CN111778177B - Mycoplasma bovis Mbov _0274 gene mutant strain and application thereof - Google Patents
Mycoplasma bovis Mbov _0274 gene mutant strain and application thereof Download PDFInfo
- Publication number
- CN111778177B CN111778177B CN202010490087.0A CN202010490087A CN111778177B CN 111778177 B CN111778177 B CN 111778177B CN 202010490087 A CN202010490087 A CN 202010490087A CN 111778177 B CN111778177 B CN 111778177B
- Authority
- CN
- China
- Prior art keywords
- mycoplasma bovis
- lys
- ser
- asn
- leu
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N1/00—Microorganisms, e.g. protozoa; Compositions thereof; Processes of propagating, maintaining or preserving microorganisms or compositions thereof; Processes of preparing or isolating a composition containing a microorganism; Culture media therefor
- C12N1/20—Bacteria; Culture media therefor
- C12N1/205—Bacterial isolates
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12R—INDEXING SCHEME ASSOCIATED WITH SUBCLASSES C12C - C12Q, RELATING TO MICROORGANISMS
- C12R2001/00—Microorganisms ; Processes using microorganisms
- C12R2001/01—Bacteria or Actinomycetales ; using bacteria or Actinomycetales
- C12R2001/35—Mycoplasma
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/02—Bacterial antigens
- A61K39/0241—Mollicutes, e.g. Mycoplasma, Erysipelothrix
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
- A61K2039/552—Veterinary vaccine
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Veterinary Medicine (AREA)
- General Engineering & Computer Science (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Public Health (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Communicable Diseases (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Tropical Medicine & Parasitology (AREA)
- Virology (AREA)
- Biomedical Technology (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a Mycoplasma bovis Mbov _0274 gene mutant, belonging to the technical field of prevention and treatment of animal infectious diseases, wherein the mutant is named as Mycoplasma bovis (Mycoplasma bovis) T9.202 and is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020084, and the nucleotide sequence of the Mbov _0274 gene is shown in SEQ ID NO: 1. The invention detects the ability of T9.202 strain stimulating BoMac cell to express IL-8 by qRT-PCR, and the result shows that the ability of Mycoplasma bovis strain T9.202 inducing BoMac cell to express cell factor is reduced, and the invention is expected to play an important role in the field of mycoplasma bovis immune control.
Description
Technical Field
The invention belongs to the technical field of prevention and treatment of animal infectious diseases, and particularly relates to a mycoplasma bovis Mbov _0274 gene mutant strain, which has the application potential in the aspect of preparing mycoplasma bovis vaccines, and the mutant strain has the capability of inducing macrophages to express IL-8 cytokines.
Background
Mycoplasma bovis (m.bovis) belongs to Mollicutes, Mycoplasma order, Mycoplasma family, Mycoplasma genus, is an important pathogen that endangers the development of the cattle industry, is widely present in the world, can infect cattle of any age, and the onset of the disease is often related to transport stress, and is manifested as chronic pneumonia, arthritis, and the like in most cases. Lactating cows are mainly characterized by bovine mycoplasma mastitis, and calves are infected by milk to suffer from mycoplasma pneumonia and arthritis. With the increase of antibiotic resistance in clinic, the prevention and treatment of bovine mycoplasma disease is an urgent problem in large-scale cattle farms, and the solution of the problem depends on the development of new drugs and new vaccines. However, the pathogenic mechanism of mycoplasma bovis is unclear and seriously hinders the development of new drugs and new vaccines, and further hinders the effective prevention, control and treatment of mycoplasma bovis diseases.
Construction of mutant pools using transposons has found application in various mycoplasmas, mainly Tn916 and Tn4001 and transposons derived therefrom. In Mycoplasma gallisepticum, Tn916 and mini-Tn4001 transposons were successfully used to construct mutant pools containing 424 and 738 strains, respectively, and to screen for genes associated with biofilm formation (Wang et al 2017, Whetzel et al 2003). The pMT85 vector containing the mini-Tn4001 transposon was used to construct a mutant library of ureaplasma parvum (Aboklaish et al 2014). In mycoplasma agalactiae, pools of mutants constructed using the mini-Tn4001 transposon mutagenesis system were used to screen for genes associated with cell co-culture growth and colonization and spread in the host (Baranowski et al 2014, Baranowski et al 2010).
