CN111705013B

CN111705013B - Mycoplasma bovis Mbov _0570 gene mutant strain and application thereof

Info

Publication number: CN111705013B
Application number: CN202010490045.7A
Authority: CN
Inventors: 郭爱珍; 赵刚; 伊赫萨努拉·希拉尼; 张慧; 陈颖钰; 胡长敏; 陈曦; 陈建国
Original assignee: Huazhong Agricultural University
Current assignee: Huazhong Agricultural University
Priority date: 2020-06-02
Filing date: 2020-06-02
Publication date: 2021-12-07
Anticipated expiration: 2040-06-02
Also published as: CN111705013A

Abstract

The invention discloses a Mycoplasma bovis Mbov _0570 gene mutant strain, which belongs to the technical field of prevention and treatment of animal infectious diseases, is named as Mycoplasma bovis (Mycoplasma bovis) T9.171 and is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020083, and the nucleotide sequence of the Mbov _0570 gene is shown in SEQ ID NO: 1. According to the invention, the ability of T9.171 strain stimulating BoMac cell to express IL-8 is detected through qRT-PCR, the ability of the mutant strain inducing BoMac cell to express cell factors is shown to be reduced, the reduction of the toxicity of the mutant strain is prompted, and the mutant strain is expected to play an important role in the field of mycoplasma bovis immunity control as a vaccine strain.

Description

Mycoplasma bovis Mbov _0570 gene mutant strain and application thereof

Technical Field

The invention belongs to the technical field of prevention and treatment of animal infectious diseases, and particularly relates to a mycoplasma bovis Mbov _0570 gene mutant strain, which has a reduced ability of inducing macrophages to express IL-8 cytokines and has a better application potential in the aspect of preparing mycoplasma bovis vaccines.

Background

Mycoplasma bovis (m.bovis) belongs to Mollicutes, Mycoplasma order, Mycoplasma family, Mycoplasma genus, is an important pathogen that endangers the development of the cattle industry, is widely present in the world, can infect cattle of any age, and the onset of the disease is often related to transport stress, and is manifested as chronic pneumonia, arthritis, and the like in most cases. Lactating cows are mainly characterized by bovine mycoplasma mastitis, and calves are infected by milk to suffer from mycoplasma pneumonia and arthritis. With the increase of antibiotic resistance in clinic, the prevention and treatment of bovine mycoplasma disease is an urgent problem in large-scale cattle farms, and the solution of the problem depends on the development of new drugs and new vaccines. However, the pathogenic mechanism of mycoplasma bovis is unclear and seriously hinders the development of new drugs and new vaccines, and further hinders the effective prevention, control and treatment of mycoplasma bovis diseases.

The applicant constructs the Mbov _0570 gene mutant strain of mycoplasma bovis by utilizing a pMT85 vector containing a mini-Tn4001 transposon, and the interaction research with bovine macrophages proves that the capability of the macrophages for expressing IL-8 is reduced, the mutant strain is expected to be applied to the field of mycoplasma bovis immune control, and the research and development of a mycoplasma bovis virulence mechanism and an immune preparation are facilitated.

Disclosure of Invention

The invention aims to provide a mycoplasma bovis Mbov _0570 gene mutant strain, which has lower capability of inducing macrophages to express IL-8 inflammatory cytokines compared with a wild strain HB0801, and is expected to play an important role in the field of mycoplasma bovis immune control as an attenuated strain.

The applicant uses mycoplasma bovis HB0801 strain (accession number on GenBank is CP002058) as parent strain, uses PEG mediated transformation method to transform transposon-containing pMT85 plasmid into mycoplasma bovis, uses gentamicin as resistance selection marker, successfully constructs mycoplasma bovis mutant library. Through a large amount of screening of mutant strains, an Mbov _0570 gene mutant strain is successfully identified from a mutant library finally, the mutant gene of the mutant strain is Mbov _0570, the nucleotide sequence of the mutant strain is a sequence shown by 1-2265 bases in SEQ ID NO. 1, the length of the mutant strain is 2265bp, the amino acid sequence of the encoded protein of the gene is shown in SEQ ID NO. 2, and 754 amino acids are coded. The transposon insertion site is located behind the 672416 th site of the genome and behind the 409 th site of the Mbov _0570 gene, and the defective expression of the mutant Mbov P0570 is verified by Western blot.

