CN111732646B - Plant drought-enduring associated protein and application of coding gene thereof in plant drought tolerance - Google Patents

Abstract

The invention discloses a plant drought-resistance negative regulation factor and application of a coding gene thereof in drought-resistance breeding, wherein the sequence of the protein provided by the invention is shown as SEQ ID NO:1, a transgenic plant having reduced drought tolerance as compared with the plant is obtained by introducing a CsSDG36 gene into the plant, and a transgenic plant having improved drought tolerance as compared with the plant is obtained by introducing a substance that suppresses the expression of the CsSDG36 gene into the plant. The invention has application value for researching plant drought tolerance regulation mechanism and cultivating drought tolerant or sensitive plants, and has application prospect for plant drought tolerance breeding.

Description

Plant drought-enduring associated protein and application of coding gene thereof in plant drought tolerance

Technical Field

The invention relates to the field of biology, in particular to a plant drought-enduring associated protein CsSDG36 and application of a coding gene thereof in plant drought tolerance.

Background

Drought stress is one of the major abiotic stresses in the growth of plants, and plants have evolved a complex and efficient drought tolerance mechanism to combat the damage caused by drought stress. Histone modification is an important regulation factor of adversity stress response, and histone modification enzyme mediates various histone modification changes and regulates the expression of a large number of downstream drought-tolerant genes, so that the tolerance of plants to drought stress is improved. Therefore, the apparent modification enzyme and the coding gene thereof have wide application prospect in the aspect of modifying the drought tolerance of plants.

Disclosure of Invention

The invention aims to provide a plant drought-enduring associated protein CsSDG36 and application of a coding gene thereof in plant drought tolerance.

The protein provided by the invention is derived from the national-grade fine variety of tea tree, namely the tea tree fuding white, is named as CsSDG36 and is (a), (b) or (c):

(a) the protein sequence is the protein shown in figure 1;

(b) a protein having a sequence similarity of 95% or more to (a) and associated with drought tolerance in plants;

(c) and (b) a fusion protein obtained by attaching a tag to the N-terminus or the C-terminus of (a) or (b).

The labels are specifically shown in table 1.

TABLE 1 sequences of tags

Label (R)	Number of residues	Sequence of
			Poly-Arg	5-6 (typically 5)	RRRRR
Poly-His	6-10 (generally 6)	HHHHHH
			FLAG
	8	DYKDDDDK
			Strep-tagII	8	WSHPQFEK
c-myc	10	EQKLISEEDL
			HA	9	YPYDVPDYA

The protein can be synthesized artificially, or can be obtained by synthesizing the coding gene and then carrying out biological expression.

The gene coding the CsSDG36, named CsSDG36 gene, also belongs to the protection scope of the invention.

The CsSDG36 gene is a DNA molecule as described in the following (1) or (2):

(1) the coding sequence is DNA molecule shown in SEQ ID NO. 2;

(2) DNA molecule which has more than 75% of sequence similarity with (1) and codes plant drought-resistant related protein;

expression cassettes, recombinant vectors or recombinant bacteria containing the CsSDG36 gene are within the scope of the invention.

The recombinant vector may specifically be a recombinant expression vector. The recombinant expression vector containing the gene can be constructed by using the existing expression vector. When the gene is used for constructing a recombinant expression vector, any one of enhanced, constitutive, tissue-specific or inducible promoters can be added in front of the transcription initiation nucleotide, and can be used alone or combined with other plant promoters; in addition, when the gene is used to construct a recombinant expression vector, enhancers, including translational or transcriptional enhancers, may be used, and these enhancer regions may be ATG initiation codons or adjacent regions initiation codons, etc., but must be in the same reading frame as the coding sequence to ensure proper translation of the entire sequence. The translational control signals and initiation codons are widely derived, either naturally or synthetically. The translation initiation region may be derived from a transcription initiation region or a structural gene. In order to facilitate identification and screening of the transgenic plant or the transgenic microorganism, an expression vector to be used may be processed, for example, a gene for expressing an enzyme or a luminescent compound which produces a color change in the plant or the microorganism, a gene for an antibiotic marker having resistance or a chemical-resistant agent marker, etc. From the viewpoint of transgene safety, the selection can be directly performed with phenotype without adding any selective marker gene.

