0.25Mb interval between the Gm 398-Gm 352 markers on chromosome 9 (see FIG. 3). Meanwhile, the high-generation mutant of Gmdsb1 is used as a female parent to be backcrossed with wild lotus bean No. 12, and the backcrossed strain is selfed to F 3 Instead of, finally construct BC 1 F 3 A population. Phenotyping a population, a total of32 individual plants with mutant phenotype and 41 with normal phenotype were collected. For BC 1 F 3 DNA extraction was performed on 73 individuals selected from the population and wild type, a resequencing library of 3 pools was constructed, and sequencing was performed on BSA (Bulked Segregant Analysis, BSA) pools. Further comparing the intervals of the map-based clone and BSA mixed pool sequencing, and finding that the map-based clone intervals are matched with the BSA correlation analysis result on chromosome 9.
By looking uphttps://phytozome.jgi.doe.govThe candidate interval provided on the website contains 32 candidate genes, which are found to be included in the gene sequence. After screening and sorting, 138 SNP loci are in total in the interval, only 2 loci conform to the mutation type of EMS mutation bases, and the loci are respectively positioned in 2 candidate genes. The complete sequences of the 2 candidate genes are cloned in mutants and wild types, and the sequencing comparison shows that the SNP locus of the gene 2 cDNA sequence under the background of the single-strain AAE3499-20 mutant is heterozygous base type and does not accord with the rule of EMS mutation recessive homozygous mutation. Therefore, the gene is not a candidate gene. However, it was found that mutation of a base located downstream of ATG from C to T in the gene1 sequence of the mutant resulted in translation of an amino acid at 632 position of the protein translated from the gene from alanine to threonine (see FIG. 4), and therefore gene1 (GmDSB 1) was presumed to be a candidate gene for regulating the development of soybean kernels and plant height.
Sequencing and determining: the nucleotide sequence of the soybean kernel and plant height development related lotus bean No. 12 GmDSB1 gene is shown in SEQ ID No. 1.
The amino acid coded by the lotus bean No. 12 GmDSB1 gene related to the growth of soybean seeds and plant height has an amino acid sequence shown in SEQ ID No. 3.
The nucleotide sequence of the mutant gene of the lotus bean No. 12 GmDSB1 gene related to the growth of soybean seeds and plant height is shown as SEQ ID NO. 2; the mutation shows that the 1894 th base of the nucleotide sequence of the GmDSB1 gene shown in SEQ ID NO.1 is changed from wild C to T.
Example 4: determination that mutation of GmDSB1 gene can cause soybean grain enlargement and plant dwarf
1. GmDSB1 gene clone, construction of over-expression vector and conversion of escherichia coli and agrobacterium
1) PRIMERs were designed using prime 5.0.
The upstream primer is 5'CACCATGCGTCTTCGTTATTCCC 3';
the downstream primer was 5'TCTCTTTCTATCAGCTGGTCTGTTG 3'.
2) Extraction of soybean leaf RNA (Trizol method)
Preparing a mortar and a pestle, cleaning, airing, precooling with liquid nitrogen, putting plant materials, adding a certain amount of liquid nitrogen, and grinding the materials into powder. After the liquid nitrogen is volatilized, the ground powder is immediately filled into a 1.5mL centrifuge tube pre-cooled in advance, then 1mL Trizol extract is rapidly added, fully and uniformly mixed, and the mixture is placed at room temperature for 5min. Centrifuging at 4 ℃ for 10min at 12,000 rpm; mu.L of the supernatant was pipetted into a new 1.5mL centrifuge tube, 200. Mu.L of chloroform was added thereto and mixed with vigorous shaking for 15s, and the mixture was left at room temperature for 5min. Centrifuging at 4 ℃ for 10min at 12,000 rpm; 400 μl of the supernatant was pipetted into a new 1.5mL centrifuge tube, added with an equal volume of isopropanol, turned over 15 times up and down, mixed well and left at room temperature for about 15min. Centrifuging at 4 ℃ for 10min at 12,000 rpm; the supernatant was discarded, and 1mL of 75% ethanol was added to the precipitate to wash twice. Centrifuging at 4℃at 8,000rpm for 5min; removing the supernatant, opening the cover of the centrifuge tube in an ultra-clean workbench, drying for 5-10min, adding 30-40 mu L of RNase-Free water into the centrifuge tube, and fully dissolving RNA at 65 ℃ for about 10min. Detecting the quality of the extracted RNA sample by agarose gel electrophoresis, measuring the concentration of the RNA sample by an ultraviolet spectrophotometer, and preserving at-20 ℃ for standby or preserving at-80 ℃ for a long time.