The invention constructs the mutant strain of the mycoplasma bovis Mbov _0274 gene by using a random transposon mutation technology, and identifies the reduction of the ability of inducing inflammatory cytokines by the interaction research with bovine macrophages, thereby prompting that the mutant strain is expected to be used as a vaccine for development and applied to the field of mycoplasma bovis immune control.
Disclosure of Invention
The invention aims to provide a mutant Mbov _0274 gene mycoplasma bovis strain, which is expected to play an important role as a vaccine strain in the field of mycoplasma bovis immune control because the strain induces the reduction of the ability of macrophages to express IL-8 cytokines.
The technical idea is as follows: the applicant uses mycoplasma bovis HB0801 (accession number on GenBank is CP002058) as a parent strain, uses a PEG-mediated transformation method to transform a pMT85 plasmid containing a transposon into mycoplasma bovis, uses gentamicin as a resistance selection marker, and successfully constructs a mycoplasma bovis mutant library. Through a large amount of screening of mutant strains, an Mbov _0274 gene mutant strain is successfully identified from a mutant library, and a transposon insertion site is positioned behind 315328 sites of mycoplasma bovis HB0801 genome and behind 1664 sites of the Mbov _0274 gene. Western blot verifies that the mutant strain has the defect of Mbovp0274 protein expression. The applicant named the mutant as Mycoplasma bovis T9.202 and Mycoplasma bovis T9.202, which was preserved in China Center for Type Culture Collection (CCTCC) at 27 months and 4 months in 2020, Wuhan university in Wuhan City, Hubei province, with the preservation number of CCTCC NO: m2020084. Finally, the expression quantity of the cytokine after the mutant strain infects the bovine macrophage is detected by using a qRT-PCR technology, and the result shows that the T9.202 strain has obviously reduced capability of inducing the macrophage to express IL-8 compared with the wild virulent strain HB0801 and the attenuated strain HB0801-150.2, thereby indicating that the strain is a virulence attenuated strain and has potential for being used as a vaccine strain for development and application.
The detailed technical scheme is described in the detailed description.
Drawings
FIG. 1: the transposon insertion mutation site in the Mbov _0274 gene sequence. In the figure: the sequence shown in the box is the sequencing sequence of the junction of the transposon and the HB0801 genome, and the orientation shown is the insertion orientation of the transposon relative to the genome.
FIG. 2: and (3) the detection result that the T9.202 mutant strain stimulates BoMac to express IL-8. In the figure: p < 0.001; p < 0.005; p < 0.01; DS p > 0.05.
Detailed Description
Example 1: construction of Mycoplasma bovis insertion mutant library
The applicant isolated a strain of Mycoplasma bovis HB0801, named Mycoplasma bovis HB0801, from diseased lung tissue of sick cattle at 6 months 2008, which strain is disclosed in the patent literature of CN 102220263 a.
The pMT85 plasmid, which was awarded by doctor Eric Baranowski, French, Agroplektory, contains a mini Tn4001 transposon (mini-Tn4001) having introduced therein a gentamicin resistance marker encoded by the aacA-aphD gene, which is located between two Inverted Repeats (IR) at both ends of the transposed segment, and a transposase gene (tnPA) located outside the repeats, which prevents transposition from occurring again (Baranowski et al 2010).
Constructing a mutant library by taking M.bovis HB0801 as a parent strain, and specifically operating as follows: collect M.bovis cultured to late log, wash twice with cold DPBS buffer, resuspend in 0.1M CaCl2Incubating in solution on ice for 30 min; the prepared Mycoplasma bovis competent cells were mixed with 3. mu.g of pMT85 plasmid, 10. mu.g of yeast tRNA and 1mL of 50% PEG 8000. After 1min of incubation, the mixture was diluted into 5mL of PPLO medium and incubated at 37 ℃ for 3 h. Mycoplasma bovis was then washed, resuspended in 1mL PPLO medium, and plated onto gentamicin-containing PPLO solid medium. Incubating at 37 ℃ for 3-7 d, selecting single colonies, culturing in 1mL PPLO broth containing gentamicin until logarithmic phase, preserving strains at-80 ℃, and establishing mycoplasma bovis HB0801 mutant library.