The applicant named the mutant as Mycoplasma bovis T9.171 and Mycoplasma bovis T9.171, and the mutant was preserved in China Center for Type Culture Collection (CCTCC) at 27 months and 4 months in 2020, Wuhan university in Wuhan City, North Hu, with the preservation number of CCTCC NO: m2020083. Finally, qRT-PCR technology is used for detecting the expression quantity of the cytokine after the mutant strain infects the bovine macrophage, and the experimental result shows that the T9.171 strain has lower capability of inducing the macrophage to express IL-8 compared with the wild strain HB0801 and the passage weakening strain, which indicates that the strain is a toxicity weakening strain and has the potential of being used as a vaccine strain for development and application.

The detailed technical scheme is described in the detailed description.

Drawings

FIG. 1: the transposon in the Mbov _0570 gene sequence is inserted into a mutation site. In the figure: the sequence shown in the box is the sequencing sequence of the junction of the transposon and the HB0801 genome, and the orientation shown is the insertion orientation of the transposon relative to the genome.

FIG. 2: and (3) the detection result that the T9.171 mutant strain stimulates BoMac to express IL-8. In the figure: p < 0.001; p < 0.05; DS p > 0.05.

Detailed Description

Example 1: construction of Mycoplasma bovis insertion mutant library

The applicant isolated a strain of Mycoplasma bovis HB0801 from diseased lung tissue of sick cattle at 6 months 2008, named Mycoplasma bovis HB0801(Mycoplasma bovis HB0801), which was disclosed in the patent literature of CN 102220263 a.

The pMT85 plasmid, which was awarded by doctor Eric Baranowski, French, Agroplektory, contains a mini Tn4001 transposon (mini-Tn4001) having introduced therein a gentamicin resistance marker encoded by the aacA-aphD gene, which is located between two Inverted Repeats (IR) at both ends of the transposed segment, and a transposase gene (tnPA) located outside the repeats, which prevents transposition from occurring again (Baranowski et al 2010).

Constructing a mutant library by taking M.bovis HB0801 as a parent strain, and carrying out the following basic procedures: collect M.bovis cultured to late log, wash twice with cold DPBS buffer, resuspend in 0.1M CaCl₂Incubating in solution on ice for 30 min; the prepared Mycoplasma bovis competent cells were mixed with 3. mu.g of pMT85 plasmid, 10. mu.g of yeast tRNA and 1mL of 50% PEG 8000. After 1min of incubation, the mixture was diluted into 5mL of PPLO medium and incubated at 37 ℃ for 3 h. Mycoplasma bovis was then washed, resuspended in 1mL PPLO medium, and plated onto gentamicin-containing PPLO solid medium. Incubating at 37 ℃ for 3-7 days, and selecting a single colony to be added into 1mL of a medium containing gentamicinThe strains were stored at-80 ℃ in PPLO broth for the logarithmic phase to establish a library of M.bovis HB0801 mutants.

Example 2: screening and identification of Mycoplasma bovis T9.171 mutant

A bacterial genome extraction kit (purchased from Takara Bio-engineering Co., Ltd.) is used for extracting the whole genome of the Mycoplasma bovis T9.171 mutant, the junction of the Tn4001 transposon and the Mycoplasma bovis genome is sequenced, the sequencing result is compared with the whole genome sequence of Mycoplasma bovis HB0801, the result shows that the T9.171 mutant gene is Mbov _0570, and the size of the T9.171 mutant gene is 3438bp (figure 1) after the transposon insertion site is positioned behind the genome 672416 site and behind the Mbov _0570 gene 409 site.

Example 3: t9.171 mutant stimulating BoMac cells to express cytokines with reduced ability

Mycoplasma bovis culture and enumeration: inoculating Mycoplasma bovis HB0801, Mycoplasma bovis Mbovhb0801-150.2, and T9.171 at a ratio of 1:1000 to PPLO liquid medium, standing at 37 deg.C and 5% CO₂After the cultivation in the incubator for 36h reaches the logarithmic phase, CFU counting is carried out, and the method comprises the following steps: diluting the cultured bacterial liquid by 10 times, spreading 10 μ L of bacterial liquid with appropriate dilution on PPLO solid culture medium, culturing at 37 deg.C under inversion with 5% CO₂After 3 ~ 7 days of culture in the incubator, carry out the bacterial colony count under the stereomicroscope, the bacterial colony number computational formula is: CFU/mL ═ colony number × dilution × 100.

BoMac was adjusted to 2X 10⁶Cell density per well was seeded into 6-well cell plates, cultured to the adherent at 37 ℃, 5% CO2, at an infection ratio of 1:1000 adding Mycoplasma bovis HB0801 or Mycoplasma bovis MbovHB0801-150.2 or T9.171, and setting the complete cell culture medium as a negative control group. Each set was repeated with 3 wells. Cells were collected after incubation at 37 ℃ for 6h, 12h, and 24h with 5% CO2, respectively.

Extraction of RNA

(1) Adding 0.2mL of chloroform, shaking vigorously for 15s, incubating at room temperature for 2-3min, and centrifuging at 12000g at 4 ℃ for 15 min;

(2) transferring the water layer to a new RNase-free EP tube, adding 0.5mL of isopropanol, gently mixing, incubating at room temperature for 10min, centrifuging at 12000g at 4 ℃ for 10min, removing the supernatant, and allowing colloidal RNA precipitate to be seen at the bottom of the tube;

(3) adding 1mL of 75% ethanol, gently mixing, centrifuging at 7500g at 4 ℃ for 10min, and removing the supernatant;

(4) the RNA was air dried for 5-10min, but not completely dried. Dissolving with 50 μ L DEPC water, mixing, and water bathing at 60 deg.C for 10 min;

(5) the concentration and purity of RNA are measured by an ultraviolet spectrophotometer, and the RNA is stored at the temperature of minus 80 ℃ for standby.

Reverse transcription

According to

II qRT SuperMix reverse transcription kit (purchased from Nanjing Novodax Biotech Co., Ltd.) instructions. First, genomic DNA was removed, and the reaction system was as follows: 4 XgDNA wiper Mix (from Nanjing Novowedan Biotechnology Co., Ltd.) 2. mu.L, template RNA 500ng, RNase free deionized water (from Binyun Tian Biotechnology Co., Ltd.) To final 8. mu.L, each reagent was added To RNase free PCR tube, gently mixed and allowed To act at 42 ℃ for 2 min. Then, reverse transcription was performed: the reaction solution contained in an amount of 8. mu.L,

II qRT SuperMixII (purchased from Nanjing Novozan Biotechnology Co., Ltd.) 2. mu.L, mixing, reacting at 5 deg.C for 10min, 42 deg.C for 30min, and 85 deg.C for 5min, and storing in refrigerator at-20 deg.C.

Real-time fluorescent quantitative PCR

SYBR qPCR Mix (purchased from Nanjing Novowed Biotechnology Co., Ltd.) is used for carrying out relative real-time quantitative PCR reaction, and beta-actin is used as an internal reference gene to detect the relative expression condition of mRNA of each gene. Each sample is provided with an internal reference gene and a target gene for amplification, and each reaction is provided with 3 repeats. The reaction system is shown in Table 1, and the reaction procedure is as follows: 2min at 50 ℃ and 10min at 95 ℃ for pre-denaturation; denaturation at 95 ℃ for 15s, renaturation at 60 ℃ for 30s, elongation at 72 ℃ for 30s, and circulation at 40. The beta-actin detection primer is as follows: an upstream primer (5 '-3') AGCAAGCAGGAGTACGATGAG, a downstream primer (5 '-3') ATCCAACCGACTGCTGTCA; the IL-8 detection primers are: an upstream primer (5 '-3') GAAGAGAGCTGAGAAGCAAGATCC and a downstream primer (5 '-3') ACCCACACAGAACATGAGGC.

TABLE 1 fluorescent quantitative PCR reaction System

The experimental results show that T9.171(Mut570 group) began to decrease in its ability to stimulate IL-8 expression by BoMac cells starting 6h after infection compared to wild strain HB0801(P1 group); and the ability of BoMac to stimulate IL-8 expression only 12h after infection was reduced compared to the passaged attenuated strain MbovHB0801-150.2 (group P150) (FIG. 2).

The term in the specification states:

the encoding gene of M.bovis Mbovp570 protein is represented by Mbov _ 0570;

the mycoplasma bovis local isolate is represented by mycoplasma bovis HB 0801;

the passage weakening strain of mycoplasma bovis is represented by mycoplasma bovis MbovHB 0801-150.2.

<110> university of agriculture in Huazhong

<120> Mycoplasma bovis Mbov _0570 gene mutant strain and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2265

<212> DNA

<213> Mycoplasma bovis (Mycoplasma bovis)

<400> 1

atgaaatcta gaaaaataaa agcattattt atttcacaag caattggctt tagtgcatta 60

attccagttt tatctgcaag atgtaatgat cctaaaaata attctgaagt tatcatatat 120

caacgtaatg ctaattctga taaaacaaat gaacaatttg aaaaatataa tcaagttaac 180

ttactttcaa atataaaaga ttactttgat aaacatgaac atttagattt aataaaattt 240

aagggtggtg gcaaacctga aacagttgaa tatagtttaa tgatgcaaaa taactatatg 300

agtaagtaca tcaattttga tactgaagct ttcaaggcaa ttgttaaaaa agaactaaaa 360

ctaagcgaca agttgctaag taggcttaaa ttctcatatg actataacaa cgttacacgt 420

gacccaggaa ataattatga tgttctattt aaggttaaag ttggccttcc actagaatca 480

aatgacaaaa gtaaatatga aagtggctta tatagccaac aaatcataga ctttagaatc 540

aaaaatgtaa aagtcaaaga taatgaaaaa ccttttgctg atgcattgaa gccttatgat 600

caaaaaattc aagctttaac tagtcaagac tttgaagtca agctagaaaa tattgatgat 660

gagttaaaac aagctattac aaaatatggc attcatcaac taagctcaaa gcagtatgaa 720

aagttattaa aattttccag tgctaaatta gatgaaatat tcaaagacaa tgacaaaaaa 780

atagaaatac ctgttggtag caaaaaagaa aaatatacgc ttaaattcaa taaattcatt 840

gaagatgttg ttctaaatga tggcacatta tcaagtgcta aagcaaaaat tagaattgct 900

acttcattgt ttgacgacaa gagaaaatct actgtttgag aatcaggaaa aacagtttat 960

ggcttattta cagtacctaa agaacaaaaa ttaattaaca acttgcagtt agctgaatta 1020

attgatgtac acacaattgg taacattgag cacaatagtg atctgtcaac tttaacaaaa 1080

ggcaacttat ttattaacgt aaaagatgca aatattgaaa aagttgaaat tgataagatt 1140

acaactagtg aacaagactt tagaaatgca actgttactt taaatgttaa acttaaaaac 1200

tcacaggaat tagttaaagt tgaaaaacat cttggtgtag gcagatactc attgcttttt 1260

gataaacaat ttacaaaaca aaatattaaa gctcctgctt ttgctactga gggaataaca 1320

actaaaaact taccaagtat tgataaaacc ttttttggtc actataattc acaactattt 1380

tcaggtggat atgcttcagc aagagctttc tatgctgata atgtagttgt gcctagattt 1440

gtacacattg gtgaagacta tattgctcca gattttcaac cagtcttggc tccttatgac 1500

ggacaaattg ttgctgctta tgaacttaca actaaggtgg tggctactgg tgttggtact 1560

gttgttgtta ttaaaattcc tgttgctaat ttagattgga gtccaaaaga aaaagaaatc 1620

tatcttaatg acaatgataa acatatttat atgtcattct tgcacttaga tgctggtaag 1680

accttaaata atactagttt aggctgacaa tcagaaacag taacattagg cgagaataga 1740

acaattaagg ttgccccaac cgtgtctgct gatacaccta ctgaagtcaa aaaaggccaa 1800

attataggct ttttgggaac tcaggacact aatggtggat gaatggcaca tgcccatgtt 1860

aatttataca caaacagaaa tttctgactt tctccaaatc actttaacaa ggaatcaaaa 1920

caatcaaaca ttgacaaaag agttaaagat tataaaaaaa ctaataaggg taaaataaaa 1980

tacacacaag ttggcaatat tggtgttgaa ggtgtcacag ataaacgtgt tgttgaagtt 2040

gaccctaaaa ccggtgaagc aataaaaaca aaagtaaaaa caaataatgg caaagaaaaa 2100

ctaatgaata aatcactaaa agaattacca gtgtatttaa acaacatatc aatgctaagc 2160

aaggaacaat ctaaaggtta tgcagatcct aatcttgttt ataaattaag agattcaaaa 2220

acatttgctt ttggtataga agatttattt gaacttaata aataa 2265

<210> 2

<211> 754

<212> PRT

<213> Mycoplasma bovis (Mycoplasma bovis)

<400> 2

Met Lys Ser Arg Lys Ile Lys Ala Leu Phe Ile Ser Gln Ala Ile Gly

1 5 10 15

Phe Ser Ala Leu Ile Pro Val Leu Ser Ala Arg Cys Asn Asp Pro Lys

20 25 30

Asn Asn Ser Glu Val Ile Ile Tyr Gln Arg Asn Ala Asn Ser Asp Lys

35 40 45

Thr Asn Glu Gln Phe Glu Lys Tyr Asn Gln Val Asn Leu Leu Ser Asn

50 55 60

Ile Lys Asp Tyr Phe Asp Lys His Glu His Leu Asp Leu Ile Lys Phe

65 70 75 80

Lys Gly Gly Gly Lys Pro Glu Thr Val Glu Tyr Ser Leu Met Met Gln

85 90 95

Asn Asn Tyr Met Ser Lys Tyr Ile Asn Phe Asp Thr Glu Ala Phe Lys

100 105 110

Ala Ile Val Lys Lys Glu Leu Lys Leu Ser Asp Lys Leu Leu Ser Arg

115 120 125

Leu Lys Phe Ser Tyr Asp Tyr Asn Asn Val Thr Arg Asp Pro Gly Asn

130 135 140

Asn Tyr Asp Val Leu Phe Lys Val Lys Val Gly Leu Pro Leu Glu Ser

145 150 155 160

Asn Asp Lys Ser Lys Tyr Glu Ser Gly Leu Tyr Ser Gln Gln Ile Ile

165 170 175

Asp Phe Arg Ile Lys Asn Val Lys Val Lys Asp Asn Glu Lys Pro Phe

180 185 190

Ala Asp Ala Leu Lys Pro Tyr Asp Gln Lys Ile Gln Ala Leu Thr Ser

195 200 205

Gln Asp Phe Glu Val Lys Leu Glu Asn Ile Asp Asp Glu Leu Lys Gln

210 215 220

Ala Ile Thr Lys Tyr Gly Ile His Gln Leu Ser Ser Lys Gln Tyr Glu

225 230 235 240

Lys Leu Leu Lys Phe Ser Ser Ala Lys Leu Asp Glu Ile Phe Lys Asp

245 250 255

Asn Asp Lys Lys Ile Glu Ile Pro Val Gly Ser Lys Lys Glu Lys Tyr

260 265 270

Thr Leu Lys Phe Asn Lys Phe Ile Glu Asp Val Val Leu Asn Asp Gly

275 280 285

Thr Leu Ser Ser Ala Lys Ala Lys Ile Arg Ile Ala Thr Ser Leu Phe

290 295 300

Asp Asp Lys Arg Lys Ser Thr Val Trp Glu Ser Gly Lys Thr Val Tyr

305 310 315 320

Gly Leu Phe Thr Val Pro Lys Glu Gln Lys Leu Ile Asn Asn Leu Gln

325 330 335

Leu Ala Glu Leu Ile Asp Val His Thr Ile Gly Asn Ile Glu His Asn

340 345 350

Ser Asp Leu Ser Thr Leu Thr Lys Gly Asn Leu Phe Ile Asn Val Lys

355 360 365

Asp Ala Asn Ile Glu Lys Val Glu Ile Asp Lys Ile Thr Thr Ser Glu

370 375 380

Gln Asp Phe Arg Asn Ala Thr Val Thr Leu Asn Val Lys Leu Lys Asn

385 390 395 400

Ser Gln Glu Leu Val Lys Val Glu Lys His Leu Gly Val Gly Arg Tyr

405 410 415

Ser Leu Leu Phe Asp Lys Gln Phe Thr Lys Gln Asn Ile Lys Ala Pro

420 425 430

Ala Phe Ala Thr Glu Gly Ile Thr Thr Lys Asn Leu Pro Ser Ile Asp

435 440 445

Lys Thr Phe Phe Gly His Tyr Asn Ser Gln Leu Phe Ser Gly Gly Tyr

450 455 460

Ala Ser Ala Arg Ala Phe Tyr Ala Asp Asn Val Val Val Pro Arg Phe

465 470 475 480

Val His Ile Gly Glu Asp Tyr Ile Ala Pro Asp Phe Gln Pro Val Leu

485 490 495

Ala Pro Tyr Asp Gly Gln Ile Val Ala Ala Tyr Glu Leu Thr Thr Lys

500 505 510

Val Val Ala Thr Gly Val Gly Thr Val Val Val Ile Lys Ile Pro Val

515 520 525

Ala Asn Leu Asp Trp Ser Pro Lys Glu Lys Glu Ile Tyr Leu Asn Asp

530 535 540

Asn Asp Lys His Ile Tyr Met Ser Phe Leu His Leu Asp Ala Gly Lys

545 550 555 560

Thr Leu Asn Asn Thr Ser Leu Gly Trp Gln Ser Glu Thr Val Thr Leu

565 570 575

Gly Glu Asn Arg Thr Ile Lys Val Ala Pro Thr Val Ser Ala Asp Thr

580 585 590

Pro Thr Glu Val Lys Lys Gly Gln Ile Ile Gly Phe Leu Gly Thr Gln

595 600 605

Asp Thr Asn Gly Gly Trp Met Ala His Ala His Val Asn Leu Tyr Thr

610 615 620

Asn Arg Asn Phe Trp Leu Ser Pro Asn His Phe Asn Lys Glu Ser Lys

625 630 635 640

Gln Ser Asn Ile Asp Lys Arg Val Lys Asp Tyr Lys Lys Thr Asn Lys

645 650 655

Gly Lys Ile Lys Tyr Thr Gln Val Gly Asn Ile Gly Val Glu Gly Val

660 665 670

Thr Asp Lys Arg Val Val Glu Val Asp Pro Lys Thr Gly Glu Ala Ile

675 680 685

Lys Thr Lys Val Lys Thr Asn Asn Gly Lys Glu Lys Leu Met Asn Lys

690 695 700

Ser Leu Lys Glu Leu Pro Val Tyr Leu Asn Asn Ile Ser Met Leu Ser

705 710 715 720

Lys Glu Gln Ser Lys Gly Tyr Ala Asp Pro Asn Leu Val Tyr Lys Leu

725 730 735

Arg Asp Ser Lys Thr Phe Ala Phe Gly Ile Glu Asp Leu Phe Glu Leu

740 745 750

Asn Lys

Claims

1. A mycoplasma bovis (Mycoplasma bovis) The Mbov _0570 gene mutant is named as Mycoplasma bovis T9.171 and is preserved in China center for type culture Collection with the preservation number of CCTCC NO: M2020083, and the nucleotide sequence of the Mbov _0570 gene is shown in SEQ ID NO: 1.

2. Use of a mutant strain of mycoplasma bovis Mbov _0570 gene according to claim 1 for the preparation of a mycoplasma bovis vaccine.

3. Use according to claim 2, characterized in that: the Mycoplasma bovis Mbov _0570 gene mutant strain induces a reduction in the ability of host macrophages to express IL-8 cytokines.