CN111778246A

CN111778246A - Construction method and application of SDK2 gene mutation mouse model

Info

Publication number: CN111778246A
Application number: CN202010549577.3A
Authority: CN
Inventors: 王开杰
Original assignee: Beijing Tongren Hospital
Current assignee: Beijing Tongren Hospital
Priority date: 2020-06-16
Filing date: 2020-06-16
Publication date: 2020-10-16
Anticipated expiration: 2040-06-16
Also published as: CN111778246B

Abstract

The invention provides a construction method of an SDK2 gene mutation mouse model, which is characterized in that sgRNA capable of specifically recognizing an SDK2 gene is designed and constructed based on a CRISPR/Cas9 system, the sgRNA and a targeting vector constructed based on the sgRNA are injected into fertilized eggs of mice, after embryo transplantation, F0 generation mice with SDK2 gene mutation are screened from produced mice and hybridized with wild type mice, and an F1 generation mouse model with SDK2 gene mutation is obtained. The mouse model constructed by the method can be stably passaged, the action mechanism of the SDK2 gene in the mouse genetic cataract can be conveniently researched in practical application, under the condition that research materials of human patients are not easily obtained and are restricted by medical ethics, the mouse model provided by the application can be an important tool in the research of the genetic cataract, and a research model capable of stably inheriting is provided in the research of pathogenic mechanisms, treatment methods, drug screening, cataract surgery and the like.

Description

Construction method and application of SDK2 gene mutation mouse model

Technical Field

The invention belongs to the technical field of animal model construction, and particularly relates to a construction method and application of an SDK2 gene mutation mouse model.

Background

The congenital cataract is the first blindness eye disease of children, 20 thousands of children cause blindness due to cataract in the world, and accounts for about 5-20% of the blindness cause of children. The causes of the congenital cataract are many and complex, and can be divided into three types, namely genetic factors, environmental factors and unknown causes, and researches prove that the genetic factors are the most main pathogenic factors and account for about 50 percent of the pathogenic factors. More than 40 pathogenic genes are related to autosomal dominant hereditary cataract (Cat-Map; http:// Cat-Map. wustly. edu /), including 13 lens protein genes, 7 membrane protein genes (gap junction protein, channel protein and the like), 6 development and transcription factor genes, 3 cytoskeletal protein genes, 3 molecular chaperones or protein degradation system genes, and 9 other genes highly expressed in the lens. However, congenital cataract has high clinical phenotype and genetic heterogeneity, and the dominant pathogenic genes and mutation sites in different countries or regions have large differences, so that the identification of the pathogenic genes still faces huge challenges.

Cell adhesion molecules Sidekick (including Sdk1 and Sdk2) belong to the IgSF family, are located on the long arm of chromosome 17 in the human genome, mediate cell adhesion by forming homo-or heterodimers, and have important roles in retinal development and formation and motor perception. The inventor discovers the SDK2 mutation in the family of the congenital cataract of Chinese people for the first time at present, and confirms that the SDK2 gene is also one of the pathogenic genes of the congenital cataract by verifying the family and a gene knock-in mouse model in normal people. Since the reports of the congenital cataract caused by the cell adhesion molecule SDK2 are not seen at home and abroad before, the pathogenesis of the congenital cataract is not clear, and the corresponding treatment method is not researched systematically. And the eye material of the human patient is difficult to obtain and has poor reproducibility, so that the development of related research is restricted. Therefore, establishing a stable and reproducible animal model of SDK2 gene mutation becomes a technical problem to be solved by those skilled in the art.

Disclosure of Invention

In order to solve the technical problems, the invention provides a construction method and application of a mouse model with SDK2 gene mutation.