Example 2 sequencing and identification of mutant genomes of M.bovis mutant library
The bacterial genome extraction kit (purchased from Takara Bio Inc.) is used for extracting mycoplasma bovis total DNA from a mycoplasma bovis mutant library, the joint of Tn4001 transposon and mycoplasma bovis genome is sequenced, the sequencing result is compared with the whole genome sequence of mycoplasma bovis HB0801, and the result shows that the transposon insertion sequence is covered in the gene Mbov _0274 involved in the mutant T9.202, the size is 3438bp, the transposon insertion sequence is located behind the 315328 site of the genome, and the position is behind the 1664 site of the Mbov _0274 gene (figure 1).
Example 3: verification of capability of T9.202 mutant in stimulating BoMac cells to express cytokines
Mycoplasma bovis culture and enumeration: inoculating Mycoplasma bovis virulent strain HB0801, Mycoplasma bovis attenuated strain Mbovhb0801-150.2, and T9.202 at a ratio of 1:1000 to PPLO liquid culture medium, standing at 37 deg.C and 5% CO2After the cultivation in the incubator for 36h reaches the logarithmic phase, CFU counting is carried out, and the method comprises the following steps: diluting the cultured bacterial liquid by 10 times, spreading 10 μ L of bacterial liquid with appropriate dilution on PPLO solid culture medium, culturing at 37 deg.C under inversion with 5% CO2After 3 ~ 7 days of culture in the incubator, carry out the bacterial colony count under the stereomicroscope, the bacterial colony number computational formula is: CFU/mL ═ colony number × dilution × 100.
Mixing BoMacAccording to 2X 10 per hole6The cells were seeded at a density of 6-well cell plates at 37 ℃ in 5% CO2Culturing until the cells adhere to the wall according to the infection ratio of 1:1000 adding Mycoplasma bovis HB0801 or Mycoplasma bovis MbovHB0801-150.2 or T9.202, and setting the complete cell culture medium as a negative control group. Each set was repeated with 3 wells. 37 ℃ and 5% CO2Cells were collected after 6h, 12h, and 24h incubation, respectively.
Extraction of RNA
(1) Adding 0.2mL of chloroform, shaking vigorously for 15s, incubating at room temperature for 2-3min, and centrifuging at 12000g at 4 ℃ for 15 min;
(2) transferring the water layer to a new RNase-free EP tube, adding 0.5mL of isopropanol, gently mixing, incubating at room temperature for 10min, centrifuging at 12000g at 4 ℃ for 10min, removing the supernatant, and allowing colloidal RNA precipitate to be seen at the bottom of the tube;
(3) adding 1mL of 75% ethanol, gently mixing, centrifuging at 7500g at 4 ℃ for 10min, and removing the supernatant;
(4) the RNA was air dried for 5-10min, but not completely dried. Dissolving with 50 μ L DEPC water, mixing, and water bathing at 60 deg.C for 10 min;
(5) the concentration and purity of RNA are measured by an ultraviolet spectrophotometer, and the RNA is stored at the temperature of minus 80 ℃ for standby.
Reverse transcription
According to
II qRT SuperMix reverse transcription kit (purchased from Nanjing Novodax Biotech Co., Ltd.) instructions. First, genomic DNA was removed, and the reaction system was as follows: 4 XgDNA wiper Mix (from Nanjing Novowed Biotechnology Co., Ltd.) 2. mu.L, template RNA500ng, RNase free deionized water (from Binyun Biotechnology Co., Ltd.) To final 8. mu.L, adding each reagent into RNase free PCR tube, gently mixing, and allowing To act at 42 ℃ for 2 min. Then, reverse transcription was performed: the reaction solution contained in an amount of 8. mu.L,
II qRT SuperMixII (purchased from Nanjing Novozan Biotechnology Co., Ltd.) 2. mu.L, mixing, reacting at 5 deg.C for 10min, at 42 deg.C for 30min, and at 85 deg.C for 5min,the product was stored in a-20 ℃ freezer.