The invention also protects the application of the CsSDG36 protein, which is (I) or (II) as follows:

(I) the drought tolerance of plants is enhanced;

(II) reducing the drought tolerance of the plants.

The invention also provides a plant breeding method, which comprises the following steps of improving the activity or content of the CsSDG36 protein in a target plant, thereby weakening the drought tolerance of the plant.

The invention also protects the application of the CsSDG36 gene in culturing transgenic plants with reduced drought tolerance.

The invention also provides a method for preparing the transgenic plant, which comprises the following step of introducing the CsSDG36 gene into the plant to obtain the transgenic plant with reduced drought tolerance.

The invention also provides a plant breeding method, which comprises the following steps of reducing the activity or content of the CsSDG36 protein in a target plant, thereby enhancing the drought tolerance of the plant.

The invention also provides a method for preparing the transgenic plant, which comprises the following step of introducing a substance for inhibiting the expression of the CsSDG36 gene into the plant to obtain the transgenic plant with enhanced drought tolerance.

Any of the above plants is a dicot. The dicotyledonous plants are specifically arabidopsis thaliana and tea trees. The arabidopsis thaliana can be specifically Columbia ecotype arabidopsis thaliana.

The invention provides a protein related to plant drought tolerance and a coding gene thereof, and the tolerance of a plant to drought stress is obviously reduced after the coding gene is introduced into the plant. The invention has application value for researching plant drought-tolerant mechanism and cultivating drought-tolerant or sensitive plants, and has application prospect for plant drought-tolerant breeding.

Drawings

FIG. 1 shows the histone H3 modification change condition (A) of tea tree under drought treatment (20% PEG6000) and the quantitative result (B) of histone H3 modification, and histone H3 is reference protein.

FIG. 2 is a phylogenetic tree analysis of the tea plant CsSDG36 gene.

FIG. 3 is the amino acid sequence of the CsSDG36 protein.

FIG. 4 shows the full-length CDS sequence of the CsSDG36 gene.

FIG. 5 shows the expression of the CsSDG36 gene of wild-type plants (WT) and two over-expression lines (OE1, OE2), with AtGADPH as the reference gene.

FIG. 6 shows the growth of wild type plants (WT) and two overexpression lines (OE1, OE2) after 6 days and 2 days of recovery from drought treatment (10% PEG 6000).

FIG. 7 is a graph of survival statistics for wild type plants (WT) and two over-expressing lines (OE1, OE2) at 6 days and 2 days of recovery from drought treatment (10% PEG 6000).

FIG. 8 shows the relative water content of leaves of wild type plants (WT) and two over-expressing lines (OE1, OE2) under drought treatment (10% PEG 6000).

FIG. 9 is a graph of stomata per area of leaves (A) and statistics of stomata number (B) for wild type plants (WT) and two over-expressed lines (OE1, OE 2).

FIG. 10 shows leaf SOD enzyme activity (A), root SOD enzyme activity (B), leaf POD enzyme activity (C), root POD enzyme activity (D), leaf CAT enzyme activity (E), root CAT enzyme activity (F), leaf MDA content (G), and root MDA content (H) of wild type plant (WT) and two overexpression strains (OE1, OE2) after drought treatment (10% PEG6000) for 3 days.

FIG. 11 shows the identification of the leaf differential expression genes (A), the identification of the root differential expression genes (B), the Wien diagram of the up-and down-regulated genes (C) of the leaves and roots, and the clustering results (D) of the differential expression genes of the leaves and roots of the over-expressed line (OE2) relative to the wild-type plant (WT).

Figure 12 is the GO pathway enrichment results for over-expressed line (OE2) significantly down-regulated genes relative to leaves of wild type plants (WT).

Detailed Description

The following examples are given to facilitate a better understanding of the invention, but do not limit the invention. The experimental procedures in the following examples are conventional unless otherwise specified. The test materials used in the following examples were purchased from a conventional biochemical reagent store unless otherwise specified. The quantitative tests in the following examples, all set up three replicates and the results averaged.

Columbia ecotype Arabidopsis is also called wild type Arabidopsis, and is expressed by WT.