3) Reverse transcription of RNA
The following components were added to an rnase-free centrifuge tube (40 μl reaction system):
total RNA 3. Mu.g, oligo-dT (0.05. Mu.g/. Mu.L) 2. Mu.L, dNTPs (0.01. Mu.g/. Mu.L) 2. Mu.L, RNase-Free water 20. Mu.L; gently mixing, denaturing at 65deg.C for 5min, immediately placing on ice, and ice-bathing for 2-3min; the following were then added to the centrifuge tube: 20mM DTT 4. Mu.L, 5 Xbuffer 8. Mu.L, MMLV 1. Mu.L; gently mixing, heating in a water bath at a constant temperature of 42 ℃ for 1h, denaturing at 70 ℃ for 15min to terminate the reaction, and placing the inverted cDNA in a refrigerator at-20 ℃ for later use.
4) Cloning and vector construction of GmDSB1
PCR amplification was performed using cDNA as a template, with the following system:
PCR reaction system: 10mM Tris-Cl, 1.5mM MgCl 2 50mM KCl, 200. Mu.M dNTP each, 0.8. Mu.M primer, 0.625U high-fidelity DNA polymerase, 1. Mu.L template, sterile water make up 25. Mu.L.
The reaction procedure is: pre-denaturation at 95 ℃ for 5min; denaturation at 95℃for 1min, annealing at 55℃for 1min, extension at 72℃for 1.5min,35 cycles; finally, the extension is carried out for 5min at 72 ℃.
Construction of Gateway system-based plant expression vectorsThe procedure of technical product Specification (Catalog nos.12535-019 and 12535-027) was carried out and the constructed vector was designated p35S:: gmDSB1, carrier structure diagram (see FIG. 5).
5) Coli transformation
Taking 50 mu L of competent escherichia coli out of a refrigerator at the temperature of minus 80 ℃, placing the competent escherichia coli on ice, adding a connection product, and uniformly mixing; ice bath for 30min, melting solid culture medium, cooling to about 50deg.C, adding sp (50 mg/L), and pouring into plate; after heat shock for 90 seconds at 42 ℃, rapidly carrying out ice bath for 2 minutes; adding 800 mu L of liquid LB culture medium (without antibiotics) into the tube, mixing uniformly, placing the mixture in a shaking table at 37 ℃ at 200rpm for 1 hour, and resuscitating the mixture; mu.L of IPTG (0.1M) and 20 mu L X-gal (20 mg/mL) were spread on the surface of the poured plate and used for screening for bluish white spots; after resuscitating, centrifuging at 5000rpm for 3min, removing the supernatant, leaving about 100 μl, gently blowing the pellet with a gun to spread the bacteria; coating the mixture on a prepared flat plate, inverting the flat plate, placing the flat plate into an incubator, and culturing overnight at 37 ℃; and (3) selecting a monoclonal, preserving bacteria, extracting plasmids, carrying out PCR identification, and further carrying out sequencing confirmation.