Real-time fluorescent quantitative PCR detection of cytokine expression
SYBR qPCR Mix (purchased from Nanjing Novowed Biotechnology Co., Ltd.) is used for carrying out relative real-time quantitative PCR reaction, and beta-actin is used as an internal reference gene to detect the relative expression condition of mRNA of each gene. Each sample is provided with an internal reference gene and a target gene for amplification, and each reaction is provided with 3 repeats. The reaction system is shown in Table 1, and the reaction procedure is as follows: 2min at 50 ℃ and 10min at 95 ℃ for pre-denaturation; denaturation at 95 ℃ for 15s, renaturation at 60 ℃ for 30s, elongation at 72 ℃ for 30s, and circulation at 40. The beta-actin detection primer is as follows: an upstream primer (5 '-3') AGCAAGCAGGAGTACGATGAG, a downstream primer (5 '-3') ATCCAACCGACTGCTGTCA; the IL-8 detection primers are: an upstream primer (5 '-3') GAAGAGAGCTGAGAAGCAAGATCC and a downstream primer (5 '-3') ACCCACACAGAACATGAGGC.
TABLE 1 fluorescent quantitative PCR reaction System
The experimental results show that T9.202(Mut274 group) began to decrease in its ability to stimulate IL-8 expression by BoMac cells starting 6h after infection compared to wild strain HB0801(P1 group); and the ability of BoMac to stimulate IL-8 expression at 12h and 24h post-infection was reduced compared to the passaged attenuated strain MbovHB0801-150.2 (group P150) (FIG. 2).
The term in the specification states:
the encoding gene of M.bovis Mbovp274 protein is represented by Mbov _ 0274;
the mycoplasma bovis local isolate is represented by mycoplasma bovis HB 0801;
the passage weakening strain of mycoplasma bovis is represented by mycoplasma bovis MbovHB 0801-150.2.
Sequence listing
<110> university of agriculture in Huazhong
<120> Mycoplasma bovis Mbov _0274 gene mutant strain and application thereof
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1770
<212> DNA
<213> Mycoplasma bovis (Mycoplasma bovis)
<400> 1
atgaataaga aaaaattatt gtttggaatt attccattag cagtagctgc tccaatgatt 60
gcagcatcat gtcaaaaaaa tgacaaaaaa gtggtgtttc aatttgctca gtcaaattct 120
tggcctttgc ctaagatgct tgtaccttta gttaagtact acaatacaac atttagcaaa 180
cacaaagact tcttacctat agaactacaa tttagtgaca aaacaaaaac cactagagag 240
tttgaattaa ttaaaaaggt aaaaaatgac attgaaacaa acaatgaagc agcattgcca 300
aaccttattc taggagcaca atctggtgct tatgtactta atcaacacaa aagattaatg 360
gatctttctg actatggaat aactaagtca atatttaata aaaatattgc cgacttacac 420
tcaaaactac caggtcaaaa aggtaatgac aaaatttata gcattccatt tgataattta 480
gacgtagatg ctgttgttta taatcttgaa gttttagatt atatgtttaa aatgattaaa 540
aagaacggcg gaaatgttga cgagaaggca acaattgttc aaaaagctac cgaagcaggc 600
agagagggtg ttggttcaaa attaccggaa aatactattt gaaaagcatt agaggcgaaa 660
agcaatgaag tctttaaggg acttactgta aacgatgaaa catttaagtc tgttgaaagt 720
atcaaggaat ttgctaaaaa attctatgaa ggcactaagc taaatgaatc aaaagttaat 780
gatgagacat taactggaga agttatttca gtagattatg ccaatgactt attatttaaa 840
gaacttcact cgcaaattga taaagacaag cttgtatatg atttagaaga gactggcaat 900
cctgaaaagc ctgttaatgt taaatataac atagttcaag atcaagacat aaagagcaag 960
tttaagtcat tgttaagcgg ttataaagaa gcaataaaaa gacatgcata caaagtaggt 1020
gctaacaaca aggttttcca aacgataaat tttggtaaca agggcgaaaa ctctagcata 1080