A new protein is found from a national clone fine variety 'Fuding Dabai' of tea trees, and is named as CsSDG36 protein, and the sequence is shown in figure 1. The gene encoding the CsSDG36 protein was designated CsSDG36 gene, and the open reading frame is shown in fig. 2.

Example 1 identification of transgenic plants

1. The vector pCambia 1300s is utilized to carry hygromycin resistance, when in identification, sterilized Arabidopsis seeds are spread on an MS culture medium containing 50 mu g/mL hygromycin, dark treatment is carried out at 20 ℃ for 48h, then the seeds are cultured for 10-12d under the conditions that the temperature is 20 ℃ and the photoperiod is 16h/8h (light/dark), green plants with good growth of roots, stems and leaves are positive seedlings with successful transgenosis, and the green plants are transplanted into nutrient soil to be continuously cultured. The plant line of which the descendants are all green plants with good growth vigor is a homozygous plant line.

2. Extracting the DNA of the positive seedling of arabidopsis thaliana, amplifying a target gene by taking the DNA as a template, and screening the transgenic positive seedling.

The DNA extraction was performed by CTAB method and stored at-20 ℃ for subsequent PCR.

3. Total RNA of homozygous T3 transgenic Arabidopsis leaves was extracted, reverse-transcribed into cDNA, and the expression level of CsSDG36 gene was measured using primers primer-F (CATGCAGCGTGGATAAAATTT) and primer-R (GAACCTGTATGCGTCTCTCCCTAT) (see FIG. 3). The expression level of the CsSDG36 gene in the transgenic plant is obviously higher than that of the wild plant.

Example 2 drought tolerance testing of wild plants (WT) and two overexpression lines (OE1, OE2)

Homozygous T's from wild plants (WT) and two over-expressed lines (OE1, OE2) were selected₃Transgenic seeds are sown on a culture medium, and are transferred into Hoagland culture fluid to be cultured for one week after being cultured normally for 14 days, then the seeds are treated by PEG 10% culture fluid for 6 days and then are rehydrated by pure water for 2 days, and the growth condition of Arabidopsis thaliana is recorded by photographing (see figure 4) and the survival rate is counted (see figure 5). The drought tolerance of the transgenic plants (OE1, OE2) is significantly weaker than that of the wild plants (WT).

Example 3 detection of SOD, POD, CAT enzyme Activity and MDA content in wild plants (WT) and two overexpression lines (OE1, OE2) under drought treatment

Homozygous T's from wild plants (WT) and two over-expressed lines (OE1, OE2) were selected₃And (3) generating transgenic seeds, sowing the seeds on a culture medium, normally culturing for 14 days, transferring the seeds into Hoagland culture fluid, culturing for one week, treating the seeds with 10% PEG6000 culture fluid for 3 days, and detecting SOD, POD, CAT enzyme activity and MDA content of leaves and roots (see figure 6). Plasma membrane damage of transgenic plants (OE1, OE2) under drought conditions was significantly higher than that of wild plants (WT).

Example 4 GO pathway enrichment results with significant downregulation of expressed genes (OE1 vs. wt)

Selection of homozygous T from wild plants (WT) and over-expressed lines (OE1)₃And (3) generating transgenic seeds, sowing the transgenic seeds on a culture medium, normally culturing for 14d, extracting leaf RNA, carrying out reverse transcription to obtain cDNA, constructing a cDNA library, sequencing, and analyzing the GO path enrichment condition of an obviously down-regulated expression gene (OE1 vs. Movement of subcellular components and cytoskeleton-related pathways of the over-expressed strain (OE1) were significantly down-regulated.

The recombinant expression vector containing the gene can be constructed by using the existing plant expression vector.

The plant expression vector comprises a binary agrobacterium vector, a vector for plant microprojectile bombardment and the like. The plant expression vector may also comprise the 3' untranslated region of the foreign gene, i.e., a region comprising a polyadenylation signal and any other DNA segments involved in mRNA processing or gene expression. The polyadenylation signal can direct polyadenylation to the 3 'end of the mRNA precursor, and untranslated regions transcribed from the 3' end of Agrobacterium crown gall inducible (Ti) plasmid genes (e.g., nopalin synthase Nos), plant genes (e.g., soybean storage protein genes) all have similar functions.