6) Agrobacterium transformation
YeP medium 25mL (rifampicin 50 mg/L) was inoculated with approximately 100. Mu.L of GV3101 Agrobacterium at 28℃and 190rpm for overnight incubation; 2mL of the bacterial liquid is collected the next day and added into 25mL of YEP culture medium (containing 50mg/L of rifampicin) and cultured until OD=about 0.8; the bacterial liquid is split charged into 27 mL tubes,5mL each, ice-bath for 30 minutes, during which 20mM CaCl was added 2 Placing the mixture on ice in a 7mL tube for standby; centrifuging the bacterial liquid at 5000rpm for 10 minutes, adding 2mL of 0.15 mol/L NaCl (sterilized and precooled at 4 ℃) into each tube after bacterial collection, and slightly bouncing; centrifuge at 5000rpm for 10min at 4℃and discard supernatant, add 200. Mu.L 20mmol/L CaCl per tube 2 Mixing uniformly, synthesizing into 1 tube, and sub-packaging into 1.5mL centrifuge tubes with 200 mu L each tube; adding 8 mu L of recombinant plasmid into each tube, uniformly mixing, and standing for 30 minutes in an ice bath; quick-freezing with liquid nitrogen for 90 seconds, and rapidly placing into a water bath kettle at 37 ℃ for 3 minutes; 1mLYEP medium (without antibiotics) was added, and resuscitated at 28℃for 1 hour at 200 rpm; melting the YEP solid culture medium, cooling to 50 ℃, adding rifampicin and Kan, and pouring into a plate; after centrifugation at 5000rpm for 3 minutes, the bacteria are collected and spread on a plate, and the plate is cultivated in an inverted dark way for 2 days at 28 ℃; and (5) selecting a monoclonal, and preserving bacteria after identification is correct.
2. Acquisition and phenotypic analysis of GmDSB1 interference strain plants
Sterilizing soybean seeds with 70% ethanol for 5min, cleaning ethanol, sterilizing with chlorine for 16 hr, and culturing in preculture medium at 24deg.C for 1 day; infecting a wild variety of lotus bean No. 12 germinated embryo with agrobacterium containing a target gene by using a vacuum infiltration auxiliary method; taking out the infected soybean, sucking off excessive bacterial liquid with sterile filter paper, placing the soybean on a co-culture medium with the section facing downwards, and carrying out dark culture for 3-4 days at 25-28 ℃; washing the dark-cultured soybean embryo with sterile water for 3-4 times, sucking with sterile filter paper, transferring to a cluster bud induction culture medium, transferring to a new culture medium every two weeks under the conditions of 25-28 ℃ and 14 hours of daily illumination, continuously culturing for four to five weeks, differentiating cluster buds, transferring the cluster buds to a bud elongation culture medium, and culturing until young seedlings (resistant seedlings) are obtained; and (3) cutting off the small buds singly after screening, transferring the small buds to a rooting culture medium, and continuously culturing for 14 days under the conditions of 25-28 ℃ and 14+/-1 hours of daily illumination to finally obtain the GmDSB1 interference line positive plants.
The phenotype of the GmDSB1 interference line plants was shown to be seed coat dehiscence, grain enlargement (see fig. 6A) and dwarf (see fig. 6B). FIG. 6 is a photograph of plant morphology of GmDSB1 interference line seed and transgenic plant seed, wherein FIG. 6A is left of GmDSB1 interference line plant seed, right of wild type plant seed, FIG. 6B is left of GmDSB1 interference line plant, right of wild type plant. The results further prove that the GmDSB1 gene can regulate the size and plant height of soybean seeds, and the GmDSB1 gene mutation can lead to the cracking of soybean seed coats, the enlargement of the seeds and the shortening of plants.
Claims (4)
1. No. 12 lotus bean related to soybean seed and plant height developmentGmDSB1A mutant gene of a gene, characterized in that: the nucleotide sequence of the mutant gene is shown as SEQ ID NO. 2; the mutation is shown as SEQ ID NO.1GmDSB1The 1894 th base of the gene nucleotide sequence is changed from wild type C to T.
2. The soybean grain and plant height development-related lotus seed No. 12 of claim 1GmDSB1An amino acid encoded by an allelic mutation of a gene, characterized in that: the amino acid sequence is shown as SEQ ID NO.4, and is the amino acid sequence change shown as SEQ ID NO. 3.
3. The soybean grain and plant height development-related lotus seed No. 12 of claim 1GmDSB1The application of the mutant gene of the gene in cultivating and improving soybean varieties.