aatatcgcta gattcaaaag cgctataggt tttgcagcaa gcgttggcgt taattcaaca 1140
atgtacagta gtagactaaa agaaaattat ggcaaaaatg accctgattt tgctaaaaaa 1200
gttgcttcat atgaagatgt ttatatggat ccacaattaa caacaattaa aaaagattcg 1260
caaaaaatat ttactgaagg cggttctagc ttactagtgt taaaatctaa agacagttca 1320
atgaataaag ctgttgcaaa gttcgttaaa tgactatttg aaggaaccaa taatgcctat 1380
aatcaagggg tagaagaaaa ctgaaaaacc tttgctaaat attctggcta cattatgcca 1440
ctagcctcag ttgtaaatga tgagagtcta aaatgatttg aaactgaagc tgataagcta 1500
aaacaaaaaa gagcaaataa atctatcagt gatgaagaat ttagaatttt aaactttcta 1560
agatcggctt atgtttctat taaatcaatt agagattttg aaaaagatag ttcaataatt 1620
gctaaaaaca atgttcagga tgataaaacc ggacaaatat atggttcaat tcaatcagct 1680
gcagtaacat gaactgatca taattctcca tcagaaataa aagaagatga cttaattaaa 1740
tcaattgaga acgaagtaaa tcataaataa 1770
<210> 2
<211> 589
<212> PRT
<213> Mycoplasma bovis (Mycoplasma bovis)
<400> 2
Met Asn Lys Lys Lys Leu Leu Phe Gly Ile Ile Pro Leu Ala Val Ala
1 5 10 15
Ala Pro Met Ile Ala Ala Ser Cys Gln Lys Asn Asp Lys Lys Val Val
20 25 30
Phe Gln Phe Ala Gln Ser Asn Ser Trp Pro Leu Pro Lys Met Leu Val
35 40 45
Pro Leu Val Lys Tyr Tyr Asn Thr Thr Phe Ser Lys His Lys Asp Phe
50 55 60
Leu Pro Ile Glu Leu Gln Phe Ser Asp Lys Thr Lys Thr Thr Arg Glu
65 70 75 80
Phe Glu Leu Ile Lys Lys Val Lys Asn Asp Ile Glu Thr Asn Asn Glu
85 90 95
Ala Ala Leu Pro Asn Leu Ile Leu Gly Ala Gln Ser Gly Ala Tyr Val
100 105 110
Leu Asn Gln His Lys Arg Leu Met Asp Leu Ser Asp Tyr Gly Ile Thr
115 120 125
Lys Ser Ile Phe Asn Lys Asn Ile Ala Asp Leu His Ser Lys Leu Pro
130 135 140
Gly Gln Lys Gly Asn Asp Lys Ile Tyr Ser Ile Pro Phe Asp Asn Leu
145 150 155 160
Asp Val Asp Ala Val Val Tyr Asn Leu Glu Val Leu Asp Tyr Met Phe
165 170 175
Lys Met Ile Lys Lys Asn Gly Gly Asn Val Asp Glu Lys Ala Thr Ile
180 185 190
Val Gln Lys Ala Thr Glu Ala Gly Arg Glu Gly Val Gly Ser Lys Leu
195 200 205
Pro Glu Asn Thr Ile Trp Lys Ala Leu Glu Ala Lys Ser Asn Glu Val
210 215 220
Phe Lys Gly Leu Thr Val Asn Asp Glu Thr Phe Lys Ser Val Glu Ser
225 230 235 240
Ile Lys Glu Phe Ala Lys Lys Phe Tyr Glu Gly Thr Lys Leu Asn Glu
245 250 255
Ser Lys Val Asn Asp Glu Thr Leu Thr Gly Glu Val Ile Ser Val Asp
260 265 270
Tyr Ala Asn Asp Leu Leu Phe Lys Glu Leu His Ser Gln Ile Asp Lys
275 280 285
Asp Lys Leu Val Tyr Asp Leu Glu Glu Thr Gly Asn Pro Glu Lys Pro
290 295 300
Val Asn Val Lys Tyr Asn Ile Val Gln Asp Gln Asp Ile Lys Ser Lys
305 310 315 320
Phe Lys Ser Leu Leu Ser Gly Tyr Lys Glu Ala Ile Lys Arg His Ala
325 330 335
Tyr Lys Val Gly Ala Asn Asn Lys Val Phe Gln Thr Ile Asn Phe Gly
340 345 350
Asn Lys Gly Glu Asn Ser Ser Ile Asn Ile Ala Arg Phe Lys Ser Ala
355 360 365
Ile Gly Phe Ala Ala Ser Val Gly Val Asn Ser Thr Met Tyr Ser Ser
370 375 380
Arg Leu Lys Glu Asn Tyr Gly Lys Asn Asp Pro Asp Phe Ala Lys Lys
385 390 395 400
Val Ala Ser Tyr Glu Asp Val Tyr Met Asp Pro Gln Leu Thr Thr Ile
405 410 415
Lys Lys Asp Ser Gln Lys Ile Phe Thr Glu Gly Gly Ser Ser Leu Leu
420 425 430
Val Leu Lys Ser Lys Asp Ser Ser Met Asn Lys Ala Val Ala Lys Phe
435 440 445
Val Lys Trp Leu Phe Glu Gly Thr Asn Asn Ala Tyr Asn Gln Gly Val
450 455 460
Glu Glu Asn Trp Lys Thr Phe Ala Lys Tyr Ser Gly Tyr Ile Met Pro
465 470 475 480
Leu Ala Ser Val Val Asn Asp Glu Ser Leu Lys Trp Phe Glu Thr Glu