The specific technical scheme of the invention is as follows:

the invention provides a method for constructing an SDK2 gene mutation mouse model on one hand, which comprises the following steps:

the first step is as follows: based on a CRISPR/Cas9 system, an sgRNA capable of specifically recognizing an SDK2 gene is designed and constructed, the sgRNA comprises a 5 'Guide and a 3' Guide, the base sequence of the 5 'Guide is shown in any one of SEQ ID Nos. 1-7, and the base sequence of the 3' Guide is shown in any one of SEQ ID Nos. 8-14;

the second step is that: designing a cloning primer based on the sgRNA, and constructing a targeting vector carrying the cloning primer, wherein the base sequence of the cloning primer is shown as SEQ ID No 47-54:

the third step: injecting the sgRNA and the targeting vector into mouse fertilized eggs, transplanting the fertilized eggs into a surrogate mouse body, producing the mouse, carrying out genotype identification, selecting an F0 generation mouse with SDK2 gene mutation, and hybridizing the F0 generation mouse with the SDK2 gene mutation with a wild type mouse to obtain an F1 generation mouse with the SDK2 gene mutation, namely the SDK2 gene mutation mouse model.

Further, the specific method of the first step is as follows:

(1) selecting a target site to be mutated from the SDK2 gene, wherein the target site is R87C (corresponding to human R83 site);

(2) designing and screening sgRNA causing the R87C expression mutation according to the exon sequence of the target site;

(3) cas9mRNA is used for detecting the activity of all sgRNAs, and the sgRNAs with the strongest activity are screened out from the activity, and are shown as SEQ ID No.6 and SEQ ID No. 8.

Further, the specific method of the second step is as follows:

(1) designing a cloning primer based on the sgRNA, wherein the cloning primer is shown as SEQ ID No 47-54 and comprises three groups of LR, A and RR primers;

(2) and sequentially connecting the cloning primer to a pBlunt vector according to the sequence of LR, A and RR to construct a targeting vector.

Further, the specific method of the third step is as follows:

(1) transcribing the sgRNA in vitro;

(2) injecting the transcription product and the targeting vector into mouse fertilized eggs, transplanting the fertilized eggs into a surrogate mouse body, producing the mouse and carrying out genotype identification;

(3) and (3) selecting the F0 generation mouse with the SDK2 gene mutation to be hybridized with a wild type mouse to obtain the F1 generation mouse with the SDK2 gene mutation, namely the SDK2 gene mutation mouse animal model.

Further, in the third step, the base sequences of primers used for genotyping F0 mouse larvae are shown in SEQ ID Nos. 63 to 66.

The invention also provides a kit for constructing the SDK2 gene mutation mouse model, which comprises a sgRNA capable of specifically recognizing the SDK2 gene and a cloning primer which is designed on the basis of the sgRNA and is used for being connected to a targeting vector, wherein the sgRNA comprises a 5 'Guide and a 3' Guide, the base sequence of the 5 'Guide is shown in any one of SEQ ID Nos. 1-7, and the base sequence of the 3' Guide is shown in any one of SEQ ID Nos. 8-14; the base sequence of the cloning primer is shown as SEQ ID No 47-54.

Further, the kit also comprises a primer for genotyping the F0 generation young mouse, wherein the base sequence of the primer is shown as SEQ ID No. 63-66.

The invention also provides application of the method in constructing a hereditary congenital cataract mouse model.

The invention also provides application of the SDK2 gene mutation mouse model constructed by the method in screening drugs for treating cataract.

The invention also provides application of the SDK2 gene mutation mouse model constructed by the method in researching cataract pathogenesis.

The invention also provides application of the SDK2 gene mutation mouse model constructed by the method in research of cataract treatment methods.

The invention has the following beneficial effects: the invention provides a method for constructing an SDK2 gene mutation mouse model, the mouse model constructed by the method can be stably passaged, the action mechanism of an SDK2 gene in mouse genetic cataract can be conveniently researched in practical application, under the condition that research materials of human patients are not easily obtained and are restricted by medical ethics, the mouse model provided by the application becomes an important tool in genetic cataract research, and an effective research model capable of being stably inherited is provided in research on pathogenic mechanism, treatment method, drug screening, cataract surgery and the like.