The invention also provides application of at least one of the gene, the protein, the recombinant expression vector, the expression cassette, the transgenic cell line or the recombinant bacterium in drought tolerance of plants, in particular application in adjusting the drought tolerance of the plants.

The plants with abnormal drought resistance are plants with poor drought resistance; the drought tolerant normal plant is a drought tolerant normal-forming plant.

The above-mentioned embodiments are intended to illustrate the objects, technical solutions and advantages of the present invention in further detail, and it should be understood that the above-mentioned embodiments are only exemplary embodiments of the present invention and are not intended to limit the present invention, and any modifications, equivalents, improvements and the like made within the spirit and principle of the present invention should be included in the protection scope of the present invention.

Sequence listing

<110> institute of standardization of China

Huazhong Agricultural University

<120> application of plant drought-resistant related protein and coding gene thereof in plant drought resistance

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1045

<212> PRT

<213> tea plant (Camellia sinensis)

<400> 1

Met Ile Ile Lys Arg Asn Leu Lys Ser Val Met Pro Thr Leu Lys Arg

1 5 10 15

Cys Arg Val Gly Asp Ser Gly Gly Glu Glu Asn Glu Ser Ser Ala Lys

20 25 30

Arg Lys Lys Arg Lys Ile Asn Gly Tyr Phe Pro Leu Asn Leu Leu Gly

35 40 45

Glu Leu Ala Ala Gly Val Ile Pro Phe Gly Ile Tyr Gly Leu Leu Arg

50 55 60

Asn Ser Gly Glu Lys Arg Phe Gly Ala Asp Glu Val Asp Ser Lys Ser

65 70 75 80

Lys Lys Thr Lys Glu Ser Leu Lys Glu Arg Asn Ile Pro Glu Gln Glu

85 90 95

Ala Ser Arg Pro Pro Leu Val Arg Thr Ser Arg Gly Arg Val Gln Val

100 105 110

Leu Pro Ser Arg Phe Asn Asp Ser Ile Leu Asp Asn Trp Lys Lys Glu

115 120 125

Lys Ser Lys Ser Ser Val Arg Glu Ser Ser Leu Asp Pro Glu Phe Asn

130 135 140

Pro Tyr Val Glu Lys Tyr Ser Phe Lys Thr Pro Lys Leu Arg Ser Gln

145 150 155 160

Asn Lys Val Ser Tyr Gln Cys Cys Lys Leu Pro Pro Leu Leu Gly Glu

165 170 175

Gly Glu Glu Val Asn Cys Phe Asp Met Lys Lys Tyr Ser Ser Ser His

180 185 190

Ser Thr Ile Thr Ser Leu His Glu Gln Leu Asn Asp Thr Glu Arg Ser

195 200 205

Pro Ile Glu Lys Leu Glu Glu Pro Val Asp Leu Ala Gly Asn Asp Gly

210 215 220

Leu Leu Lys Glu Gly Glu Phe Val Ser Gly Asp Ile Val Trp Ala Met

225 230 235 240

Ser Gly Lys Asn Tyr Pro Ala Trp Pro Ala Ile Val Leu Asn Pro Leu

245 250 255

Thr Gln Ala Pro Gln Gln Val Leu Ser Phe Arg Val Thr Gly Ala Phe

260 265 270

Cys Val Met Phe Phe Gly Tyr Ser Gly Asn Gly Thr Gln Arg Asp Tyr

275 280 285

Ala Trp Val Lys Arg Gly Met Ile Phe Pro Phe Val Glu Tyr Val Asp

290 295 300

Arg Phe Gln Gly Gln Thr Asp Leu Asn Asp Ser Lys Pro Ser Asp Leu

305 310 315 320

Arg Ser Ala Ile Glu Glu Ala Phe Leu Ala Glu His Gly Phe Thr Glu

325 330 335

Met Leu Met Val Glu Ile Asn Ala Ala Ala Gly Asn Leu Gly Tyr Leu

340 345 350

Glu Ser Ile Arg Gly Gly Val Gln Glu Val Thr Gly Ser Asn Gln Asp

355 360 365

Gln Glu Cys Asn Ile His Asn Gln Asp Val Leu Lys Lys Lys Glu Thr

370 375 380

Trp Ser Cys Glu Ser Cys Gly Leu Asn Ile Leu Leu Lys Ser Ser Asn

385 390 395 400

Lys Met Lys Phe Ser Thr Pro Gly Ser Cys Leu Cys Asn Ser Cys Ala

405 410 415

Arg Leu Lys Lys Leu Lys His Ser Cys Gly Ile Cys Lys Lys Ile Arg

420 425 430

Asn His Leu Asp Ser Gly Ile Trp Val Arg Cys Asp Ser Cys Lys Val

435 440 445

Arg Val His Ala Ala Cys Asp Lys Ile Ser Ser Asn Leu Ser Lys Asp

450 455 460

Leu Gly Ala Thr Asp Tyr Tyr Cys Pro Glu Cys Arg Ala Lys Phe Asn

465 470 475 480

Phe Glu Leu Ser Asp Ser Glu Ile Cys Gln Pro Lys Val Lys Asn Asn

485 490 495

Asn Met Leu Pro Asp Lys Val Thr Val Val Cys Ser Gly Met Glu Gly

500 505 510

Val Tyr Ser Pro Ser Leu His Leu Val Val Cys Lys Cys Gly Ser Cys

515 520 525

Gly Thr Glu Lys Gln Ala Leu Ser Glu Trp Glu Arg His Thr Gly Ser

530 535 540

Lys Ala Lys Asn Trp Lys Thr Ser Val Arg Val Lys Gly Ser Met Leu

545 550 555 560

Thr Leu Glu Gln Trp Met Leu Gln Ile Ala Glu Tyr His Ala Arg Thr

565 570 575

Val Val Ser Ala Asn Ser Leu Lys Arg Pro Ser Ile Lys Ala Arg Lys

580 585 590

Gln Lys Leu Leu Thr Phe Leu Gln Ala Lys Tyr Glu Pro Ile Tyr Ala

595 600 605

Lys Trp Thr Thr Glu Arg Cys Ala Val Cys Arg Trp Val Glu Asp Trp

610 615 620

Asp Tyr Asn Lys Ile Ile Ile Cys Ile Arg Cys Gln Ile Ala Val His

625 630 635 640

Gln Glu Cys Tyr Gly Ala Arg Asn Val Lys Asp Phe Thr Ser Trp Val

645 650 655

Cys Arg Ala Cys Glu Thr Pro Asp Ile Lys Arg Glu Cys Cys Leu Cys

660 665 670

Pro Val Lys Gly Gly Ala Leu Lys Pro Thr Asp Val Glu Ser Leu Trp

675 680 685

Val His Val Thr Cys Ala Trp Phe Gln Pro Glu Val Ser Phe Ser Ser

690 695 700

Asp Glu Lys Met Glu Pro Ala Val Gly Ile Leu Arg Ile Pro Ser Asn

705 710 715 720

Ala Phe Ile Lys Ile Cys Val Val Cys Lys Gln Ile His Gly Ser Cys

725 730 735

Thr Gln Cys Cys Lys Cys Ser Thr Tyr Tyr His Ala Val Cys Ala Ser

740 745 750

Arg Ala Gly Tyr Arg Met Glu Leu His Cys Leu Glu Lys Asn Gly Lys

755 760 765

Gln Ile Thr Lys Met Val Ser Tyr Cys Ala Tyr His Arg Phe Pro Asn

770 775 780

Pro Asp Thr Val Leu Ile Ile Gln Thr Pro Leu Gly Val Phe Ser Thr

785 790 795 800

Lys Asn Leu Leu Gln Asp Lys Lys Gly Ser Gly Ser Arg Leu Ile Ser

805 810 815

Ser Asn Arg Leu Lys Leu Lys Glu Ala Pro Thr Ile Glu Ile Asn Glu

820 825 830

Ile Glu Pro Phe Ser Ala Ala Arg Cys Arg Thr Phe Lys Arg Leu Asn

835 840 845

Ser Lys Arg Thr Gly Glu Gln Ala Val Ala His His Val Met Arg Pro

850 855 860

Cys His His Ser Leu Ser Ala Met Gln Ile Leu Asn Thr Phe Arg Lys

865 870 875 880

Ile Asp Glu Pro Arg Ser Phe Ser Thr Phe Arg Glu Arg Leu His Gln

885 890 895

Leu Gln Arg Thr Glu Asn Asp Arg Val Cys Phe Gly Lys Ser Gly Ile

900 905 910

His Gly Trp Gly Leu Phe Ala Arg Arg Asn Ile Gln Glu Gly Glu Met

915 920 925

Val Leu Glu Tyr Arg Gly Glu Gln Val Arg Cys Ser Ile Ala Asp Leu

930 935 940

Arg Glu Ala Arg Tyr Arg Val Glu Gly Lys Asp Cys Tyr Leu Phe Lys

945 950 955 960

Ile Ser Glu Glu Val Val Val Asp Ala Thr Asp Lys Gly Asn Ile Ala

965 970 975

Arg Leu Ile Asn His Ser Cys Met Pro Asn Cys Tyr Ala Arg Ile Met

980 985 990

Ser Val Gly His Asp Glu Ser Arg Ile Val Leu Ile Ala Lys Thr Asn

995 1000 1005

Val Pro Ala Gly Asp Glu Leu Thr Tyr Asp Tyr Leu Phe Asp Thr Asp

1010 1015 1020

Glu Cys Asp Glu Phe Lys Val Pro Cys Leu Cys Lys Ala Pro Asn Cys

1025 1030 1035 1040

Arg Lys Phe Met Asn

1045

<210> 2

<211> 3138

<212> DNA/RNA

<213> tea plant (Camellia sinensis)

<400> 2

atgataatca agcgcaactt gaaatcggta atgccgactc tgaagcgatg cagagttggt 60

gattccggtg gtgaagaaaa cgagagttcc gcgaagagaa agaaacggaa aattaacggc 120

tattttcctc tgaatctgct cggtgagctc gccgccggtg taattccctt cggtatctac 180

gggctgttga ggaattccgg tgagaaacgt tttggcgcag atgaggtgga ttcgaaatcg 240

aagaagacta aggagagctt gaaggagcgc aacattccag aacaagaggc ttcacggccg 300

cctctcgtga ggacgtctcg gggacgagtt caggtacttc cttctagatt caatgattca 360

attcttgata attggaagaa ggagaagagt aaatctagtg ttagagaatc gagtttggac 420

cctgaattca atccctacgt tgagaaatac agcttcaaaa cccccaaact tcgttcacaa 480

aataaagtta gctatcaatg ttgtaaattg ccgccattgt taggggaagg tgaagaagtg 540

aattgttttg acatgaagaa gtattcgagt tcccatagta caataacgtc gctccatgag 600

caattgaatg acacagaaag gtccccgatt gagaaattgg aggaacctgt agatttggct 660

ggtaatgatg gattgttgaa ggagggtgag tttgtttcag gtgatatagt ttgggccatg 720

tcaggaaaga actatcctgc gtggccggct attgttctta atcctctaac acaagctccc 780

caacaagttc tgagttttcg ggttacaggt gcattttgtg tgatgttctt tggctactct 840

ggaaatggaa cgcaaaggga ttatgcttgg gttaaacgtg gaatgatatt tccatttgtg 900

gagtatgtag acaggtttca ggggcagaca gacttgaatg atagcaagcc cagcgatctt 960

cggtctgcaa tagaagaggc atttttggcg gagcatggct tcactgagat gttaatggtg 1020

gaaattaatg cggcagctgg aaatctaggt tatttagaat ctattcgtgg aggggtccag 1080

gaagttactg gttcaaatca ggatcaggaa tgcaacatcc ataaccagga tgtgcttaaa 1140

aagaaagaga catggtcctg tgaaagctgt ggattgaata ttttacttaa atcttccaat 1200

aaaatgaagt tttcaacccc gggaagctgc ctatgtaatt cctgtgctag gctaaaaaaa 1260

ttaaaacatt cttgtggcat atgcaagaag attaggaatc atttggacag tggcatttgg 1320

gtacgctgtg atagttgtaa agttagggtg catgcagcgt gtgataaaat ttctagcaat 1380

ctttccaagg atctgggggc cactgattat tactgccctg aatgcagagc aaagttcaat 1440

tttgaattat cagattcaga aatctgtcag cctaaagtca aaaacaataa tatgctgcct 1500

gacaaggtta cagtggtttg ctcgggcatg gaaggtgtat attctccaag ccttcattta 1560

gttgtctgca aatgtgggtc ctgtggaaca gaaaaacagg cacttagtga atgggagcgg 1620

catacaggtt cgaaagcaaa aaattggaag actagtgtca gggtgaaagg ttccatgtta 1680

acactagaac aatggatgct gcagatagca gagtatcatg cacgtactgt tgtttctgct 1740

aattctctta aacgcccttc aataaaagca cgaaagcaga agttgcttac ttttttgcaa 1800

gcaaaatatg agcccattta tgccaaatgg acaacagaac ggtgtgcagt atgtagatgg 1860

gttgaagatt gggactacaa caaaataatt atatgcatca gatgccaaat tgctgtccat 1920

caagaatgct atggagcaag aaatgttaaa gatttcactt cttgggtttg ccgagcatgt 1980

gagacacctg atatcaagcg ggagtgttgc ctctgtcctg taaaaggagg tgctttgaaa 2040

cctactgatg ttgagtcatt gtgggttcat gttacttgtg cttggtttca acctgaagtt 2100

tctttctcaa gtgatgaaaa gatggagcct gctgtgggaa tcttgagaat tccatcaaat 2160

gcttttataa agatctgtgt agtctgtaag caaattcatg gttcctgcac acagtgttgc 2220

aagtgttcca cttattacca tgctgtgtgt gcatcaaggg ctgggtatcg tatggagttg 2280

cattgcttgg aaaaaaatgg gaaacaaatt acaaaaatgg tttcgtattg tgcttatcac 2340

aggtttccaa atccagatac cgttctaatc atacagactc ctctgggggt tttttctacc 2400

aaaaaccttc tccaagacaa aaaaggcagt ggttcaaggc taatttcatc taacagattg 2460

aaacttaaag aagcgccaac aatagagatc aatgagattg agccattttc tgctgcaaga 2520

tgtcggacct tcaaacgatt gaatagtaag aggacaggag aacaggccgt tgctcatcat 2580

gtgatgagac cttgccatca ctctttaagt gcaatgcaaa tactgaacac tttcagaaaa 2640

atagatgagc ctagatcctt ttctactttc agggaacggc tgcaccagtt acagagaaca 2700

gagaatgatc gggtttgctt tgggaaatct ggaattcatg gatggggcct ctttgcacgt 2760

cggaacatcc aagaaggaga aatggttctt gaatatcggg gtgaacaggt taggtgtagt 2820

attgctgatt tgagggaagc tcgctaccga gtggaaggca aagattgcta tctgtttaag 2880

atcagtgaag aagttgttgt ggatgccaca gataagggaa acattgcacg tttaatcaac 2940

cattcgtgta tgcccaactg ctatgcaagg atcatgagtg tgggtcatga tgagagtagg 3000

atcgtgctta ttgccaagac taacgtgcct gctggtgatg agttaacgta cgattactta 3060

tttgatactg acgagtgtga cgaattcaaa gtcccttgct tgtgtaaagc tccaaactgc 3120

aggaagttca tgaattag 3138

Claims (7)

1. A protein characterized by: the amino acid sequence of the protein is shown as SEQ ID NO. 1.

2. Use of a protein according to claim 1 for reducing drought tolerance in plants.

3. A drought-tolerant breeding method comprises the following steps: increasing the activity or content of the protein of claim 1 in the target plant, thereby reducing the drought tolerance of the plant.

4. A gene encoding the protein of claim 1, wherein: the nucleotide sequence of the gene is SEQ ID NO. 2.

5. An expression cassette, recombinant vector or recombinant bacterium comprising the gene of claim 4.

6. Use of the gene of claim 4 for the production of transgenic plants with reduced drought tolerance.

7. A method of making a transgenic plant comprising the steps of: a transgenic plant with reduced drought tolerance, which is obtained by introducing the gene of claim 4 into a plant.

Images