4. The soybean grain and plant height development-related lotus seed No. 12 of claim 1GmDSB1The mutant gene of the gene is applied to the cultivation of soybean varieties with large soybean seeds and short plants.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211009700.8A CN116042641B (en) | 2022-08-23 | 2022-08-23 | Soybean GmDSB1 gene related to grain and plant height development, mutant and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211009700.8A CN116042641B (en) | 2022-08-23 | 2022-08-23 | Soybean GmDSB1 gene related to grain and plant height development, mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN116042641A CN116042641A (en) | 2023-05-02 |
| CN116042641B true CN116042641B (en) | 2023-08-29 |
Family
ID=86122378
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211009700.8A Active CN116042641B (en) | 2022-08-23 | 2022-08-23 | Soybean GmDSB1 gene related to grain and plant height development, mutant and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN116042641B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109628464A (en) * | 2018-12-26 | 2019-04-16 | 浙江大学 | A method of increasing soybean yields |
| CN114875038A (en) * | 2022-03-25 | 2022-08-09 | 山东大学 | GmILPA1 gene mutant causing soybean dwarfing and application thereof |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA3069014A1 (en) * | 2017-09-14 | 2019-03-21 | Pioneer Hi-Bred International, Inc. | Compositions and methods for stature modification in plants |
-
2022
- 2022-08-23 CN CN202211009700.8A patent/CN116042641B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109628464A (en) * | 2018-12-26 | 2019-04-16 | 浙江大学 | A method of increasing soybean yields |
| CN114875038A (en) * | 2022-03-25 | 2022-08-09 | 山东大学 | GmILPA1 gene mutant causing soybean dwarfing and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| PREDICTED: Glycine max twinkle homolog protein, chloroplastic/mitochondrial (LOC100804637), mRNA，ACCESSION：XM_003534746.4;GenBank;GenBank;第1-2页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN116042641A (en) | 2023-05-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106191107B (en) | Molecular improvement method for reducing rice grain falling property | |
| CN108239647B (en) | Gene and molecular marker for controlling rape plant type and application | |
| CN107245480B (en) | Acetolactate synthase mutant protein with herbicide resistance and application thereof | |
| WO2011127744A1 (en) | Protein ipa1 related to plant architecture, its coding genes and uses | |
| CN107177610B (en) | Arabidopsis thaliana MPK gene for regulating seed size and method for increasing seed size | |
| CN111333707B (en) | Plant grain type related protein and coding gene and application thereof | |
| CN114875038A (en) | GmILPA1 gene mutant causing soybean dwarfing and application thereof | |
| CN114990139A (en) | Application of CsHLS1 gene or protein coded by same in regulation and control of organ size of cucumber plant | |
| JP2011120597A (en) | Method for selecting genomic dna fragment | |
| CN101892246B (en) | Clone and application of pleiotropic gene Ghd8 for controlling yield, florescence and plant height of rice grain | |
| CN101747420A (en) | Dominant dwarf rice related protein, encoding gene thereof and application | |
| CN116042641B (en) | Soybean GmDSB1 gene related to grain and plant height development, mutant and application thereof | |
| CN114107373B (en) | Method for preparing arabidopsis autophagy gene mutant and application thereof | |
| CN112029777B (en) | OsALIS4 gene for reducing rice setting percentage and protein obtained by encoding same and application thereof | |
| CN112899302B (en) | Application of rape alpha-6 tubulin gene in improving rape yield | |
| CN110616226B (en) | specific molecular marker of pear PbE L F3b gene and application thereof | |
| CN116042642B (en) | Lotus bean No. 12 GmDFB1 gene related to soybean flower development, mutant and application thereof | |
| CN112430599A (en) | Rice plant type gene and application thereof | |
| CN112063597A (en) | Maize multi-copper oxidase coding gene ZmDEK559-2 and application thereof | |
| CN115710588B (en) | Application of over-expression bna-miR166f in improvement of complex quantitative characters such as rape harvest index and the like | |
| CN104558132B (en) | Peanut DELLA gene families and its encoding gene and application | |
| CN116004570B (en) | Rice chlorophyll content regulating gene OsCTR1, encoding protein and application thereof | |
| CN116121292B (en) | Rice MYB transcription factor and application of encoded protein thereof | |
| CN115786346B (en) | Application of knockout TaSnRK2.10 in increasing tillering number, spike number and grain width of wheat | |
| CN112080481B (en) | Spike-type related gene OsFRS5 and application and phenotype recovery method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |