CN102719389A - Capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and preparation method thereof - Google Patents
Capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and preparation method thereof Download PDFInfo
- Publication number
- CN102719389A CN102719389A CN2012101730854A CN201210173085A CN102719389A CN 102719389 A CN102719389 A CN 102719389A CN 2012101730854 A CN2012101730854 A CN 2012101730854A CN 201210173085 A CN201210173085 A CN 201210173085A CN 102719389 A CN102719389 A CN 102719389A
- Authority
- CN
- China
- Prior art keywords
- streptococcus equi
- hasb
- epizootic disease
- disease subspecies
- vaccine
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and a preparation method thereof, belonging to the technical field of animal vaccine preparation. The capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain is named Streptococcus equi subsp. zooepidemicus C55138 delta hasB, and was preserved in CCTCC (China Center for Type Culture Collection) on May 14, 2012 with the preservation number of CCTCC NO:M 2012164. The strain is constructed by hasB gene inactivation caused by allele replacing, is attenuated in toxicity, and can be used for preparing vaccine for Streptococcus equi disease. The vaccine production process is simple, the vaccine strain can be cultured on a large scale, the cost is low and the period is short; the vaccine presents cellular immunity and humoral immunity; and the vaccine is low in dosage, high in safety, low in toxicity and convenient for use, and can be popularized and used all over the world.
Description
Technical field
The present invention relates to the animal vaccine preparing technical field, be specifically related to a kind of pod membrane absence type bacterial strain streptococcus equi epizootic disease subspecies less toxic vaccine and preparation method thereof.
Background technology
Streptococcus equi epizootic disease subspecies are and mucous membrane of animal and the symbiotic a kind of bacterium of skin, and are especially more common on length, possibly cause septicemia, endocarditis and sacroiliitis to many other kinds animals, like ox, pig, sheep, dog.In China, streptococcus equi epizootic disease subspecies are important pathogenic agent that cause the swine streptococcus disease, and 1975, outburst swine streptococcus epidemic disease caused 300000 pig death in Sichuan, causes enormous economic loss.Up to the present, China's industry of raising pigs still receives the puzzlement of this disease.
Streptococcus equi epizootic disease subspecies constitute a serious threat to the All Around The World industry of raising pigs, but also do not have the effectively preventing method at present, therefore develop effective vaccine prevention streptococcus equi epizootic disease subspecies and infect and be very important.Yet, study very little about the virulence factor of this cause of disease, thus the research and development of obstruction less toxic vaccine, more type of the having only M protein (SzP) of research in the prior art.Recently, there is the investigator successfully to make up a streptococcus equi attenuated vaccine strain through the gene that knocks out coding SzP
Δ ATCC35246, and find to make that mouse avoids lethal hit.This achievement in research provides important clue for suis vaccine research direction, as the less toxic vaccine target research direction is provided for exploring other potential virulence factors of suis.
Streptococcus equi can synthesize by operon
HasABCThe mucinase pod membrane of coding is through to suis
C55138Bacterial strain
HasBGene makes this gene inactivation through allelic replacement, and this directly is convenient to study mucinase pod membrane role in the pathogenesis of this bacterium, simultaneously the relevant less toxic vaccine of research and development.
Summary of the invention
The objective of the invention is to provides a kind of pod membrane absence type bacterial strain streptococcus equi epizootic disease subspecies less toxic vaccine to above-mentioned deficiency of the prior art.
Another object of the present invention provides the preparation method of above-mentioned pod membrane absence type bacterial strain streptococcus equi epizootic disease subspecies less toxic vaccine and preparation method thereof.
The present invention realizes above-mentioned purpose through following technical scheme:
A kind of pod membrane absence type bacterial strain streptococcus equi epizootic disease subspecies attenuated vaccine strain, name is called streptococcus equi epizootic disease subspecies C55138
HasB(
Streptococcus equiSubsp.
ZooepidemicusC55138
HasB), abbreviate mutant bacteria C55138 among the present invention as
HasB, being preserved in Chinese typical culture collection center on May 14th, 2012, deposit number is CCTCC NO:M 2012164, preservation address: China. Wuhan. Wuhan University.
This mutant bacteria C55138
HasBBecause the hasB gene function lacks and can not normally synthesize pod membrane, streptococcus equi can synthesize by operon
HasABCThe mucinase pod membrane of coding, and discover that the mucinase pod membrane plays an important role in the pathogenesis of swine streptococcus disease, therefore this pod membrane absence type mutant bacteria can reduce the toxicity of bacterial strain itself greatly.
The preparation method of above-mentioned pod membrane absence type streptococcus equi epizootic disease subspecies attenuated vaccine strain respectively gets portion gene with hasB gene upstream and downstream and is connected to plasmid pG
+Host5 is last, obtains carrier pG
HasB, transform streptococcus equi epizootic disease subspecies C55138, utilize the homologous recombination principle with the hasB genetically deficient in the streptococcus equi epizootic disease subspecies C55138 genome, be built into pod membrane absence type mutant bacteria C55138
HasB
As a kind of preferred version, preparing method's concrete steps of above-mentioned pod membrane absence type streptococcus equi epizootic disease subspecies attenuated vaccine strain are following:
(1) genomic dna with streptococcus equi epizootic disease subspecies C55138 is a template, and nucleotides sequence is classified primer as shown in SEQ ID NO:1 ~ 2, pcr amplification hasBL gene fragment;
(2) genomic dna with streptococcus equi epizootic disease subspecies C55138 is a template, and nucleotides sequence is classified primer as shown in SEQ ID NO:3 ~ 4, pcr amplification hasBR gene fragment;
(3) hasBL gene fragment and the hasBR gene fragment with gained connects into plasmid pG
+Among the host5, transform streptococcus equi epizootic disease subspecies C55138, be built into pod membrane absence type streptococcus equi epizootic disease subspecies attenuated vaccine strain.
The application of above-mentioned pod membrane absence type streptococcus equi epizootic disease subspecies attenuated vaccine strain in the preparation vaccine.
A kind of preparation method of streptococcus equi epizootic disease subspecies less toxic vaccine, concrete steps are following:
(1) streptococcus equi epizootic disease subspecies C55138
HasBRecover in TSB 37 ℃ of shaking table overnight cultures;
(2) bacterial classification of getting overnight cultures in new TSB, 37 ℃ of shaking table enlarged culturing 6 ~ 8h;
(3) through bacterium liquid centrifugal 3min under the 8000rpm condition of enlarged culturing, remove supernatant;
(4) bacterium in the deposition mixes with the 20wt.% skimming milk of sterilization, and lyophilize is prepared into freeze-dried live vaccine.This freeze-dried live vaccine can be preserved in-20 ℃ of cryogenic refrigerators.
Above-mentioned TSB is a soybean casein digest medium, can buy existing procucts (OXOID, CM0129); Prescription is: Tryptones 1.5% (g/100mL); Soy peptone 0.5% (g/100mL), sodium-chlor 0.5% (g/100mL), adding distil water is formulated; Regulating the pH value is 7.2 ± 0.2, behind 121 ℃ of pressuresteam sterilizations, uses.
Compared with prior art, the present invention has following beneficial effect:
This streptococcus equi epizootic disease subspecies less toxic vaccine has the following advantages: one, manufacture craft is simple, and vaccine strains can be cultivated in a large number, and cost is low, and the cycle is short, can promote the use of in the whole world; Two, not only show cellular immunization but also humoral immunization is arranged; Three, consumption is little, and is safe, and virulence is little, easy to use.
The present invention adopts genetic engineering technique to make up pod membrane disappearance strains of streptococcus C55138
Δ hasB, this bacterial strain virulence attenuation of.Experiment has proved that this mutant strain is avirulent to mouse, uses its immune mouse, and mouse 100% is protected.
Description of drawings
Fig. 1. gene
HasBIn the site and the gene fragment of streptococcus equi epizootic disease subspecies C55138 bacterial strain, arrow is represented to synthesize
HasBThe length of gene fragment and transcriptional orientation.
Fig. 2. make up the method and the principle schematic of absence type genophore.
Fig. 3. the method with PCR and RT-PCR is identified mutant bacteria C55138
HasBStructure electrophorogram as a result, WT is a wild-type, hasB is a mutant bacteria.
Fig. 4. the figure as a result of transmission electron microscope observation wild strain and mutant strain, WT is a wild type strain, and pod membrane is thick and fine and close, and hasB is for lacking mutant strain C55138
HasB, the pod membrane disappearance.