485 490 495
Ala Asp Lys Leu Lys Gln Lys Arg Ala Asn Lys Ser Ile Ser Asp Glu
500 505 510
Glu Phe Arg Ile Leu Asn Phe Leu Arg Ser Ala Tyr Val Ser Ile Lys
515 520 525
Ser Ile Arg Asp Phe Glu Lys Asp Ser Ser Ile Ile Ala Lys Asn Asn
530 535 540
Val Gln Asp Asp Lys Thr Gly Gln Ile Tyr Gly Ser Ile Gln Ser Ala
545 550 555 560
Ala Val Thr Trp Thr Asp His Asn Ser Pro Ser Glu Ile Lys Glu Asp
565 570 575
Asp Leu Ile Lys Ser Ile Glu Asn Glu Val Asn His Lys
580 585
Claims (3)
1. A mycoplasma bovis (Mycoplasma bovis) The Mbov _0274 gene mutant is named as Mycoplasma bovis T9.202 and is preserved in China Center for Type Culture Collection (CCTCC) with the preservation number of M2020084, and the nucleotide sequence of the Mbov _0274 gene is shown in SEQ ID NO. 1.
2. Use of a mycoplasma bovis Mbov _0274 gene mutant as claimed in claim 1 for the preparation of a mycoplasma bovis vaccine.
3. Use according to claim 2, characterized in that: the Mycoplasma bovis Mbov _0274 gene mutant induces a reduced ability of host macrophages to express IL-8 cytokines.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010490087.0A CN111778177B (en) | 2020-06-02 | 2020-06-02 | Mycoplasma bovis Mbov _0274 gene mutant strain and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010490087.0A CN111778177B (en) | 2020-06-02 | 2020-06-02 | Mycoplasma bovis Mbov _0274 gene mutant strain and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN111778177A CN111778177A (en) | 2020-10-16 |
| CN111778177B true CN111778177B (en) | 2021-09-21 |
Family
ID=72753302
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010490087.0A Active CN111778177B (en) | 2020-06-02 | 2020-06-02 | Mycoplasma bovis Mbov _0274 gene mutant strain and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111778177B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111705013B (en) * | 2020-06-02 | 2021-12-07 | 华中农业大学 | Mycoplasma bovis Mbov _0570 gene mutant strain and application thereof |
| CN111748507B (en) * | 2020-06-02 | 2021-12-03 | 华中农业大学 | Mycoplasma bovis Mbov _0475 gene mutant strain and application thereof |
| CN111705026B (en) * | 2020-06-02 | 2021-11-26 | 华中农业大学 | Mycoplasma bovis Mbov _0280 gene mutant strain and application thereof |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111676181A (en) * | 2020-05-09 | 2020-09-18 | 华中农业大学 | Mycoplasma bovis Mbov _0145 gene mutant strain and application thereof |
| CN111705026A (en) * | 2020-06-02 | 2020-09-25 | 华中农业大学 | Mycoplasma bovis Mbov _0280 gene mutant strain and application thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| KR101360432B1 (en) * | 2009-06-18 | 2014-02-25 | 한림대학교 산학협력단 | Immunostimulatory Compositions Comprising Liposome-encapsulated Oligonucleotides as Active Ingredients |
| CN109652357B (en) * | 2019-02-21 | 2020-12-01 | 华中农业大学 | Mycoplasma bovis mutant strain with growth defect under cell co-culture and application thereof |
| CN111856006B (en) * | 2020-06-22 | 2021-07-30 | 华中农业大学 | Application of mycoplasma bovis secretory protein MbovP274 |
-
2020
- 2020-06-02 CN CN202010490087.0A patent/CN111778177B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111676181A (en) * | 2020-05-09 | 2020-09-18 | 华中农业大学 | Mycoplasma bovis Mbov _0145 gene mutant strain and application thereof |