Drawings

FIG. 1 is the results of activity assays of all Cas9/sgRNA plasmids in S1.4;

FIG. 2 is an electrophoresis diagram of the amplified LR, A and RR pairs of cloning primers in the targeting vector in S2.2;

FIG. 3 is a schematic diagram of Southern hybridization in S2.3;

FIG. 4 is an electrophoretic image of the enzymolysis experiment of pBluent vector clone in S2.4;

FIG. 5 is the electrophoresis chart of the enzymolysis experiment after the transformation of the targeting vector and the large plasmid extraction in S2.5, wherein 1: EcoRI + HindIII; 2: BamHI + BglII; 3: NotI + EcoRV;

FIG. 6 is an electrophoretogram of in vitro transcription of sgRNA in S3, in which the left band is the up oligo and the right band is the dnoligo;

FIG. 7 is a schematic diagram of genotyping F0 generation mice in S4.2;

FIG. 8 is an electrophoretogram of S4.3 amplified of all mouse genomes;

FIG. 9 is an electrophoretogram of S4.4 re-amplifying mice positive for S4.3;

FIG. 10 is a schematic diagram of KI mice screened in S5.2;

fig. 11 is an electrophoretogram of KI mice screened in S5.2, wherein (a): amplification results using the L-GT-F3/GT (in) -R primer pair; (b) the method comprises the following steps Amplification results using the GT (in) -F/R-GT-R primer pair;

FIG. 12 is a schematic of KO mice selected in S5.3;

FIG. 13 is an electrophoretogram of KO mice selected in S5.3;

FIG. 14 is a schematic diagram of the structure of a marker used in the course of an experiment, in which (a): GeneRuler for DNA electrophoresis^TM1kb Plus DNA Ladder, agarose gel concentration of 1%; (b) the method comprises the following steps For use in RNA electrophoresisRiboRulerLow Range RNA Ladder, agarose gel concentration of 2% and 5%; (c) the method comprises the following steps Southern blot using a maker, agarose gel concentration 0.8%;

FIG. 15 shows the result of corneal slit lamp examination of mouse with SDK2 gene mutation.

Detailed Description

Example 1 preparation of mouse model with SDK2 Gene mutation

The target Gene SDK2 is located on the reverse chain of chromosome 11 of a mouse genome, has the length of about 289.85kb, has the Gene ID of 237979 in NCBI, and can form 6 transcripts in total, and in the embodiment, a mouse model of mutation at the R87C site (corresponding to the R83C site of the human SDK2 Gene) is constructed by taking the Transcript SDK2-001(Transcript ID: ENSMUST00000041627) as an example, and the CGC is changed into TGC.

S1: sgrnas for gene knock-in were constructed.

S1.1: constructing sgRNA for gene knock-in http:// criprp. mit. edu/, obtaining 14 sgRNA sequences including 75 'guides (SEQ ID Nos. 1-7) and 7 3' guides (SEQ ID Nos. 8-14) in total, as shown in Table 1:

table 1 candidate sgRNA sequences

S1.2: respectively inserting the sgRNAs into Cas9 plasmids to construct 14 Cas9/sgRNA plasmids;

s1.3: constructing a sequencing primer aiming at the target fragment, wherein the sequencing primer is specifically shown in the table 2:

table 2 sgRNA screening sequencing primers (SEQ ID Nos. 15 to 18)

S1.4: according to the sgRNA, an oligo primer is constructed for each Guide, as shown in table 3:

TABLE 3 sgRNA screening sequencing oligo primers (SEQ ID Nos. 19 to 46)

S1.5: by UCA^TM(Universal CRISPR Activity Assay System) the Activity was determined and the results are shown in FIG. 1. The sgRNA6-1(SEQ ID No.6) and sgRNA8-1(SEQ ID No.8) with the strongest activity were selected for subsequent use.

S2: constructing a targeting vector.

S2.1: constructing cloning primers aiming at the R87C locus, specifically as shown in Table 4, and sequentially connecting the following primers to a TV-2D vector (pBlunt vector) according to the sequence of LR, A and RR to construct a targeting vector;

TABLE 4 cloning primers for target fragments (SEQ ID Nos. 47 to 54)

S2.2: constructing sequencing primers for the cloned products, which are specifically shown in table 5; the primers are used for amplifying the targeting vector, the electrophoresis result is shown in figure 2, bright bands appear at corresponding positions, and the primers LR, RR and A are confirmed to be successfully connected to the pBlunt vector;

TABLE 5 sequencing primers for the clone products (SEQ ID Nos. 55 to 58)

Primer and method for producing the same	Sequence (5 '-3')	Tm(℃)
			LR-1057F	acggtggtggttatggtgat	57
LR-1169R	taatcatgaccatcaccacccat	57
			RR-3721F	ctcgtcatgtcccagagtcc	57
RR-3803R	gtgcatatacactcatgtgcac	55

S2.3: probes were constructed against the cloned product, as shown in table 6:

TABLE 6 Southern hybridization probes (SEQ ID Nos. 59 to 62)

Carrying out Southern hybridization on the TV-2G vector connected with the cloning primer by using the primer and the probe, wherein the reaction principle is shown in FIG. 3, the enzymes and the shearing modes used in the reaction process are shown in Table 7, and finally selecting a clone with the number #7 as the correct clone;

TABLE 7 Southern cleavage strategy

Restriction enzyme	Probe needle	Product of	Target
				Mfel
	5`Probe	12.0kb	8.6kb
				Pstl	RR Probe	8.8kb	3.6kb

S2.4: carrying out enzymolysis test on the clone #7 by utilizing the endonuclease combination in the table 8, wherein the electrophoresis result is shown in fig. 4, and a band appears at a corresponding position, which indicates that the clone has a corresponding enzyme cutting site and is determined as a required clone;

TABLE 8 enzymolysis test strategy

Restriction enzyme	Desired product
		EcoRI+HindIII	3990bp+2692bp
BamHI+BglII	5407bp+1275bp
		NotI+EcoRV	4125bp+2530bp

S2.5: the targeting vector is transformed into escherichia coli, endotoxin-free plasmid extraction is carried out after culture, enzymolysis experiments are carried out on the extracted granules according to the strategy of table 8, the electrophoresis result is shown in fig. 5, bright bands appear at corresponding positions, and the clone can be stably replicated.

S3: the sgRNA6-1 and sgRNA8-1 were ligated into pT7 vector and transcribed in vitro by corresponding oligo primers (SEQ ID Nos. 29&30, 33&34) in S1.4 at 65 ℃ for 5 min. The electrophoresis results are shown in fig. 6, and bright bands appear at the corresponding positions, indicating that the sgrnas were successfully transcribed and reached the desired concentration.

S4: injecting the in vitro transcription product of the sgRNA and the targeting vector into mouse fertilized eggs to breed F0 generation mice.

S4.1: selecting a C57BL/6 mouse, collecting 282 fertilized eggs in the same batch, injecting the sgRNA and the targeting vector into the fertilized eggs in a molar ratio of 1:2, transplanting the fertilized eggs into a surrogate pregnant mouse body, and obtaining 86 young mice in total;

s4.2: primers designed for genotyping young mice were shown in FIG. 7, and the specific primers are shown in Table 9:

TABLE 9 mouse genotyping primers (SEQ ID Nos. 63 to 66)

S4.3: all the genome of the young mouse is subjected to PCR amplification by using EGE-LC-026-L-GT (in) -F and EGE-LC-026-GT-R primers, the adopted restriction enzyme is KOD-plus, a falling type PCR reaction mode is used, and the specific reaction conditions are as follows:

(1) pre-denaturation: 5min at 94 ℃;

(2) first round amplification: 30s at 94 ℃, 30s (-0.7 ℃/cycle) at 67 ℃, 1kb/min at 68 ℃ and 15 cycles;

(3) and (3) second round amplification: 30s at 94 ℃, 30s at 56 ℃ and 1kb/min at 68 ℃ for 25 cycles;

(4) extension: 10min at 68 ℃ and infinity at 4 ℃;

after the reaction, the electrophoresis result is shown in FIG. 8 (only the gel plate containing the target fragment is shown), wherein

lanes

2, 9, 12, 19, 24, 26, 44, 45, 54, 58, 60, 65, 75, and 77 show bright bands at the target position, indicating that the gel plate has the corresponding restriction enzyme sites;

s4.4: carrying out PCR amplification on the genome of the young mouse with the band by using EGE-LC-026-L-GT-F and EGE-LC-026-GT (in) -R primers, wherein the adopted restriction enzyme is KOD-plus, a falling type PCR reaction mode is used, and the specific reaction conditions are the same as S4.3;

after the reaction, the electrophoresis result is shown in FIG. 9 (only the gel plate containing the target fragment is shown), wherein

lanes

2, 12, 19, 26, 54, 60, 65, 75, and 77 show bright bands at the target position, indicating that they have the corresponding restriction enzyme sites; and finally selecting the #2 (male parent), #12 (female parent), #65 (male parent) and #77 (male parent) young mice as subsequent parents by combining the experimental results and the sequencing results.

S5: offspring mice with point mutation of the SDK2 gene were bred through F0 generation mice.

S5.1: the 4F 0 mice were mated with wild type mice to give rise to 49F 1 mice (of which mouse No.1 died);

s5.2: primers for screening KI (knock-in) mice were constructed as shown in table 10; amplifying the F1 mouse genome by using primer combinations of L-GT-F3/GT (in) -R and GT (in) -F/R-GT-R respectively, wherein the reaction principle is shown in figure 10;

TABLE 10 KI mouse screening primers (SEQ ID Nos. 67, 64 to 66)

After the reaction, the electrophoresis result is shown in FIG. 11, all lanes show bright bands at 2718bp, which indicates that all F1 mice have the target fragment; however, according to the sequencing results, only mice nos. 1, 2, 6, 7, 14, 18, 19, 20, 22, 23, 39, 40, 42, 44, 46 and 47 confirmed the knock-in of the mutant gene;

s5.3: primers for screening KO (knock out) mice were constructed as shown in table 11; the primers are used for amplifying the F1 mouse genome, and the reaction principle is shown in figure 12;

TABLE 11 KO mouse screening primers (SEQ ID Nos. 68 to 69)

After the reaction, as shown in FIG. 13, all lanes showed bands at 1892bp, in which 21, 24, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 41, 43, 45 and 48 lanes showed bands at 600bp, and the sequencing confirmed that the mouse numbered above was a KO mouse.

The growth state of the mice is observed continuously within 30 days after birth, and the KI mice are very similar to wild mice in the aspects of physique, habit and growth and development, which indicates that the SDK2 gene mutation does not have obvious influence on the growth state of the mice.

When the young mouse reaches 1 month of age, the nuclear opacity of the lens of the mouse prepared in the embodiment is determined by slit lamp microscopy (as shown in fig. 14); the same-month-old wild-type mice had normal lenses and no cataract appearance.

Example 2 study of the role of cell adhesion linkage in lens development Using the mouse model of SDK2 Gene mutation

The inventors first discovered that SDK2 mutation is associated with congenital cataracts, suggesting that cell adhesion molecules may have important functions in the developmental process and/or maintenance of function of the lens. The pathogenic mutation is taken as a starting point, and the role of cell adhesion connection in the lens development process and function maintenance is explored by comparing with a wild type, so that the pathogenic molecular mechanism of the SDK2 mutation is clarified. The specific experimental method is as follows:

(1) observing the form and degree of lenticular opacity by using a slit lamp microscope, quantifying the lenticular opacity area under a dark field microscope, and performing phenotype evaluation;

(2) selecting a 2-month-old mouse as a research object, measuring the weight and the diameter of the removed crystalline lens, evaluating the influence of the SDK2 mutation on the development of the crystalline lens, extracting the whole protein of the crystalline lens, and researching the influence of the mutation on the protein solubility and the thermal stability;

(3) primarily observing the arrangement state of mouse lens cells, the subcellular localization and aggregation of proteins and the apoptosis condition of cells under a light microscope, and discussing the influence of mutation on the pathological morphology of the lens;

(4) the morphology and the ultrastructure of the lens cells of the mice are observed by an electron microscope, and the effect of the cell adhesion molecules on maintaining the correct arrangement of the lens cells is evaluated.

The above-mentioned embodiments only express several embodiments of the present invention, and the description thereof is more specific and detailed, but not construed as limiting the scope of the present invention. It should be noted that, for a person skilled in the art, several variations and modifications can be made without departing from the inventive concept, which falls within the scope of the present invention. Therefore, the protection scope of the present patent shall be subject to the appended claims.

Sequence listing

<110> Beijing Hospital affiliated to capital medical university

Construction method and application of <120> SDK2 gene mutation mouse model

<160>67

<170>SIPOSequenceListing 1.0

<210>1

<211>23

<212>DNA

<213> Artificial sequence ()

<400>1

cgggtgaaag ccaagctcgc cgg 23

<210>2

<211>23

<212>DNA

<213> Artificial sequence ()

<400>2

gccaagctcg ccggctcagc agg 23

<210>3

<211>23

<212>DNA

<213> Artificial sequence ()

<400>3

gcctgctgag ccggcgagct tgg 23

<210>4

<211>23

<212>DNA

<213> Artificial sequence ()

<400>4

cggtgctgca cagtagagct ggg 23

<210>5

<211>23

<212>DNA

<213> Artificial sequence ()

<400>5

aaaccctcag tcagtgcatc agg 23

<210>6

<211>23

<212>DNA

<213> Artificial sequence ()

<400>6

ggcaaacttg ctttacagag agg 23

<210>7

<211>23

<212>DNA

<213> Artificial sequence ()

<400>7

ggcgctggtg agcgggtggc tgg 23

<210>8

<211>23

<212>DNA

<213> Artificial sequence ()

<400>8

tcggggtggt agtgattccg ggg 23

<210>9

<211>23

<212>DNA

<213> Artificial sequence ()

<400>9

cattggtgat cggagaagtc tgg 23

<210>10

<211>23

<212>DNA

<213> Artificial sequence ()

<400>10

agcgatgctg tgcactttcg ggg 23

<210>11

<211>23

<212>DNA

<213> Artificial sequence ()

<400>11

gtggtagtga ttccggggtg ggg 23

<210>12

<211>23

<212>DNA

<213> Artificial sequence ()

<400>12

tccgatcacc aatgtgccac tgg 23

<210>13

<211>23

<212>DNA

<213> Artificial sequence ()

<400>13

agcttaaaag agccctctat ggg 23

<210>14

<211>23

<212>DNA

<213> Artificial sequence ()

<400>14

ggacctacct cttgctacaa agg 23

<210>15

<211>25

<212>DNA

<213> Artificial sequence ()

<400>15

gttcttctga ggaccctgct caacc 25

<210>16

<211>25

<212>DNA

<213> Artificial sequence ()

<400>16

tcctaggctt ctctgttagg ggctg 25

<210>17

<211>25

<212>DNA

<213> Artificial sequence ()

<400>17

cactggggct cacagaagta ccaag 25

<210>18

<211>25

<212>DNA

<213> Artificial sequence ()

<400>18

tggcactaaa ggaagatgcc ctgtg 25

<210>19

<211>25

<212>DNA

<213> Artificial sequence ()

<400>19

caccggccaa gctcgccggc tcagc 25

<210>20

<211>23

<212>DNA

<213> Artificial sequence ()

<400>20

aaacgcgagc ttggctttca ccc 23

<210>21

<211>25

<212>DNA

<213> Artificial sequence ()

<400>21

caccggccaa gctcgccggc tcagc 25

<210>22

<211>25

<212>DNA

<213> Artificial sequence ()

<400>22

aaacgctgag ccggcgagct tggcc 25

<210>23

<211>25

<212>DNA

<213> Artificial sequence ()

<400>23

caccggcctg ctgagccggc gagct 25

<210>24

<211>25

<212>DNA

<213> Artificial sequence ()

<400>24

aaacagctcg ccggctcagc aggcc 25

<210>25

<211>23

<212>DNA

<213> Artificial sequence ()

<400>25

caccggtgct gcacagtaga gct 23

<210>26

<211>23

<212>DNA

<213> Artificial sequence ()

<400>26

aaacagctct actgtgcagc acc 23

<210>27

<211>26

<212>DNA

<213> Artificial sequence ()

<400>27

caccggaaac cctcagtcag tgcatc 26

<210>28

<211>26

<212>DNA

<213> Artificial sequence ()

<400>28

aaacgatgca ctgactgagg gtttcc 26

<210>29

<211>24

<212>DNA

<213> Artificial sequence ()

<400>29

caccggcaaa cttgctttac agag 24

<210>30

<211>24

<212>DNA

<213> Artificial sequence ()

<400>30

aaacctctgt aaagcaagtt tgcc 24

<210>31

<211>24

<212>DNA

<213> Artificial sequence ()

<400>31

caccggcgct ggtgagcggg tggc 24

<210>32

<211>24

<212>DNA

<213> Artificial sequence ()

<400>32

aaacgccacc cgctcaccag cgcc 24

<210>33

<211>22

<212>DNA

<213> Artificial sequence ()

<400>33

caccggggtg gtagtgattc cg 22

<210>34

<211>22

<212>DNA

<213> Artificial sequence ()

<400>34

aaaccggaat cactaccacc cc 22

<210>35

<211>26

<212>DNA

<213> Artificial sequence ()

<400>35

caccggcatt ggtgatcgga gaagtc 26

<210>36

<211>26

<212>DNA

<213> Artificial sequence ()

<400>36

aaacgacttc tccgatcacc aatgcc 26

<210>37

<211>24

<212>DNA

<213> Artificial sequence ()

<400>37

caccggcgat gctgtgcact ttcg 24

<210>38

<211>24

<212>DNA

<213> Artificial sequence ()

<400>38

aaaccgaaag tgcacagcat cgcc 24

<210>39

<211>25

<212>DNA

<213> Artificial sequence ()

<400>39

caccggtggt agtgattccg gggtg 25

<210>40

<211>25

<212>DNA

<213> Artificial sequence ()

<400>40

aaaccacccc ggaatcacta ccacc 25

<210>41

<211>22

<212>DNA

<213> Artificial sequence ()

<400>41

caccggatca ccaatgtgcc ac 22

<210>42

<211>22

<212>DNA

<213> Artificial sequence ()

<400>42

aaacgtggca cattggtgat cc 22

<210>43

<211>24

<212>DNA

<213> Artificial sequence ()

<400>43

caccggctta aaagagccct ctat 24

<210>44

<211>24

<212>DNA

<213> Artificial sequence ()

<400>44

aaacatagag ggctctttta agcc 24

<210>45

<211>24

<212>DNA

<213> Artificial sequence ()

<400>45

caccggacctacctcttgct acaa 24

<210>46

<211>24

<212>DNA

<213> Artificial sequence ()

<400>46

aaacttgtag caagaggtag gtcc 24

<210>47

<211>35

<212>DNA

<213> Artificial sequence ()

<400>47

ctaggaattc gtacccaaga gtcaggaact gctcg 35

<210>48

<211>41

<212>DNA

<213> Artificial sequence ()

<400>48

ctaggagctc caattggaga ggcaggatgc aagcagatca g 41

<210>49

<211>38

<212>DNA

<213> Artificial sequence ()

<400>49

ctagggtacc tgtaaagcaa gtttgccata cacctgct 38

<210>50

<211>41

<212>DNA

<213> Artificial sequence ()

<400>50

agccagcgtg ggtgcagtcc aggctggtaa tcatgtacct g 41

<210>51

<211>39

<212>DNA

<213> Artificial sequence ()

<400>51

gattaccagc ctggactgca cccacgctgg cttctaccg 39

<210>52

<211>33

<212>DNA

<213> Artificial sequence ()

<400>52

ctaggtcgac ccggggtggg ggacctagag ttc 33

<210>53

<211>37

<212>DNA

<213> Artificial sequence ()

<400>53

ctaggcggcc gcaatcacta ccaccccgaa agtgcac 37

<210>54

<211>34

<212>DNA

<213> Artificial sequence ()

<400>54

ctagaagctt ctctagagag gggcaggagc tagg 34

<210>55

<211>20

<212>DNA

<213> Artificial sequence ()

<400>55

acggtggtgg ttatggtgat 20

<210>56

<211>23

<212>DNA

<213> Artificial sequence ()

<400>56

taatcatgac catcaccacc cat 23

<210>57

<211>20

<212>DNA

<213> Artificial sequence ()

<400>57

ctcgtcatgt cccagagtcc 20

<210>58

<211>22

<212>DNA

<213> Artificial sequence ()

<400>58

gtgcatatac actcatgtgc ac 22

<210>59

<211>21

<212>DNA

<213> Artificial sequence ()

<400>59

caactccatg agctaaggct t 21

<210>60

<211>22

<212>DNA

<213> Artificial sequence ()

<400>60

ggctgtcatg agacatcgct tc 22

<210>61

<211>24

<212>DNA

<213> Artificial sequence ()

<400>61

cctacctctt gctacaaagg agac 24

<210>62

<211>22

<212>DNA

<213> Artificial sequence ()

<400>62

gtcaaaatgt cacaaggtgg cc 22

<210>63

<211>28

<212>DNA

<213> Artificial sequence ()

<400>63

gaactcgatg tagaccaggc tggccttg 28

<210>64

<211>25

<212>DNA

<213> Artificial sequence ()

<400>64

gtgtgacatt acagagctcc catgc 25

<210>65

<211>22

<212>DNA

<213> Artificial sequence ()

<400>65

ggccatgggc agaatcctgc ac 22

<210>66

<211>25

<212>DNA

<213> Artificial sequence ()

<400>66

agggggctgg gtcaaggaga tgttt 25

<210>67

<211>25

<212>DNA

<213> Artificial sequence ()

<400>67

ggtagggatg tgtataggga gtgcg 25

Claims

1. A method for constructing an SDK2 gene mutation mouse model is characterized by comprising the following steps:

2. The method for constructing the mouse model with the mutation in the SDK2 gene of claim 1, wherein the concrete method in the first step is as follows:

(1) selecting a target site to be mutated from the SDK2 gene, the target site being R87C;

(3) cas9mRNA is used for detecting the activity of all sgRNAs, and the sgRNAs with the strongest activity are screened out from the activity, as shown in SEQ ID No.6 and SEQ ID No. 8.

3. The method for constructing a mouse animal model with the SDK2 gene mutation according to claim 1, wherein the second step comprises the following steps:

4. The method for constructing a mouse model with a mutated SDK2 gene according to claim 1, wherein the third step is as follows:

(1) transcribing the sgRNA in vitro;

5. The method for constructing a mouse model with a mutant SDK2 gene according to claim 4, wherein in the third step, the base sequence of a primer used for genotyping F0 mouse larvae is shown as SEQ ID Nos. 63-66.

6. A kit for constructing the mouse model with the SDK2 gene mutation according to any one of claims 1-5, comprising a sgRNA capable of specifically recognizing the SDK2 gene, and a cloning primer designed on the basis of the sgRNA and used for connecting to a targeting vector, wherein the sgRNA comprises a 5 'Guide and a 3' Guide, the base sequence of the 5 'Guide is shown in any one of SEQ ID Nos. 1-7, and the base sequence of the 3' Guide is shown in any one of SEQ ID Nos. 8-14; the base sequence of the cloning primer is shown as SEQ ID No 47-54.

7. The kit of claim 6, further comprising a primer for genotyping F0 mouse larvae, wherein the primer has a base sequence shown in SEQ ID Nos. 63-66.

8. Use of the method of any one of claims 1 to 5 for the construction of a mouse model of genetic congenital cataract.

9. SDK constructed by the method of any one of claims 1 to 52The application of the gene mutation mouse model in screening the medicine for treating cataract.

10. SDK constructed by the method of any one of claims 1 to 52The gene mutation mouse model is applied to research on cataract pathogenesis and treatment methods.