Fig. 5. BALB/c mouse is through wild bacterium of abdominal injection and mutant bacteria C55138
HasBSurvival curve afterwards.
Fig. 6. use C55138
HasBThe wild bacteria vaccine (positive control) of mutant bacteria, deactivation, adjuvant (negative control), PBS (blank) be immune mouse respectively; Use wild bacterium that four groups of mouse are attacked poison respectively then; The mouse of attacking poison continues to observe every group of mouse survival rate 12 days.
Fig. 7. use mutant bacteria C55138
HasBPass through the detected immune mouse spleen cell of the method IFN-γ of quantitative PCR and the mRNA level of IL-4 behind the immune mouse.
Embodiment
1. material: streptococcus equi epizootic disease subspecies C55138, available from China Veterinary Drugs Supervisory Inst..Plasmid pG
+Host5 available from Appligene company (Illkirch, France).
2. primer design is synthetic
The genome structure of streptococcus equi epizootic disease subspecies C55138 (being called for short bacterial strain C55138) is seen shown in the accompanying drawing 1, is template with bacterial strain C55138 genomic dna, uses Primer Premier5.0 design amplification purpose fragment
HasBThe primer of gene, wherein the hasBL primer is to containing restriction enzyme
SalI with
BamThe restriction enzyme site of HI, the hasBR primer is to containing
BamHI with
EcoThe restriction enzyme site of RI.It is synthetic that primer is given birth to the worker by Shanghai.
hasBL1:5’-ATTTCTGTCGACGGCTCAGGATA-3’(SEQ?ID?NO:1);
hasBL2:5’-AATGGATCCTGACGCATTTAGGT-3’(SEQ?ID?NO:2);
hasBR1:5’-AACCATTACAATAACGGATCCTTTG-3’(SEQ?ID?NO:3);
hasBR2:5’-ACAACCCTGTAGCGAATTCCCTC-3’(SEQ?ID?NO:4);
3. pcr amplification goal gene
HasBL gene fragment amplification system (30 μ L):
ddH
2O 17.8μL
10×buffer 3.0μL
Mg
2+? 1.0μL
dNTP 3.0μL
hasBL1 1.5μL
hasBL2 1.5μL
Dna profiling 2.0 μ L
RTaq enzyme 0.2 μ L
The pcr amplification reaction condition: 95 ℃ of 5min, once; 94 ℃ of 1min, 55 ℃ of 45s, 72 ℃ of 45s, totally 30 circulations; 72 ℃ of 5min, once.Obtain hasBL gene fragment amplification product.
The amplification system of hasBR gene fragment (30 μ L):
ddH
2O 17.8μL
10×buffer 3.0μL
Mg
2+? 1.0μL
dNTP 3.0μL
hasBR1 1.5μL
hasBR2 1.5μL
Dna profiling 2.0 μ L
RTaq enzyme 0.2 μ L
Condition: 95 ℃ of 5min, once; 94 ℃ of 1min, 55 ℃ of 45s, 72 ℃ of 45s, totally 30 circulations; 72 ℃ of 5min, once.Obtain hasBR gene fragment amplification product.
4. pod membrane lacks the structure of bacterium
Use bacterial strain C55138 genome as template, hasBL gene fragment amplification product and plasmid pG that the amplification of step 3 method obtains
+Host5 uses restriction enzyme
SalI with
BamHI digestion, digestion product connects with the T4 ligase enzyme, recombinant plasmid in the middle of obtaining, this plasmid and hasBR gene fragment amplification product re-use restriction enzyme
BamHI with
EcoRI digestion, digestion product connects with the T4 ligase enzyme, and the end product that obtains is recombinant plasmid pG
HasB(seeing accompanying drawing 2).
PG
HasBTransform entering streptococcus equi epizootic disease subspecies C55138 through electricity, (clone of anti-Oxacyclotetradecane,erythromycin deriv is because pG for screening positive clone on 28 ℃ of Oxacyclotetradecane,erythromycin deriv flat boards
+Host5 has the Oxacyclotetradecane,erythromycin deriv resistance).Grow into the logarithm initial stage with the TSB substratum dilution back of not containing Oxacyclotetradecane,erythromycin deriv at 28 ℃ when growing into logarithmic phase behind the positive colony switching TSB substratum.Be transferred to 37 ℃ to culturing bottle and hatch 4h.Subsequently, be uniformly coated on the dull and stereotyped last 37 ℃ of growths of TSA to bacterium, select the erythromycin-sensitive clone and identify with PCR.Identify that correct recombinant clone is labeled as mutant bacteria
HasB, 37 ℃ of shaking tables are cultivated in TSB, obtain finite concentration bacterium liquid after ,-80 ℃ of refrigerators are preserved.
5. the evaluation of pod membrane absence type mutant bacteria
The mutant bacteria that makes up with wild-type streptococcus equi epizootic disease subspecies C55138 (representing) and step 4 respectively with WT
HasB(use
HasBExpression) be template, hasB1, hasB2 are primer (hasB1:ATACGATAACCTTTACCCAAGTCG, SEQ ID NO:5; HasB2:AGGTATTCGCAAATAGCTTGACC, SEQ ID NO:6), the method for conventional RT-PCR obtains purpose fragment, electrophoresis result (seeing accompanying drawing 3).The WT swimming lane amplifies the purpose fragment about 200bp, and mutant bacteria
HasBDo not amplify the purpose fragment with the swimming lane of negative control.Then, respectively with wild bacterium C55138 and mutant bacteria
HasBGenomic dna be template, hasBL1, hasBR2 are that primer carries out pcr amplification, the electrophoresis result of amplified production is seen (seeing accompanying drawing 3).The WT swimming lane amplifies the purpose fragment about 1200bp, mutant bacteria
HasBSwimming lane amplify the purpose fragment about 800bp.
The experimental result of comprehensive RT-PCR and PCR can show mutant strain
HasB HasBGenetically deficient the gene fragment about 400bp, mutant strain
HasBMake up successfully called after C55138
HasB, be preserved in Chinese typical culture collection center.
6. the outer pod membrane of transmission electron microscope observation bacterial strain born of the same parents
Bacterial strain C55138 and mutant strain
HasBSample process negative staining, through transmission electron microscope, amplification 15500 *, acceleration voltage is that 80kV observes bacterial capsule.Observations (seeing accompanying drawing 4): compare mutant bacteria C55138 with wild bacterium
HasBPod membrane disappearance.
20 4 ~ 6 age in week BALB/c mouse, be divided into 2 groups at random, inject wild bacterium C55138 for one group, another group injection mutant bacteria C55138
HasB, be used to contrast the virulence size of two kinds of bacterial strains.
After bacterium used PBS resuspended, bacterium liquid suitably was diluted to 1 * 10
5CFU/mL, mouse peritoneal inject 500 μ L, observe the mouse existing state, write down the death time of mouse, and the result is analyzed, and mouse continues to observe 12 days.
Experimental result is seen Fig. 5: mortality ratio reaches 80% in the mouse that wild bacterium is a group 9 days, and shows serious clinical symptom, mutant bacteria C55138
HasB100% survival in one group of mouse 12 days, and have no clinical symptom.
Experimental result shows: mutant bacteria
HasBVirulence significantly descend.
40 4 ~ 6 the week age female BALB/c mouse be divided into 4 groups at random, 10 every group.The 1st group of mouse, abdominal injection 500 μ L mutant bacteria C55138 for the first time
HasBCarry out immunity, bacterial concentration is 2 * 10
6CFU/mL, immune once more after 14 days with same dosage; The 2nd group of mouse carries out immunity as positive control with the vaccine of same method injection formalin-inactivated, and this deactivation vaccine is the wild bacterium of deactivation and freund's adjuvant emulsive inactivated vaccine, and abdominal injection 500 μ L for the first time, follow-up immunization are per 2 all for 1 time.The 3rd group of mouse uses identical freund's adjuvant emulsive PBS to inject mouse as negative control with same method, and the 4th group of mouse uses PBS to inject mouse as blank with same method.
After four groups of all immune completion of mouse, the wild bacterium C55138 of every group of mouse peritoneal injection lethal dose, the survival rate of observing every group of mouse, and record result.
Experimental result is seen Fig. 6: owing to there is not the immunoprotection of vaccine, the 3rd group with the 4th group of mouse behind the wild bacterium of inserting lethal dose, all death in 5 days.The 2nd group of mouse is under the immunoprotection of wild bacterium inactivated vaccine, and survival rate reaches 80%.The 1st group of mouse obtains mutant strain C55138
HasBImmunoprotection, finishing the mouse survival rate up to research is 100%.Phenomenons such as in addition, the mouse of all negative controls and blank all shows tangible clinical symptom, and is for example coarse messy by hair, and IR is slow, however mutant bacteria C55138 used
HasBMice immunized does not show any clinical symptom.
Experimental result shows: mutant bacteria C55138
HasBImmune effect than the good immune effect of wild bacterium inactivated vaccine, through mutant bacteria C55138
HasBThe mouse resistibility that immunity is crossed is strong, receive wild virus infection once more after protection ratio reach 100%.
The T cell mass is made up of two subgroups, is respectively Th1 subgroup and Th2 subgroup.Th1 Expression of Subsets IFN-γ can activate the CDCC of K cell, causes delayed type hypersensitivity, the mediated cell immunoreation.Th2 Expression of Subsets IL-4, the generation of enhancing antibody causes humoral immunization.Mouse is through mutant bacteria C55138
HasBAfter the immunity, can be through the activity of these two cell subsets of the horizontal Indirect evaluation of mRNA of IFN-γ and IL-4 in the detection mouse spleen cell.
6 BALB/c mouses are divided into two groups at random, one group of abdominal injection 1 * 10
6CFU/mL mutant bacteria C55138
HasB, another group injection PBS, dosage all is 0.5mL.Behind the injection 96h, the spleen cell of every mouse is extracted RNA respectively.Use the method evaluation IFN-γ of quantitative PCR and the transcriptional level of IL-4.
Experimental result: the quantitative PCR analysis result shows that IL-4 and the IFN-γ mRNA level in the back 96 hours mouse spleen cell of immunity significantly increases.In addition, the mRNA level of IFN-γ is significantly higher than the mRNA level (seeing accompanying drawing 7) of IL-4.
Experimental result shows: mutant strain
HasBCan activate the immunoreation of the interior Th1 of mouse body and two cell masses of Th2, show cellular immunization and humoral immunization simultaneously, and cellular immune level be significantly higher than humoral immunity level.
SEQUENCE?LISTING
< 110>Zhongshan University
< 120>a kind of pod membrane absence type streptococcus equi epizootic disease subspecies attenuated vaccine strain and preparation method thereof
<130>
<160> 6
<170> PatentIn?version?3.3
<210> 1
<211> 23
<212> DNA
< 213>artificial sequence
<400> 1
atttctgtcg?acggctcagg?ata 23
<210> 2
<211> 23
<212> DNA
< 213>artificial sequence
<400> 2
aatggatcct?gacgcattta?ggt 23
<210> 3
<211> 25
<212> DNA
< 213>artificial sequence
<400> 3
aaccattaca?ataacggatc?ctttg 25
<210> 4
<211> 23
<212> DNA
< 213>artificial sequence
<400> 4
acaaccctgt?agcgaattcc?ctc 23
<210> 5
<211> 24
<212> DNA
< 213>artificial sequence
<400> 5
atacgataac?ctttacccaa?gtcg 24
<210> 6
<211> 23
<212> DNA
< 213>artificial sequence
<400> 6
aggtattcgc?aaatagcttg?acc 23
Claims (5)
1. pod membrane absence type streptococcus equi epizootic disease subspecies attenuated vaccine strain, name is called streptococcus equi epizootic disease subspecies C55138
HasB(
Streptococcus equiSubsp.
ZooepidemicusC55138
HasB), on May 14th, 2012 was preserved in Chinese typical culture collection center, and deposit number is CCTCC NO:M 2012164.
2. the preparation method of the said pod membrane absence type of claim 1 streptococcus equi epizootic disease subspecies attenuated vaccine strain, it is characterized in that with
HasBThe gene upstream and downstream is respectively got portion gene and is connected to plasmid pG
+Host5 is last, obtains carrier pG
HasB, transform streptococcus equi epizootic disease subspecies C55138, utilize the homologous recombination principle with the hasB genetically deficient in the streptococcus equi epizootic disease subspecies C55138 genome, be built into pod membrane absence type mutant bacteria C55138
HasB
3. according to the preparation method of the said pod membrane absence type of claim 2 streptococcus equi epizootic disease subspecies attenuated vaccine strain, it is characterized in that step is following:
(1) genomic dna with streptococcus equi epizootic disease subspecies C55138 is a template, and nucleotides sequence is classified primer as shown in SEQ ID NO:1 ~ 2, pcr amplification hasBL gene fragment;
(2) genomic dna with streptococcus equi epizootic disease subspecies C55138 is a template, and nucleotides sequence is classified primer as shown in SEQ ID NO:3 ~ 4, pcr amplification hasBR gene fragment;
(3) hasBL gene fragment and the hasBR gene fragment with gained connects into plasmid pG
+Among the host5, transform streptococcus equi epizootic disease subspecies C55138, be built into pod membrane absence type streptococcus equi epizootic disease subspecies attenuated vaccine strain.
4. the application of the said pod membrane absence type of claim 1 streptococcus equi epizootic disease subspecies attenuated vaccine strain in the preparation vaccine.
5. the preparation method of a streptococcus equi epizootic disease subspecies less toxic vaccine is characterized in that step is following:
(1) streptococcus equi epizootic disease subspecies C55138
HasBRecover in TSB 37 ℃ of shaking table overnight cultures;
(2) bacterial classification of getting overnight cultures in new TSB, 37 ℃ of shaking table enlarged culturing 6 ~ 8h;
(3) through bacterium liquid centrifugal 3min under the 8000rpm condition of enlarged culturing, remove supernatant;
(4) bacterium in the deposition mixes with the 20wt.% skimming milk of sterilization, and lyophilize is prepared into freeze-dried live vaccine.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012101730854A CN102719389A (en) | 2012-05-30 | 2012-05-30 | Capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and preparation method thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012101730854A CN102719389A (en) | 2012-05-30 | 2012-05-30 | Capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and preparation method thereof |
Publications (1)
Publication Number | Publication Date |
---|---|
CN102719389A true CN102719389A (en) | 2012-10-10 |
Family
ID=46945262
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2012101730854A Pending CN102719389A (en) | 2012-05-30 | 2012-05-30 | Capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and preparation method thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN102719389A (en) |
Cited By (4)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108220182A (en) * | 2016-12-22 | 2018-06-29 | 新疆农业大学 | One plant of horse source streptococcus zooepidemicus strain X JMSY16-1 and its application in streptococcus equi disease vaccine |
CN113005072A (en) * | 2021-04-09 | 2021-06-22 | 佛山科学技术学院 | Streptococcus equi subsp zooepidemicus gene deletion strain and preparation method and application thereof |
CN115418369A (en) * | 2022-04-07 | 2022-12-02 | 佛山科学技术学院 | Recombinant streptococcus and construction method and application thereof |
WO2024002331A1 (en) * | 2022-06-30 | 2024-01-04 | Shanghai Yuguan Biotech Co., Ltd. | A live bacteria strain with reduced capsules |
Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1833723A (en) * | 2006-04-25 | 2006-09-20 | 范红结 | Chain coccus recombination subunit vaccine and prepn. thereof |
WO2009093014A2 (en) * | 2008-01-24 | 2009-07-30 | Animal Health Trust | Vaccines |
CN101703769A (en) * | 2009-11-13 | 2010-05-12 | 广东永顺生物制药有限公司 | Novel tetravalent inactivated vaccine for streptococcus suis disease |
-
2012
- 2012-05-30 CN CN2012101730854A patent/CN102719389A/en active Pending
Patent Citations (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN1833723A (en) * | 2006-04-25 | 2006-09-20 | 范红结 | Chain coccus recombination subunit vaccine and prepn. thereof |
WO2009093014A2 (en) * | 2008-01-24 | 2009-07-30 | Animal Health Trust | Vaccines |
CN101703769A (en) * | 2009-11-13 | 2010-05-12 | 广东永顺生物制药有限公司 | Novel tetravalent inactivated vaccine for streptococcus suis disease |
Non-Patent Citations (1)
Title |
---|
WEIZ,ET AL: "The capsule of Streptococcus equi ssp.zooepidemicus is a target for attenuation in vaccine development", 《VACCINE》, vol. 30, no. 31, 8 May 2012 (2012-05-08) * |
Cited By (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN108220182A (en) * | 2016-12-22 | 2018-06-29 | 新疆农业大学 | One plant of horse source streptococcus zooepidemicus strain X JMSY16-1 and its application in streptococcus equi disease vaccine |
CN108220182B (en) * | 2016-12-22 | 2021-02-26 | 新疆农业大学 | Streptococcum zooepidemicus strain XJMSY16-1 and application thereof in streptococcus equi vaccine |
CN113005072A (en) * | 2021-04-09 | 2021-06-22 | 佛山科学技术学院 | Streptococcus equi subsp zooepidemicus gene deletion strain and preparation method and application thereof |
CN115418369A (en) * | 2022-04-07 | 2022-12-02 | 佛山科学技术学院 | Recombinant streptococcus and construction method and application thereof |
WO2024002331A1 (en) * | 2022-06-30 | 2024-01-04 | Shanghai Yuguan Biotech Co., Ltd. | A live bacteria strain with reduced capsules |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
Li et al. | Development of live attenuated Streptococcus agalactiae vaccine for tilapia via continuous passage in vitro | |
CN107109372B (en) | Novel Clostridium perfringens bacteriophage Clo-PEP-1 and use thereof for inhibiting proliferation of Clostridium perfringens | |
Huang et al. | Alteration of the gut microbiome and immune factors of grass carp infected with Aeromonas veronii and screening of an antagonistic bacterial strain (Streptomyces flavotricini) | |
CN102242202B (en) | Method and kit for detecting streptococcus agalactiae | |
Zhao et al. | First reported fatal Morganella morganii infections in chickens | |
EP3922724A1 (en) | Recombinant vector containing african swine fever virus immunogenic protein, recombinant bacteria, and application thereof | |
CN102719389A (en) | Capsule deficiency type Streptococcus equi subsp. zooepidemicus attenuated vaccine strain and preparation method thereof | |
CN102776220B (en) | Construction of brucellosis A19 molecular marker vaccine strain and determination of virulence and immunogenicity | |
CN102271693B (en) | Pharmaceutical composition to protect an animal against a disorder arising from an infection with a bacterium that belongs to the group of nocardioform actinomycetes | |
CN114015660B (en) | Construction of ten-gene deleted attenuated African swine fever virus strain and application thereof as vaccine | |
Hashemzadeh et al. | Prevention of Salmonella colonization in neonatal broiler chicks by using different routes of probiotic administration in hatchery evaluated by culture and PCR techniques. | |
CN113005072A (en) | Streptococcus equi subsp zooepidemicus gene deletion strain and preparation method and application thereof | |
Shan et al. | Helicobacter pylori outer membrane protein 18 (Hp1125) is involved in persistent colonization by evading interferon-γ signaling | |
CN102676421B (en) | Bordetella bronchiseptica gene deletion strain, vaccine prepared from Bordetella bronchiseptica gene deletion strain and application | |
CN112442473B (en) | Avian Escherichia coli vaccine strain | |
CN113046384A (en) | Construction method of broad-spectrum antiviral recombinant salmonella | |
CN104593336B (en) | Porcine reproductive and respiratory syndrome embedded virus RvHBJX and its application | |
CN109735477B (en) | Preparation and application of three-gene deletion attenuated mutant strain of Listeria monocytogenes | |
KR101717281B1 (en) | Composite Vaccine Composition For Preventing Scuticociliatosis in Fish | |
CN112694988B (en) | Chicken source streptococcus suis attenuated strain and application thereof | |
CN103589693A (en) | Recombinant HVT (herpesvirus of turkey) expressing IBDV (infectious bursal disease virus) VP2 and bursin chimeric protein | |
CN116903755B (en) | Fusion protein and nucleic acid molecule for pig interleukin3, 7 and 15 co-expression, and substitution biological material and application thereof | |
CN117625505B (en) | Lactococcus lactis vector oral vaccine for producing enterotoxin escherichia coli K88 genotype and application | |
CN111944838B (en) | Application of gram-positive bacterium expression system in expression of clostridium putrefactive toxin, preparation method of clostridium putrefactive alpha toxin and vaccine | |
CN105985920A (en) | Streptococcus mutans strain SS3ST3 Delta aroC with streptococcus suis serotype-3 aroC-gene functional defect and preparation method and application of streptococcus mutans strain SS3ST3 Delta aroC |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20121010 |