| CN111705026A (en) * | 2020-06-02 | 2020-09-25 | 华中农业大学 | Mycoplasma bovis Mbov _0280 gene mutant strain and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN111778177A (en) | 2020-10-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111705013B (en) | Mycoplasma bovis Mbov _0570 gene mutant strain and application thereof | |
| CN111778177B (en) | Mycoplasma bovis Mbov _0274 gene mutant strain and application thereof | |
| CN105801707B (en) | A kind of hemorrhagic disease of grass carp oral vaccine and its preparation and application | |
| CN111676181B (en) | Mycoplasma bovis Mbov _0145 gene mutant strain and application thereof | |
| CN111705026B (en) | Mycoplasma bovis Mbov _0280 gene mutant strain and application thereof | |
| CN111748507B (en) | Mycoplasma bovis Mbov _0475 gene mutant strain and application thereof | |
| CN113265351B (en) | Lactobacillus W8172 and application thereof | |
| WO2021217959A1 (en) | Recombinant vector containing african swine fever virus immunogenic protein, recombinant bacteria, and application thereof | |
| CN106591195A (en) | Microbial immunopotentiator applicable to aquatic animals and application of microbial immunopotentiator | |
| KR101873682B1 (en) | Novel Lactobacillus acidophilus KNU-02 having immune enhancing activity and use thereof | |
| CN105779346B (en) | A kind of enterococcus faecium and its application of bacteriocinogeny | |
| CN115927102A (en) | Prisella megaterium, microbial inoculum, preparation method and application thereof | |
| CN111454872A (en) | Avian pathogenic escherichia coli VI type secretion system clpV gene deletion strain and construction method and application thereof | |
| CN106520817A (en) | Preparation method and applications of porcine circovirus type II recombinant lactobacillus plantarum oral vaccine | |
| CN113214407B (en) | II-type grass carp reovirus VP4-NS38 fusion protein gene, expression vector, strain and application thereof | |
| CN102719389A (en) | Capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and preparation method thereof | |
| CN109468255A (en) | Integrate probiotics clone strain, construction method and the application of single copy function F4 pili operon gene | |
| CN109897863B (en) | Lactobacillus brevis transformation method | |
| CN114181881A (en) | Novel attenuated listeria monocytogenes construction method based on amino acid modification and application | |
| CN110669714B (en) | Preparation and application of salmonella enteritidis attenuated vaccine candidate strain | |
| CN107988130A (en) | Stablize lactic acid bacteria genetic engineering subunit vaccine strain of expression porcine rotavirus VP4 albumen and preparation method thereof | |
| CN113512559A (en) | Mycoplasma bovis Mbov _0701 mutant gene and mutant strain and application thereof | |
| CN105385666A (en) | Establishment of pseudorabies virus double fluorescence labeled 5 gene deletion strain | |
| CN106754592B (en) | Streptococcus suis 2-type Rex gene knockout mutant strain SS2-1 Δ Rex and its construction method and application | |
| CN104762244B (en) | Streptococcus suis SBP_bac_5 gene-deleted strains and its construction method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |